Design of new bidentate ligands constructed of two Hoechst 33258 units for discrimination of the length of two A3T3 binding motifs

[structure: see text] The aim of this study is to develop bidentate minor-groove binders that bind the double binding motifs cooperatively. The new bidentate ligands (1) have been designed by connecting two Hoechst 33258 units with a polyether linker for cooperative binding with two remote A3T3 sites of DNA. The linker is introduced to the benzimidazole ring so that it is located at the convex side of the Hoechst unit. DNA binding affinity of the ligands was evaluated by measuring surface plasmon resonance (SPR), circular dichroism, and fluorescence spectra. Interestingly, the bidentate ligands (1) did not show affinity to DNA1 with a single A3T3 motif but showed selective affinity to DNA2 with two A3T3 motifs. The Long Bis-H (1L) having a long polyether linker showed specific binding to DNA2(6) with two A3T3 motifs separated by six nonbinding base pairs. The Long Bis-H (1L) has also shown specific binding to the three-way junction DNA4 with two A3T3 motifs. This study has demonstrated that DNA with double binding motifs can be selectively recognized by the newly designed bidentate ligands.     

Interaction with plasmid DNA of Hoechst-TACN conjugates

ABSTRACT

A new family of conjugates between the Hoechst minor groove binder and the TACN metal ion ligand connected through hydrophobic alkyl or more hydrophilic oxyethyl linkers of different length has been prepared. The linkers are connected to the convex side of the Hoechst skeleton thus forcing the TACN ligand to exit the minor groove and interact with the phosphate backbone of DNA. The conjugates preserve the binding mode of Hoechst with an affinity influenced by the nature of the linker, the more hydrophobic being the more efficient. Coordination of Cu(II) or Zn(II) poorly affect these parameters. Nevertheless, the Zn(II) complex bearing a C6 linear alkyl linker induced a modest but reproducible acceleration of the hydrolytic cleavage of DNA which can be ascribed to the ability of the conjugate to deliver the hydrolytic subunit close to the DNA phosphodiester bonds.     

Solid-phase synthesis of positively charged deoxynucleic guanidine (DNG) tethering a Hoechst 33258 analogue: triplex and duplex stabilization by simultaneous minor groove binding

Deoxynucleic guanidine (DNG), a DNA analogue in which positively charged guanidine replaces the phosphodiester linkages, tethering to Hoechst 33258 fluorophore by varying lengths has been synthesized. A pentameric thymidine DNG was synthesized on solid phase in the 3' --> 5' direction that allowed stepwise incorporation of straight chain amino acid linkers and a bis-benzimidazole (Hoechst 33258) ligand at the 5'-terminus using PyBOP/HOBt chemistry. The stability of (DNA)(2).DNG-H triplexes and DNA.DNG-H duplexes formed by DNG and DNG-Hoechst 33258 (DNG-H) conjugates with 30-mer double-strand (ds) DNA, d(CGCCGCGCGCGCGAAAAACCCGGCGCGCGC)/d(GCGGCGCGCGCGCTTTTTGGGCCGCGCGCG), and single-strand (ss) DNA, 5'-CGCCGCGCGCGCGAAAAACCCGGCGCGCGC-3', respectively, has been evaluated by thermal melting and fluorescence emission experiments. The presence of tethered Hoechst ligand in the 5'-terminus of the DNG enhances the (DNA)(2).DNG-H triplex stability by a DeltaT(m) of 13 degrees C. The fluorescence emission studies of (DNA)(2).DNG-H triplex complexes show that the DNG moiety of the conjugates bind in the major groove while the Hoechst ligand resides in the A:T rich minor groove of dsDNA. A single G:C base pair mismatch in the target site decreases the (DNA)(2).DNG triplex stability by 11 degrees C, whereas (DNA)(2).DNG-H triplex stability was decreased by 23 degrees C. Inversion of A:T base pair into T:A base pair in the center of the binding site, which provides a mismatch selectively for DNG moiety, decreases the triplex stability by only 5-6 degrees C. Upon hybridization of DNG-Hoechst conjugates with the 30-mer ssDNA, the DNA.DNG-H duplex exhibited significant increase in the fluorescence emission due to the binding of the tethered Hoechst ligand in the generated DNA.DNG minor groove, and the duplex stability was enhanced by DeltaT(m) of 7 degrees C. The stability of (DNA)(2).DNG triplexes and DNA.DNG duplexes is independent of pH, whereas the stability of (DNA)(2).DNG-H triplexes decreases with increase in pH.     

