Neomycin-neomycin dimer: an all-carbohydrate scaffold with high affinity for AT-rich DNA duplexes

A dimeric neomycin-neomycin conjugate 3 with a flexible linker, 2,2'-(ethylenedioxy)bis(ethylamine), has been synthesized and characterized. Dimer 3 can selectively bind to AT-rich DNA duplexes with high affinity. Biophysical studies have been performed between 3 and different nucleic acids with varying base composition and conformation by using ITC (isothermal calorimetry), CD (circular dichroism), FID (fluorescent intercalator displacement), and UV (ultraviolet) thermal denaturation experiments. A few conclusions can be drawn from this study: (1) FID assay with 3 and polynucleotides demonstrates the preference of 3 toward AT-rich sequences over GC-rich sequences. (2) FID assay and UV thermal denaturation experiments show that 3 has a higher affinity for the poly(dA)·poly(dT) DNA duplex than for the poly(dA)·2poly(dT) DNA triplex. Contrary to neomycin, 3 destabilizes poly(dA)·2poly(dT) triplex but stabilizes poly(dA)·poly(dT) duplex, suggesting the major groove as the binding site. (3) UV thermal denaturation studies and ITC experiments show that 3 stabilizes continuous AT-tract DNA better than DNA duplexes with alternating AT bases. (4) CD and FID titration studies show a DNA binding site size of 10-12 base pairs/drug, depending upon the structure/sequence of the duplex for AT-rich DNA duplexes. (5) FID and ITC titration between 3 and an intramolecular DNA duplex [d(5'-A(12)-x-T(12)-3'), x = hexaethylene glycol linker] results in a binding stoichiometry of 1:1 with a binding constant ～10(8) M(-1) at 100 mM KCl. (6) FID assay using 3 and 512 hairpin DNA sequences that vary in their AT base content and placement also show a higher binding selectivity of 3 toward continuous AT-rich than toward DNA duplexes with alternate AT base pairs. (7) Salt-dependent studies indicate the formation of three ion pairs during binding of the DNA duplex d[5'-A(12)-x-T(12)-3'] and 3. (8) ITC-derived binding constants between 3 and DNA duplexes have the following order: AT continuous, d[5'-G(3)A(5)T(5)C(3)-3'] > AT alternate, d[5'-G(3)(AT)(5)C(3)-3'] > GC-rich d[5'-A(3)G(5)C(5)T(3)-3']. (9) 3 binds to the AT-tract-containing DNA duplex (B* DNA, d[5'-G(3)A(5)T(5)C(3)-3']) with 1 order of magnitude higher affinity than to a DNA duplex with alternating AT base pairs (B DNA, d[5'-G(3)(AT)(5)C(3)-3']) and with almost 3 orders of magnitude higher affinity than a GC-rich DNA (A-form, d[5'-A(3)G(5)C(5)T(3)-3']).     

Identification of miR-23a as a novel microRNA normalizer for relative quantification in human uterine cervical tissues

Quantitative real-time RT-PCR (RT-qPCR) is being widely used in microRNA expression research. However, few reports detailed a robust identification and validation strategy for suitable reference genes for normalisation in microRNA RT-qPCR studies. The aim of this study was to identify the most stable reference gene(s) for quantification of microRNA expression analysis in uterine cervical tissues. A microarray was performed on 6 pairs of uterine cervical tissues to identify the candidate reference genes. The stability of candidate reference genes was assessed by RT-qPCR in 23 pairs of uterine cervical tissues. The identified most stable reference genes were further validated in other cohort of 108 clinical uterine cervical samples: (HR-HPV- normal, n=21; HR-HPV+ normal, n=19; cervical intraepithelial neoplasia [CIN], n=47; cancer, n=21), and the effects of normalizers on the relative quantity of target miR-424 were assessed. In the array experiment, miR-26a, miR-23a, miR-200c, let-7a, and miR-1979 were identified as candidate reference genes for subsequent validation. MiR-23a was identified as the most reliable reference gene followed by miR-191. The use of miR-23a and miR-191 to normalize expression data enabled detection of a significant dereg-ulation of miR-424 between normal, CIN and cancer tissue. Our results suggested that miR-23a and miR-191 are the optimal reference microRNAs that can be used for normalization in profiling studies of cervical tissues; miR-23a is a novel microRNA normalizer.     