Self-assembling zeolite crystals into uniformly oriented layers

We report important progress made in the synthesis of oriented functional layers of nanochannel materials by using coordination chemistry as a tool. Zeolite L (ZL) crystals have been arranged into oriented layers through the coordinative interactions between a functional organic linker (L) and metal cations used for connecting the different parts. As organic linker we used a terpyridyl ligand bearing a urea group and a reactive siloxane part. Two strategies that lead to monolayers with different properties are described. The first consists of reacting the siloxane group of ligand L with OH groups of the substrate (S), and selectively reacting the siloxane group of L with OH groups located at the base of the ZL crystals. Next, metal cations M(n+), for example, Zn(2+) or Cu(2+), are coordinated to the terpy group on the modified substrate. To this the modified ZL is added and coordinatively bound by the terpy(Mn(n+))terpy interaction, leading to oriented ZL layers. The second method consists of reacting substrate S and ligand L in the presence of a metal cation. A layer with reactive siloxane groups is formed on S to which the ZL crystals are bound by the reaction of the hydroxyl groups of their base. Zn(2+), Cu(2+), and lanthanide ions Eu(3+) and Tb(3+)have been tested successfully, all of them leading to high-quality ZL monolayers with open channels, accessible for accepting guests, oriented perpendicularly with respect to the surface of S.     

Single and double pH-driven Cu2+ translocation with molecular rearrangement in alkyne-functionalized polyamino polyamido ligands

A new series of ligands, containing one (L1H(2)-L4H(2)) or two (L5H(4)-L6H(4)) 1,4,8,11-tetraaza-5,7-dione units and functionalized with a propargyl group on the C atom between the C=O moieties, has been synthesized. Protonation constants for the ligands and formation constants of their Cu(2+) complexes have been determined in water, and the coordination geometry of the complexes existing at various pH values has been investigated by coupled pH-metric and spectrophotometric titrations. Ligands capable of simple uptake of Cu(2+) with the formation of neutral, square-planar complexes containing the -2-charged diamino-diimido donor sets and ligands containing further coordinating groups (quinoline or pyridine) capable of single and double cation translocation have been investigated. The role of the substituents on the amino groups and the structural role played by the propargyl group have been examined as regards Cu(2+) complexation and translocation. In the double-translocating ligand L6H(4), when the two Cu(2+) ions move inside the diamino-diamido donor set, the slim propargyl group allows an unprecedented folding of the whole ligand with apical coordination of one pyridine to form a five-coordinate, square-pyramidal Cu(2+) ion. The crystal and molecular structures of this unusual [L6Cu(2)] complex have been determined by X-ray diffraction. Finally, oxidation of Cu(2+) to Cu(3+) has been studied by cyclic voltammetry in water, which revealed that the redox reaction occurs only when the copper cation is within the diamino-diimido compartment. Moreover, both functionalization of the primary amines with bulky substituents and apical coordination of Cu(2+) make access to the 3+ oxidation state more difficult and disrupt the reversibility of the electrochemical process.     

Irreversible but noncovalent Ru(II)-pyridine bond: its use for the formation of [2]-catenanes

The reaction between ligand 1, which consists of two terminal pyridines attached to a central 1,10-phenanthroline (phen), and the complex Ru(phen)2(CH3CN)2(PF6)2 has been studied. A new ruthenium containing metallamacrocycle has been obtained and fully characterized. Despite the relatively poor yield for the cyclization process involving the ruthenium center (20%), this strategy led to the synthesis of two different kinds of [2]-catenane. The first example reported in this article is a bimetallic Cu(I)/Ru(II) catenane 5(3+) consisting of a purely organic ring interlocked with the ruthenium(II)-incorporating metallacycle. Complex 5(3+) was selectively demetalated at the Cu(I) center to lead to the free Ru(II)-containing catenane. A trimetallic Ru(II)/Cu(I)/Ru(II) catenane 8(5+) was also synthesized showing that this approach is reliable and promising for the elaboration of photoactive multicomponent systems.     

An allosteric synthetic catalyst: metal ions tune the activity of an artificial phosphodiesterase

A trinuclear metal complex of general formula (L-H)M3(Mf)2 represents the first allosteric low molecular weight catalyst. L is a polyaza ligand having a tetradentate and two bidentate metal binding sites, Ms is a "structural" (allosteric) metal, and Mf are functional (catalytic) metals which interact with a substrate. In mononuclear [(L-H)Ms]+ complexes [(L-H)Cu(MeOH)]ClO4 (1a). [(L-H)Cu]NO3 x 2H2O (1b), [(L-H)Ni]ClO4 x 4H2O (2), and [(L-H)Pd]ClO4 x 2H2O (3), prepared from L and M2+ salts, the metal is strongly bound by an in-plane N4-coordination (confirmed by X-ray crystal structure determination of la). Formation of trinuclear complexes [(L-H)MsCu2]5+, with two functional Cu2+ ions coordinated to the bidentate sites of L, was evidenced in solution by photometric titration and by isolation of [(L-H)Cu3][PO4][ClO4]2 x 9H2O (4). The trinuclear complexes catalyze the cleavage of RNA-analogue 2-(hydroxypropyl)-p-nitrophenyl phosphate (HPNP), an activated phosphodiester. From a kinetic analysis of the cleavage rate at various HPNP concentrations, parameters KHPNP (the equilibrium constant for binding of HPNP to [(L-H)MsCu2]5+ and kcat (first-order rate constant for cleavage of HPNP when bound to the catalyst) were derived: KM= 170 (Ms= Cu2+), 340 (Ms = Ni2+), 2,600 (Ms = Pd2+) M(-1), kcat = 17 x 10(-3) (Ms= Cu2+) 3.1 x 10(-3) (Ms=Ni2+), 0.22 x 10(-3) (Ms = Pd2+) s(-1). Obviously, the nature of the allosteric metal ion Ms strongly influences both substrate affinity and reactivity of the catalyst [(L-H)MsCu2]5+. Our interpretation of this observation is that subtle differences in the ionic radius of Ms and in its tendency to distort the N4-Ms coordination plane have a significant influence on the conformation of the catalyst (i.e., preorganization of functional Cu2+ ions) and thus on catalytic activity.     

Molecular-level examination of Cu2+ binding structure for amyloid fibrils of 40-residue Alzheimer's β by solid-state NMR spectroscopy

Cu(2+) binding to Alzheimer's β (Aβ) peptides in amyloid fibrils has attracted broad attention, as it was shown that Cu ion concentration elevates in Alzheimer's senile plaque and such association of Aβ with Cu(2+) triggers the production of neurotoxic reactive oxygen species (ROS) such as H(2)O(2). However, detailed binding sites and binding structures of Cu(2+) to Aβ are still largely unknown for Aβ fibrils or other aggregates of Aβ. In this work, we examined molecular details of Cu(2+) binding to amyloid fibrils by detecting paramagnetic signal quenching in 1D and 2D high-resolution (13)C solid-state NMR (SSNMR) for full-length 40-residue Aβ(1-40). Selective quenching observed in (13)C SSNMR of Cu(2+)-bound Aβ(1-40) suggested that primary Cu(2+) binding sites in Aβ(1-40) fibrils include N(ε) in His-13 and His-14 and carboxyl groups in Val-40 as well as in Glu sidechains (Glu-3, Glu-11, and/or Glu-22). (13)C chemical shift analysis demonstrated no major structural changes upon Cu(2+) binding in the hydrophobic core regions (residues 18-25 and 30-36). Although the ROS production via oxidization of Met-35 in the presence of Cu(2+) has been long suspected, our SSNMR analysis of (13)C(ε)H(3)-S- in M35 showed little changes after Cu(2+) binding, excluding the possibility of Met-35 oxidization by Cu(2+) alone. Preliminary molecular dynamics (MD) simulations on Cu(2+)-Aβ complex in amyloid fibrils confirmed binding sites suggested by the SSNMR results and the stabilities of such bindings. The MD simulations also indicate the coexistence of a variety of Cu(2+)-binding modes unique in Aβ fibril, which are realized by both intra- and intermolecular contacts and highly concentrated coordination sites due to the in-register parallel β-sheet arrangements.     