In-silico investigations of selective miRNA-gene targets and their validation studies in obstructive sleep apnea (OSA) patient cohorts

BackgroundObstructive sleep apnoea (OSA) is a prevalent form of sleep disordered breathing which results in sleep fragmentation and deprivation. Obesity and cardiovascular disorders are the major risk factors associated with OSA. Molecular analysis of the factors associated with OSA could demarcate the clinical analysis pattern in a population.ObjectiveThis study pertains to in-silico analyses of miRNA and their gene targets with validation for their potential role in OSA as putative biomarker candidates.MethodsmiRDB, TargetScan and miRanda databases were used to identify targets of miR-27 and let-7 that have documented role in OSA and co-related obesity and cardiovascular disorders. Quantitative PCR was used to analyze expression pattern of miR-27 and let-7 in obese and non-obese OSA patient cohorts with respective controls. In-silico analysis was done using PatchDoc to obtain atomic contact energy (ACE) scores that indicated the docked gene targets to the predicted miRNA structures. The docked structures were analysed using Maestro Suite 11 for the hydrogen and aromatic interactions.ResultsDownregulation of miR-27 and let-7 in OSA compared to controls was observed. In-silico data analysis was performed for gene targets (TGFBR1, TGFBR2, SMAD2, SMAD4, CRY2 and CNR1) of the selected miRNAs (miR-27 and let-7). Among all, CNR1 and CRY2 were found to be better targets for miR-27 and let-7 respectively as per ACE scores, ROC scores and expression fold change in OSA.ConclusionOur study gives insights to the expression profiling of miR-27 and let-7 and explore a set of potential target genes (CNR1 and CRY2) of these two miRNAs for a promising clinical relevance in OSA.     

NMR studies of DNA single strands and DNA:RNA hybrids with and without 1-propynylation at C5 of oligopyrimidines

The 1-propynylation at C5 of consecutive pyrimidines in DNA can enhance DNA:RNA hybrid stability at 37 degrees C by over 1 kcal/mol of substitution [Barnes, T. W., III; Turner, D. H. J. Am. Chem. Soc.2001, 123, 4107-4118]. To provide information on the structural consequences of propynylation, two-dimensional NMR spectroscopy was used to study the structures of several oligonucleotides. Intraresidue nuclear Overhauser effect spectroscopy cross peaks were observed at 30 degrees C and a 200 ms mixing time in the H6-H1' region for 5'(dC(P)C(P)U(P)C(P)C(P)U(P)U(P)) (ssPrODN) but not for 5'(dCCUCCUU) (ssODN), suggesting preorganization of the propynylated single strand. NMR structures of the duplexes 5'(dC(P)C(P)U(P)C(P)C(P)U(P)U(P))3':3'(rGAGGAGGAAAU)5' (PrODN:RNA), 5'(dCC(P)U(P)C(P)C(P)U(P)U(P))3':3'(rGAGGAGGAAAU)5' (sPrODN1:RNA), and 5'(dCCUCCUU)3':3'(rGAGGAGGAAAU)5' (ODN:RNA) indicate that their global structures are almost identical. The NMR data, however, suggest that the 5'-end of sPrODN1:RNA is more dynamic than that of PrODN:RNA. In the propynylated duplexes, the propyne group stacks on the aromatic ring of the 5'-base and extends into the major groove. The results suggest that the increased stability of the propynylated duplexes is caused by preorganization of the propynylated single strand and different interactions in the double strand. The propynyl group provides volume exclusion, enhanced stacking, and possibly different solvation.     

Screening of threading bis-intercalators binding to duplex DNA by electrospray ionization tandem mass spectrometry

The DNA binding of novel threading bis-intercalators V1, trans-D1, and cis-C1, which contain two naphthalene diimide (NDI) intercalation units connected by a scaffold, was evaluated using electrospray ionization mass spectrometry (ESI-MS) and DNAse footprinting techniques. ESI-MS experiments confirmed that V1, the ligand containing the -Gly3-Lys- peptide scaffold, binds to a DNA duplex containing the 5'-GGTACC-3' specific binding site identified in previous NMR-based studies. The ligand formed complexes with a ligand/DNA binding stoichiometry of 1:1, even when there was excess ligand in solution. Trans-D1 and cis-C1 are new ligands containing a rigid spiro-tricyclic scaffold in the trans- and cis- orientations, respectively. Preliminary DNAse footprinting experiments identified possible specific binding sites of 5'-CAGTGA-5' for trans-D1 and 5'-GGTACC-3' for cis-C1. ESI-MS experiments revealed that both ligands bound to DNA duplexes containing the respective specific binding sequences, with cis-C1 exhibiting the most extensive binding based on a higher fraction of bound DNA value. Cis-C1 formed complexes with a dominant 1:1 binding stoichiometry, whereas trans-D1 was able to form 2:1 complexes at ligand/DNA molar ratios >or=1 which is suggestive of nonspecific binding. Collisional activated dissociation (CAD) experiments indicate that DNA complexes containing V1, trans-D1, and cis-C1 have a unique fragmentation pathway, which was also observed for complexes containing the commercially available bis-intercalator echinomycin, as a result of similar binding interactions, marked by intercalation in addition to hydrogen bonding by the scaffold with the DNA major or minor groove.     

Effect of secondary structure on the thermodynamics and kinetics of PNA hybridization to DNA hairpins.

The binding of a series of PNA and DNA probes to a group of unusually stable DNA hairpins of the tetraloop motif has been observed using absorbance hypochromicity (ABS), circular dichroism (CD), and a colorimetric assay for PNA/DNA duplex detection. These results indicate that both stable PNA-DNA and DNA-DNA duplexes can be formed with these target hairpins, even when the melting temperatures for the resulting duplexes are up to 50 degrees C lower than that of the hairpin target. Both hairpin/single-stranded and hairpin/hairpin interactions are considered in the scope of these studies. Secondary structures in both target and probe molecules are shown to depress the melting temperatures and free energies of the probe-target duplexes. Kinetic analysis of hybridization yields reaction rates that are up to 160-fold slower than hybridization between two unstructured strands. The thermodynamic and kinetic obstacles to hybridization imposed by both target and probe secondary structure are significant concerns for the continued development of antisense agents and especially diagnostic probes.     

miR-9 and let-7g enhance the sensitivity to ionizing radiation by suppression of NFκB1

The activation of nuclear factor-kappa B1 (NFkB1) in cancer cells may confer resistance to ionizing radiation (IR). To enhance the therapeutic efficiency of IR in lung cancer, we screened for microRNAs (miRNAs) that suppress NFkB1 and observed their effects on radiosensitivity in a human lung cancer cell line. From time series data of miRNA expression in γ-irradiated H1299 human lung cancer cells, we found that the expression of miR-9 was inversely correlated with that of NFκB1. Overexpression of miR-9 down-regulated the level of NFκB1 in H1299 cells, and the surviving fraction of γ-irradiated cells was decreased. Interestingly, let-7g also suppressed the expression of NFκB1, although there was no canonical target site for let-7g in the NFκB1 3' untranslated region. From these results, we conclude that the expression of miR-9 and let-7g could enhance the efficiency of radiotherapy for lung cancer treatment through the inhibition of NFκB1.     

Long-range cooperativity in molecular recognition of RNA by oligodeoxynucleotides with multiple C5-(1-propynyl) pyrimidines.