Bimetallic reactivity. One-site addition two-metal oxidation reactions using a di-Co(II) complex of a binucleating ligand with 5- and 6-coordinate sites

The preparation of an unsymmetrical binucleating ligand bearing a bridging oxadiazole ring flanked on one side by three ligands and on the other by four ligands is described. When bound to two metals, the ligand forms complexes where the metals are in 5- and 6-coordinate sites after the incorporation of an exogenous bridging ligand. A di-Co(2+) complex of this ligand has been prepared containing a hydroxide bridge. The complex is readily oxidized to the di-Co(3+) state by outer sphere electron transfer with ferrocenium ions. Addition of Br(2) or NO(2)(+) to the di-Co(2+) complex leads to the rapid formation of the di-Co(3+) bromo or nitro complexes, respectively. The ligand characteristics which allow for double oxidation with ferrocenium ions and for the one-site addition two-metal oxidations with Br(2) and NO(2)(+) are discussed in terms of mechanical coupling between the two metal sites.     

Synthesis of the DNA-[Ru(tpy)(dppz)(CH(3)CN)](2+) conjugates and their photo cross-linking studies with the complementary DNA strand

We here report our studies on the conjugation of photoreactive Ru(2+) complex to oligonucleotides (ODNs), which give a stable duplex with the complementary target DNA strand. These functionalized DNA duplexes bearing photoreactive Ru(2+) complex can be specifically photolyzed to give the reactive aqua derivative, [Ru(tpy)(dppz)(H(2)O)](2+)-ODN (tpy = 2,2':6',2' '-terpyridine; dppz = dipyrido[3,2-a:2',3'-c]phenazine), in situ, which successfully cross-links to give photoproduct(s) in the duplex form with the target complementary DNA strand. Thus, the stable precursor of the aquaruthenium complex, the monofunctional polypyridyl ruthenium complex [Ru(tpy)(dppz)(CH(3)CN)](2+), has been site-specifically tethered to ODN, for the first time, by both solid-phase synthesis and postsynthetic modifications. (i) In the first approach, pure 3'-[Ru(tpy)(dppz)(CH(3)CN)](2+)-ODN conjugate has been obtained in 42% overall yield (from the monomer blocks) by the automated solid-phase synthesis on a support labeled with [Ru(tpy)(dppz)Cl](+) complex with subsequent liberation of the crude conjugate from the support under mild conditions and displacement of the Cl(-) ligand by acetonitrile in the coordination sphere of the Ru(2+) label. (ii) In the second approach, the single-modified (3'- or 5'- or middle-modified) or 3',5'-bis-modified Ru(2+)-ODN conjugates were prepared in 28-50% yield by an amide bond formation between an active ester of the metal complex and the ODNs conjugated with an amino linker. The pure conjugates were characterized unambiguously by ultraviolet-visible (UV-vis) absorption spectroscopy, enzymatic digestion followed by HPLC quantitation, polyacrylamide gel electrophoresis (PAGE), and mass spectrometry (MALDI-TOF as well as by ESI). [Ru(tpy)(dppz)(CH(3)CN)](2+)-ODNs form highly stabilized ODN.DNA duplexes compared to the unlabeled counterpart (DeltaT(m) varies from 8.4 to 23.6 degrees C) as a result of intercalation of the dppz moiety; they undergo clean and selective photodissociation of the CH(3)CN ligand to give the corresponding aqua complex, [Ru(tpy)(dppz)(H(2)O)](2+)-ODNs (in the aqueous medium), which is evidenced from the change of their UV-vis absorption properties and the detection of the naked Ru(2+)-ODN ions generated in the course of the matrix-assisted laser desorption ionization time-of-flight (MALDI-TOF) mass spectrometric analysis. Thus, when [Ru(tpy)(dppz)(CH(3)CN)](2+)-ODN conjugate was hybridized to the complementary guanine (G)-rich target strand (T), and photolyzed in a buffer (pH 6.8), the corresponding aqua complex formed in situ immediately reacted with the G residue of the opposite strand, giving the cross-linked product. The highest yield (34%) of the photo cross-linked product obtained was with the ODN carrying two reactive Ru(2+) centers at both 3'- and 5'-ends. For ODNs carrying only one Ru(2+) complex, the yield of the cross-linked adduct in the corresponding duplex is found to decrease in the following order: 3'-Ru(2+)-ODN (22%) > 5'-Ru(2+)-ODN (9%) > middle-Ru(2+)-ODN (7%). It was also found that the photo cross-coupling efficiency of the tethered Ru(2+) complex with the target T strand decreased as the stabilization of the resulting duplex increased: 3'-Ru(2+)-ODN (VI.T) (DeltaT(m)(b) = 7 degrees C) < 5'-Ru(2+)-ODN (V.T) (DeltaT(m)(b) = 16 degrees C) < middle-Ru(2+)-ODN (VII.T) (DeltaT(m)(b) = 24.3 degrees C, Table 2). This shows that, with the rigidly packed structure, as in the duplex with middle-Ru(2+)-ODN, the metal center flexibility is considerably reduced, and consequently the accessibility of target G residue by the aquaruthunium moiety becomes severely restricted, which results in a poor yield in the cross-coupling reaction. The cross-linked product was characterized by PAGE, followed by MALDI-TOF MS.     

Characterization and application to the detection of single-stranded DNA binding protein of fluorescent DNA-templated copper/silver nanoclusters

A simple strategy for the preparation of strongly fluorescent and stable DNA-Cu/Ag NCs from reduction of AgNO(3) and Cu(NO(3))(2) by NaBH(4) in the presence of DNA having a sequence 5'-CCCTTAATCCCC-3' has been demonstrated. Fluorescence, absorption, X-ray photoelectron spectroscopy (XPS), and electrospray ionization-mass spectrometry (ESI-MS) measurements have been applied to the characterization of the DNA-Cu/Ag NCs. The ESI-MS data reveal that each DNA-Cu/Ag NC contained 2 Ag and 1 Cu atoms. The interactions among DNA with the Ag and Cu atoms are further supported by the data of low-temperature fluorescence. In the presence of Cu(2+) ions, the reaction time is 1.5 h, which is much shorter than that (120 h) for the preparation of Ag-DNA NCs that are prepared in a mixture of AgNO(3), NaBH(4) and DNA without containing Cu(2+) ions. Relative to the DNA-Ag NCs, the DNA-Cu/Ag NCs have greater fluorescence (quantum yield 51.2% vs. 11.5%). The DNA-Cu/Ag NCs are highly sensitive and selective for the detection of single-stranded DNA binding protein (SSB), with a linear range 1-50 nM and a limit of detection 0.2 nM at a signal-to-ratio of 3.     

Supramolecular isomers of metal-organic frameworks: the role of a new mixed donor imidazolate-carboxylate tetradentate ligand

Five new metal-organic frameworks prepared from the ligand 5-bis(3-(1-imidazolyl)propylcarbamoyl)terephthalate (bipta(2-)) and transition metal salts, Zn(2+) (1), Co(2+) (2), Mn(2+) (3, 4) and Cu(2+) (5), are reported. Single crystal X-ray studies reveal that the bipta(2-) ligand acts as a tetradentate ligand and combines with four-coordinate cationic metal nodes to give four-connected framework structures. Whilst reaction of bipta(2-) with Zn(II) gives rise to a framework of diamondoid topology 1, the analogous frameworks with Co(II), Mn(II) and Cu(II) afford frameworks that incorporate square-planar nodes. Whereas 2 and 5 form frameworks of Cd(SO(4)) (cds) and square 4(4) nets (sql), respectively, reaction of Mn(II) with bipta(2-) forms two supramolecular isomers of topology cds for 3 and sql for 4.     

Macrobicyclic cage amine ligands for copper radiopharmaceuticals: a single bivalent cage amine containing two Lys3-bombesin targeting peptides

The synthesis of new cage amine macrobicyclic ligands with pendent carboxylate functional groups designed for application in copper radiopharmaceuticals is described. Reaction of [Cu((NH(2))(2)sar)](2+) (sar = 3,6,10,13,16,19-hexaazabicyclo[6.6.6]icosane) with either succinic or glutaric anhydride results in selective acylation of the primary amine atoms of [Cu((NH(2))(2)sar)](2+) to give derivatives with either one or two aliphatic carboxylate functional groups separated from the cage amine framework by either a four- or five-atom linker. The Cu(II) serves to protect the secondary amine nitrogen atoms from acylation, and can be removed to give the free ligands. The newly appended carboxylate functional groups can be used as sites of attachment for cancer-targeting peptides such as Lys(3)-bombesin. The synthesis of the first dimeric sarcophagine-peptide conjugate, possessing two Lys(3)-bombesin peptides tethered to a single cage amine, is presented. This species has been radiolabeled with copper-64 at ambient temperature and there is minimal dissociation of Cu(II) from the conjugate even after two days of incubation in human serum.     