A heptamer composed of C5-(1-propynyl) pyrimidines (Y(p)'s) is a potent and specific antisense agent against the mRNA of SV40 large T antigen (Wagner, R. W.; Matteucci, M. D.; Grant, D.; Huang, T.; Froehler, B. C. Nat. Biotechnol. 1996, 14, 840-844). To characterize the role of the propynyl groups in molecular recognition, thermodynamic increments associated with substitutions in DNA:RNA duplexes, such as 5'-dCCUCCUU-3':3'-rGAGGAGGAAAU-5', have been measured by UV melting experiments. For nucleotides tested, an unpaired dangling end stabilizes unmodified and propynylated duplexes similarly, except that addition of a 5' unpaired rA is 1.4 kcal/mol more stabilizing on the propynylated, PODN:RNA, duplex than on the DNA:RNA duplex. Free energy increments for addition of single propynyl groups range from 0 to -4.0 kcal/mol, depending on the final number and locations of substitutions. A preliminary model for predicting the stabilities of Y(p)-containing hybrid duplexes is presented. Eliminating one amino group, and therefore a hydrogen bond, by substituting inosine (I) for guanosine (G), to give 5'-dC(p)C(p)U(p)C(p)C(p)U(p)U(p)-3':3'-rGAGIAGGAAAU-5', destabilizes the duplex by 3.9 kcal/mol, compared to 1.7 kcal/mol for the same change within the unpropynylated duplex. This 2.2 kcal/mol difference is eliminated by removing a single propynyl group three base pairs away. CD spectra suggest that single propynyl deletions within the PODN:RNA duplex have position-dependent effects on helix geometry. The results suggest long-range cooperativity between propynyl groups and provide insights for rationally programming oligonucleotides with enhanced binding and specificity. This can be exploited in developing technologies that are dependent upon nucleic acid-based molecular recognition.     

Solid-phase synthesis of positively charged deoxynucleic guanidine (DNG) tethering a Hoechst 33258 analogue: triplex and duplex stabilization by simultaneous minor groove binding

Deoxynucleic guanidine (DNG), a DNA analogue in which positively charged guanidine replaces the phosphodiester linkages, tethering to Hoechst 33258 fluorophore by varying lengths has been synthesized. A pentameric thymidine DNG was synthesized on solid phase in the 3' --> 5' direction that allowed stepwise incorporation of straight chain amino acid linkers and a bis-benzimidazole (Hoechst 33258) ligand at the 5'-terminus using PyBOP/HOBt chemistry. The stability of (DNA)(2).DNG-H triplexes and DNA.DNG-H duplexes formed by DNG and DNG-Hoechst 33258 (DNG-H) conjugates with 30-mer double-strand (ds) DNA, d(CGCCGCGCGCGCGAAAAACCCGGCGCGCGC)/d(GCGGCGCGCGCGCTTTTTGGGCCGCGCGCG), and single-strand (ss) DNA, 5'-CGCCGCGCGCGCGAAAAACCCGGCGCGCGC-3', respectively, has been evaluated by thermal melting and fluorescence emission experiments. The presence of tethered Hoechst ligand in the 5'-terminus of the DNG enhances the (DNA)(2).DNG-H triplex stability by a DeltaT(m) of 13 degrees C. The fluorescence emission studies of (DNA)(2).DNG-H triplex complexes show that the DNG moiety of the conjugates bind in the major groove while the Hoechst ligand resides in the A:T rich minor groove of dsDNA. A single G:C base pair mismatch in the target site decreases the (DNA)(2).DNG triplex stability by 11 degrees C, whereas (DNA)(2).DNG-H triplex stability was decreased by 23 degrees C. Inversion of A:T base pair into T:A base pair in the center of the binding site, which provides a mismatch selectively for DNG moiety, decreases the triplex stability by only 5-6 degrees C. Upon hybridization of DNG-Hoechst conjugates with the 30-mer ssDNA, the DNA.DNG-H duplex exhibited significant increase in the fluorescence emission due to the binding of the tethered Hoechst ligand in the generated DNA.DNG minor groove, and the duplex stability was enhanced by DeltaT(m) of 7 degrees C. The stability of (DNA)(2).DNG triplexes and DNA.DNG duplexes is independent of pH, whereas the stability of (DNA)(2).DNG-H triplexes decreases with increase in pH.     

How do size-expanded DNA nucleobases enhance duplex stability? Computational analysis of the hydrogen-bonding and stacking ability of xDNA bases

Computational chemistry (B3LYP, MP2) is used to study the properties of size-expanded DNA nucleobases generated by inserting a benzene spacer into the natural nucleobases. Although the addition of the spacer does not significantly affect the hydrogen-bonding properties of natural nucleobases, the orientation of the base about the glycosidic bond necessary for Watson-Crick binding is destabilized, which could have implications for the selectivity of expanded bases, as well as the stability of expanded duplexes. Consideration of the (stacked) binding energies in the preferred relative orientation of natural and expanded nucleobases aligned according to their centers of mass reveals that the stacking within natural dimers can be increased by up to 50% upon expansion of one nucleobase and up to 90% upon expansion of two nucleobases. The implications of these findings to the stability of expanded duplexes were revealed by considering simplified models of natural and mixed duplexes composed of four nucleobases. Although intra- and interstrand interactions within double helices are typically less than those predicted when nucleobases are stacked according to their centers of mass, some nucleobases utilize their full stacking potential within double helices, where both intra- and interstrand interactions can be significant. Most importantly, increasing the size of nucleobases within the duplex significantly increases both intra- and interstrand stacking interactions. Specifically, some interactions are double the magnitude of the corresponding intrastrand interactions in natural helices, and even greater increases in interstrand interactions are sometimes found. Thus, our work suggests that mixed duplexes composed of natural bases hydrogen bound to expanded bases may exploit the increase in the inherent stacking ability of the expanded bases in more than one way and thereby afford duplexes with greater stability than natural DNA.     

Influence of initial charge state on fragmentation patterns for noncovalent drug/DNA duplex complexes

The charge state-dependent dissociation of various DNA duplexes and drug/duplex complexes has been investigated using collisionally activated dissociation (CAD) in a quadrupole ion trap mass spectrometer (QIT-MS). Several non-self-complementary 14-residue oligonucleotides were employed, in addition to an array of known DNA-interactive ligands, including the intercalators daunomycin and nogalamycin, as well as the minor groove binding agents distamycin, netropsin, 4',6-diamidino-2-phenylindole, and Hoechst 33342. In general, the dissociation pathways exhibited by both the duplexes and the drug/duplex complexes were found to be markedly sensitive to initial charge state. Time- and activation voltage-independent duplex strand separation predominated for higher charge states, which was interpreted to be a result of internal Coulombic repulsion or partial unzipping in the interface, while time- and activation voltage-dependent covalent cleavage predominated for lower charge states. The identity of the drug and the sequence of the duplex were both found to affect the competition between different dissociation processes. The dissociation pathways for the lower charge state complexes are probably more reflective of specific drug-DNA interactions because Coulombic and/or conformational effects are less marked for these precursors.     

Amplified electrochemical detection of nucleic acid hybridization via selective preconcentration of unmodified gold nanoparticles

The common drawback of optical methods for rapid detection of nucleic acid by exploiting the differential affinity of single-/double-stranded nucleic acids for unmodified gold nanoparticles (AuNPs) is its relatively low sensitivity. In this article, on the basis of selective preconcentration of AuNPs unprotected by single-stranded DNA (ssDNA) binding, a novel electrochemical strategy for nucleic acid sequence identification assay has been developed. Through detecting the redox signal mediated by AuNPs on 1, 6-hexanedithiol blocked gold electrode, the proposed method is able to ensure substantial signal amplification and a low background current. This strategy is demonstrated for quantitative analysis of the target microRNA (let-7a) in human breast adenocarcinoma cells, and a detection limit of 16 fM is readily achieved with desirable specificity and sensitivity. These results indicate that the selective preconcentration of AuNPs for electrochemical signal readout can offer a promising platform for the detection of specific nucleic acid sequence.     

Structural and binding study of modified siRNAs with the Argonaute 2 PAZ domain by NMR spectroscopy

By using high-resolution NMR spectroscopy, the structures of a natural short interfering RNA (siRNA) and of several altritol nucleic acid (ANA)-modified siRNAs were determined. The interaction of modified siRNAs with the PAZ domain of the Argonaute 2 protein of Drosophila melanogaster was also studied. The structures show that the modified siRNA duplexes (ANA/RNA) adopt a geometry very similar to the naturally occurring A-type siRNA duplex. All ribose residues, except for the 3' overhang, show 3'-endo conformation. The six-membered altritol sugar in ANA occurs in a chair conformation with the nucleobase in an axial position. In all siRNA duplexes, two overhanging nucleotides at the 3' end enhance the stability of the first neighboring base pair by a stacking interaction. The first overhanging nucleotide has a rather fixed position, whereas the second overhanging nucleotide shows larger flexibility. NMR binding studies of the PAZ domain with ANA-modified siRNAs demonstrate that modifications in the double-stranded region of the antisense strand have some small effects on the binding affinity as compared with the unmodified siRNA. Modification of the 3' overhang with thymidine (dTdT) residues shows a sixfold increase in the binding affinity compared with the unmodified siRNA (relative binding affinity of 17% compared with dTdT-modified overhang), whereas modification of the 3' overhang with ANA largely decreases the binding affinity.     