Theoretical study on the gas-phase acidity of multiple sites of Cu+-adenine and Cu2+-adenine complexes

The acidities of multiple sites in Cu(+)-adenine and Cu(2+)-adenine complexes have been investigated theoretically. To compare, the acidities of adenine (A) and adenine radical cation (A(*+)) have also been included. The results clearly indicate that the acidities of C-H and N-H groups in Cu(+/2+)-adenine are significantly enhanced relative to the neutral adenine. The acidic order for a given site on adenine and adenine derivatives is as follows: Cu(2+)-adenine > A(*+) > Cu(+)-adenine > A. For Cu(+)-adenine and Cu(2+)-adenine, N3-coordination exhibits N9-H acid, and N1- and N7-coordination exhibits N6-H(a) and N6-H(b) acid, respectively. Additionally, it is found that C2-H group is surprisingly acidic in the coordination complexes. Calculations in aqueous solution reveal that our results can be extrapolated to aqueous solution. Analyses of the electronic properties interpret the highest acidity of Cu(2+)-adenine among the adenine derivatives studied. Also, Electrostatic potential calculations of [A(-H(+))](-) and [A(-H(+))](*) indicate that the removal of H(a) or H(b) from the amino group favors the bidentate coordination, which provides a dative bond from the deprotonated N and the original coordination ligand to copper ion besides the electrostatic interaction between them and thereby stabilizes the [A(-H(+))](-)/[A(-H(+))](*). NBO analysis confirms the electrostatic potential result.     

Role of anions on the crystal structures of copper(II) and zinc(II) complexes of a tunable butterfly cyclophane macrocycle

Three crystal structures of a ditopic cyclophane ligand (L) in which two 1,5,8,12-tetraamine molecules have been attached through methylene spacers to the ortho positions of a benzene ring are reported. The first one (1) corresponds to the tetraprotonated free macrocycle (H4L4+) having two tetrachlorozincate(II) counteranions (C24H54O2N8Cl8Zn2, a = 9.1890(2) A, b = 14.0120(3) A, c = 15.3180(3) A, alpha = 89.2320(7) degrees , beta = 82.0740(6) degrees , gamma = 83.017(1) degrees , Z = 2.00, triclinic, P); the second one (2) is of a binuclear Cu2+ complex having coordinated chloride anions and perchlorate counteranions (C24H58O14N8Cl4Cu2 a = 9.9380(2) A, b = 30.2470(6) A, c = 53.143(1) A, orthorhombic, F2dd, Z = 18), and the third one (3) corresponds to an analogous Zn2+ complex that has been crystallized using triflate as counteranion (C26H(51.2)O(6.6)N8Cl2F6S2Zn2 a = 8.472(5) A, b = 9.310(5), c = 13.745(5) A, alpha = 84.262(5) degrees , beta = 77.490(5) degrees , gamma = 73.557(5) degrees , triclinic, P, Z = 2). The analysis of the crystallographic data clearly shows that the conformation of the macrocycle and, in consequence, the overall architecture of the crystals are controlled by the anions present in the moiety, pi-pi-stacking associations, and hydrogen bonding interactions. The protonation and stability constants for the formation of the Cu2+ and Zn2+ complexes in aqueous solution have been determined potentiometrically in 0.15 mol dm(-3) NaClO4 at 298.1 K. Intramolecular hydrogen bonding defines the protonation behavior of the compound. Positive cooperativity is observed in the formation of the Cu2+ complexes.     

Amyloid-beta binds Cu2+ in a mononuclear metal ion binding site

Amyloid-beta (Abeta) peptide is the principal constituent of plaques associated with Alzheimer's disease and is thought to be responsible for the neurotoxicity associated with the disease. Metal ions have been hypothesized to play a role in the formation and neurotoxicity of aggregates associated with Alzheimer's disease (Bush, A. I.; et al. Proc. Natl. Acad. Sci. U.S.A. 2003, 100, 11934). Elucidation of the chemistry through which transition-metal ions participate in the assembly and toxicity of Abeta oligomers is important to drug design efforts if inhibition of Abeta containing bound metal ions becomes a treatment for Alzheimer's disease. In this paper, we report electron paramagnetic resonance (EPR) spectroscopic characterization of Cu(2+) bound to soluble and fibrillar Abeta. Addition of stoichiometric amounts of Cu(2+) to soluble Abeta produces an EPR signal at 10 K with observable Cu(2+) hyperfine lines. A nearly identical spectrum is observed for Abetafibrils assembled in the presence of Cu(2+). The EPR parameters are consistent with a Type 2 Cu(2+) center with three nitrogen donor atoms and one oxygen donor atom in the coordination sphere of Cu(2+): g( parallel) = 2.26 and A( parallel) = 174 +/- 4 G for soluble Abeta with Cu(2+), and g( parallel) = 2.26 and A( parallel) = 175 +/- 1 G for Abeta fibrils assembled with Cu(2+). Investigation of the temperature dependence of the EPR signal for Cu(2+) bound to soluble Abetaor Cu(2+) in fibrillar Abeta shows that the Cu(2+) center displays normal Curie behavior, indicating that the site is a mononuclear Cu(2+) site. Fibrils assembled in the presence of Cu(2+) contain one Cu(2+) ion per peptide. These results show that the ligand donor atom set to Cu(2+) does not change during organization of Abetamonomers into fibrils and that neither soluble nor fibrillar forms of Abeta(1-40) with Cu(2+) contain antiferromagnetically exchange-coupled binuclear Cu(2+) sites in which two Cu(2+) ions are bridged by an intervening ligand.     

Synthesis of N3- and 2-NH2-substituted 6,7-diphenylpterins and their use as intermediates for the preparation of oligonucleotide conjugates designed to target photooxidative damage on single-stranded DNA representing the bcr-abl chimeric gene

Two 17-mer oligodeoxynucleotide-5'-linked-(6,7-diphenylpterin) conjugates, 2 and 3, were prepared as photosensitisers for targeting photooxidative damage to a 34-mer DNA oligodeoxynucleotide (ODN) fragment 1 representing the chimeric bcr-abl gene that is implicated in the pathogenesis of chronic myeloid leukaemia (CML). The base sequence in the 17-mer was 3'G G T A G T T A T T C C T T C T T5'. In the first of these ODN conjugates (2) the pterin was attached at its N3 atom, via a -(CH2)3OPO(OH)- linker, to the 5'-OH group of the ODN. Conjugate 2 was prepared from 2-amino-3-(3-hydroxypropyl)-6,7-diphenyl-4(3H)-pteridinone 10, using phosphoramidite methodology. Starting material 10 was prepared from 5-amino-7-methylthiofurazano[3,4-d]pyrimidine 4 via an unusual highly resonance stabilised cation 8, incorporating the rare 2H,6H-pyrimido[6,1-b][1,3]oxazine ring system. In the characterisation of 10 two pteridine phosphazenes, 15 and 29, were obtained, as well as new products containing two uncommon tricyclic ring systems, namely pyrimido[2,1-b]pteridine (20 and 24) and pyrimido[1,2-c]pteridine (27). In the second ODN conjugate the linker was -(CH2)5CONH(CH2)6OPO(OH)- and was attached to the 2-amino group of the pterin. In the preparation of 3, the N-hydroxysuccinimide ester 37 of 2-(5-carboxypentylamino)-6,7-diphenyl-4(3H)-pteridinone was condensed with the hexylamino-modified 17-mer. Excitation of 36 with near UV light in the presence of the single-stranded target 34-mer, 5'T G A C C A T C A A T A A G14 G A A G18 A A G21 C C C T T C A G C G G C C3' 1 caused oxidative damage at guanine bases, leading to alkali-labile sites which were monitored by polyacrylamide gel electrophoresis. Cleavage was observed at all guanine sites with a marked preference for cleavage at G14. In contrast, excitation of ODN-pteridine conjugate 2 in the presence of 1 caused oxidation of the latter predominantly at G18, with a smaller extent of cleavage at G15 and G14 (in the double-stranded portion) and G21. These results contrast with our previous observation of specific cleavage at G21 with ruthenium polypyridyl sensitisers, and suggest that a different mechanism, probably one involving Type 1 photochemical electron transfer, is operative. Much lower yields were found with the ODN-pteridine conjugate 3, perhaps as a consequence of the longer linker between the ODN and the pteridine in this case.     