A pyrazine-based fluorescence-enhancing ligand with a high selectivity for thymine in AP site-containing DNA duplexes

A fluorescent pyrazine derivative, 3,5-diamino-6-chloro-2-pyrazine carbonitrile (DCPC), is presented as a promising light-up ligand for single-nucleotide polymorphisms (SNPs) typing. In solutions buffered to pH 7.0 (I = 0.11 M, at 5 degrees C), DCPC can bind to thymine selectively over other nucleobases opposite an abasic site in DNA duplexes (5'-GTGTG CGTTG ANA TGGAC GCAGA-3'/3'-CACAC GCAAC TXT ACCTG CGTCT-5', X = abasic site, N = target nucleotide) with a dissociation constant of 2.6 microM. The binding of DCPC is accompanied by a significant enhancement of its fluorescence (lambda(max), 412 nm), and the response is highly selective to thymine base. These binding and sensing properties allow a clear detection of thymine-related mutations present in polymerase chain reaction (PCR) amplification products.     

Synthesis and modelling of DNA junction and minor groove zipper motifs incorporating the double-headed nucleoside 5'(S)-C-(thymine-1-ylmethyl)thymidine

A nucleoside with two nucleobases, a so-called double-headed nucleoside, 5'(S)-C-(thymine-1-ylmethyl)thymidine 3, is synthesised and incorporated into oligonucleotides. The additional nucleobase is hereby positioned in the minor groove of the duplexes, which are formed with complementary DNA and RNA-sequences. Slight thermal destabilisation of these duplexes as compared to unmodified duplexes is observed. With other target sequences forming bulged duplexes or three-way junctions, no additional influence of the additional base on the thermal stability is observed. On the other hand, a base-base stacking interaction and subsequent stabilisation is observed when two double-headed nucleotide moieties are positioned in two complementary DNA-sequences forming a DNA-zipper motif.     

Dumbbell probe-mediated cascade isothermal amplification: A novel strategy for label-free detection of microRNAs and its application to real sample assay

Considering the great significance of microRNAs (miRNAs) in cancer detection and typing, the development of sensitive, specific, quantitative, and low-cost methods for the assay of expression levels of miRNAs is desirable. We describe a highly efficient amplification platform for ultrasensitive analysis of miRNA (taking let-7a miRNA as a model analyte) based on a dumbbell probe-mediated cascade isothermal amplification (DP-CIA) strategy. The method relies on the circularization of dumbbell probe by binding target miRNA, followed by rolling circle amplification (RCA) reaction and an autonomous DNA machine performed by nicking/polymerization/displacement cycles that continuously produces single-stranded G-quadruplex to assemble with hemin to generate a color signal. In terms of the high sensitivity (as low as 1 zmol), wide dynamic range (covering 9 orders of magnitude), good specificity (even single-base difference) and easy operation (one probe and three enzymes), the proposed label-free assay is successfully applied to direct detection of let-7a miRNA in real sample (total RNA extracted from human lung tissue), demonstrating an attractive alternative for miRNA analysis for gene expression profiling and molecular diagnostics, particularly for early cancer diagnosis.     

Specific and Direct Amplified Detection of MicroRNA with MicroRNA:Argonaute‐2 Cleavage (miRACle) Beacons

MicroRNA detection is a valuable method for determining cell identity. Molecular beacons are elegant sensors that can transform intracellular microRNA concentration into a fluorescence intensity. While target binding enhances beacon fluorescence, the degree of enhancement is insufficient for demanding applications. The addition of specialty nucleases can enable target recycling and signal amplification, but this process complicates the assay. We have developed and characterized a class of beacons that are susceptible to the endogenous nuclease Argonaute‐2 (Ago2). After purification of the complex by co‐immunoprecipitation, microRNA:Ago2 cleavage (miRACle) beacons undergo site‐ and sequence‐specific cleavage, and show a 13‐fold fluorescence enhancement over traditional beacons. The system can be adapted to any microRNA sequence, and can cleave nuclease‐resistant, non‐RNA bases, potentially allowing miRACle beacons to be designed for cells without interference from non‐specific nucleases.     