Ligand field modification around Cu2+ ions in sodium borate glass by codoping

Understanding the effect of codoping on the properties of photonic glasses is important for improving their properties. The effect of codoping on the ligand field around Cu(2+) ions in a sodium borate glass is examined using optical absorption spectroscopy, continuous-wave electron paramagnetic resonance, and three-pulse electron-spin-echo envelope-modulation. Glass with a composition of 0.1CuO·5Na(2)O·95B(2)O(3) was codoped with 2 mol % of Al(3+), Si(4+), P(5+), Zr(4+), or La(3+) oxide. Three codoping effects are found: strengthening the ligand field, as observed for Zr-codoping, which induces a large blue shift of the optical absorption peak of Cu(2+); weakening the ligand field, as observed for P-codoping, which causes a red shift of the Cu(2+) absorption peak; and almost no effect on the ligand field, which is observed for Al-, Si-, and La-codoping. Coordination structure models based on local charge neutrality are proposed for the codoped glasses. The mechanism of the codoping effect is revealed by elucidating the local structure around Cu(2+).     

Alteration of the selectivity of DNA cleavage by a deglycobleomycin analogue containing a trithiazole moiety

The bleomycin (BLM) group of antitumor antibiotics effects DNA cleavage in a sequence-selective manner. Previous studies have indicated that the metal-binding and bithiazole moieties of BLM are both involved in the binding of BLM to DNA. The metal-binding domain is normally the predominant structural element in determining the sequence selectivity of DNA binding, but it has been shown that replacement of the bithiazole moiety with a strong DNA binder can alter the sequence selectivity of DNA binding and cleavage. To further explore the mechanism by which BLM and DNA interact, a trithiazole-containing deglycoBLM analogue was synthesized and tested for its ability to relax supercoiled DNA and cleave linear duplex DNA in a sequence-selective fashion. Also studied was cleavage of a novel RNA substrate. Solid-phase synthesis of the trithiazole deglycoBLM A(5) analogue was achieved using a TentaGel resin containing a Dde linker and elaborated from five key intermediates. The ability of the resulting BLM analogue to relax supercoiled DNA was largely unaffected by introduction of the additional thiazole moiety. Remarkably, while no new sites of DNA cleavage were observed for this analogue, there was a strong preference for cleavage at two 5'-GT-3' sites when a 5'-(32)P end-labeled DNA duplex was used as a substrate. The alteration of sequence selectivity of cleavage was accompanied by some decrease in the potency of DNA cleavage, albeit without a dramatic diminution. In common with BLM, the trithiazole analogue of deglycoBLM A(5) effected both hydrolytic cleavage of RNA in the absence of added metal ion and oxidative cleavage in the presence of Fe(2+) and O(2). In comparison with BLM A(5), the relative efficiencies of hydrolytic cleavage at individual sites were altered.     

Synthesis, DNA-binding, cleavage, and cytotoxic activity of new 1,7-dioxa-4,10-diazacyclododecane artificial receptors containing bisguanidinoethyl or diaminoethyl double side arms

Novel 1,7-dioxa-4,10-diazacyclododecane artificial receptors with two pendant aminoethyl (3) or guanidinoethyl (4) side arms have been synthesized. Spectroscopy, including fluorescence and CD spectroscopy, of the interactions of 3, 4, and their copper(II) complexes with calf thymus DNA indicated that the DNA binding affinity of these compounds follows the order Cu(2+)-4>Cu(2+)-3>4>3, and the binding constants of Cu(2+)-3 are Cu(2+)-4 are 7.2x10(4) and 8.7x10(4) M(-1), respectively. Assessment by agarose gel electrophoresis of the plasmid pUC 19 DNA cleavage activity in the presence of the receptors showed that the complexes Cu(2+)-3 and Cu(2+)-4 exhibit powerful supercoiled DNA cleavage efficiency. Kinetic data of DNA cleavage promoted by Cu(2+)-3 and Cu(2+)-4 under physiological conditions fit to a saturation kinetic profile with kmax values of 0.865 and 0.596 h(-1), respectively, which give about 10(8)-fold rate acceleration over uncatalyzed supercoiled DNA. This acceleration is due to efficient cooperative catalysis of the copper(II) center and the functional (diamino or bisguanidinium) groups. In-vitro cytotoxic activities toward murine melanoma B16 cells and human leukemia HL-60 cells were also examined: Cu(2+)-4 shows the highest activity with IC(50) values of 1.62x10(-4) and 1.19x10(-5) M, respectively.