Probing the nature of three-centered hydrogen bonds in minor-groove ligand-DNA interactions: the contribution of fluorine hydrogen bonds to complex stability

Double-stranded DNA sequences have been prepared in which single atoms (the O2-carbonyls of selected thymines) have been replaced by fluorine or methyl. To maintain normal Watson-Crick hydrogen bonding with the complementary purines, these analogue derivatives have been prepared as C-nucleosides. The O2-carbonyls of interest for this study are those involved in a bifurcated (or three-centered) hydrogen bond with the minor groove binding ligand 4',6-diamidino-2-phenylindole (DAPI). TM studies of the duplexes illustrate that the DNA duplexes are destabilized when fluorine or methyl replaces one or both of the minor groove O2-carbonyls, which can in part be explained by changes in minor groove hydration. In the presence of DAPI, most of the duplexes exhibit an increased TM due to the presence of DAPI bound in the minor groove. The extent of helix overstabilization negatively correlates with the presence of one or both methyl groups in the minor groove, suggesting that ligand binding is weakened in the presence of the non-carbonyl functional groups. The presence of single fluorine appears to promote helix stabilization, and native-like stabilization occurs when both fluorines are present. KD values quantitate binding effects between DAPI and the native and analogue sequences. Sequences with one or both methyl groups exhibit very poor binding with DAPI, while those containing a single fluorine behave essentially like native carbonyl-containing sequences. With both fluorines present, KD values were observed to increase by a moderate 3-fold at 100 mM NaCl and somewhat more at 200 mM NaCl. Binding affinities with both methyl groups present were 500-1000-fold weaker than native. The results suggest that organofluorines can function as hydrogen-bond acceptors, at least in the bifurcated interaction that contributes to minor groove binding by DAPI.     

Marked dependence on carrier-ligand bulk but not on carrier-ligand chirality of the duplex versus single-strand forms of a DNA oligonucleotide with a series of G-Pt(II)-G intrastrand cross-links modeling cisplatin-DNA adducts

The N7-Pt-N7 adjacent G,G intrastrand DNA cross-link responsible for cisplatin anticancer activity is dynamic, promotes local "melting" in long DNA, and converts many oligomer duplexes to single strands. For 5'-d(A1T2G3G4G5T6A7C8C9C10A11T12)-3' (G3), treatment of the (G3)2 duplex with five pairs of [LPt(H2O)2]2+ enantiomers (L = an asymmetric diamine) formed mixtures of LPt-G3 products (1 Pt per strand) cross-linked at G3,G4 or at G4,G5 in all cases. L chirality exerted little influence. For primary diamines L with bulk on chelate ring carbons (e.g., 1,2-diaminocyclohexane), the duplex was converted completely into single strands (G3,G4 coils and G4,G5 hairpins), exactly mirroring results for cisplatin, which lacks bulk. In sharp contrast, for secondary diamines L with bulk on chelate ring nitrogens (e.g., 2,2'-bipiperidine, Bip), unexpectedly stable duplexes having two platinated strands (even a unique G3,G4/G4,G5 heteroduplex) were formed. After enzymatic digestion of BipPt-G3 duplexes, the conformation of the relatively nondynamic G,G units was shown to be head-to-head (HH) by HPLC/mass spectrometric characterization. Because the HH conformation dominates at the G,G lesion in duplex DNA and in the BipPt-G3 duplexes, the stabilization of the duplex form only when the L nitrogen adducts possess bulk suggests that H-bonding interactions of the Pt-NH groups with the flanking DNA lead to local melting and to destabilization of oligomer duplexes. The marked dependence of adduct properties on L bulk and the minimal dependence on L chirality underscore the need for future exploration of the roles of the L periphery in affecting anticancer activity.