Adsorption of phenyl phosphate on Ni-Cr alloy surface: Experimental and theoretical investigations

The adsorption behaviour of phenyl phosphate, which is an available biomolecule, on NiCr alloys was investigated. Atomic flame spectroscopy was used to characterize the elemental dissolution during immersion in neutral aqueous solution of 0.09 w% sodium chloride, 37°C. Phenyl phosphate is shown to reduce the release of both Ni²⁺ and Cr³⁺ ions. XPS analyses evidence the formation of a passive film which is mainly consisted in dichromium trioxide and an ultrafilm layer of phenyl phosphate is adsorbed at the passive film surface. DFT+U calculations show that the phenyl phosphate self-assembling at a Cr₂O₃ surface is thermodynamically favoured, with calculated adsorption energy of 2.9 eV. The first half of this value is due to the interaction with the surface, and the second one is due to self-assembling. This study suggests that phenyl phosphate has an important capacity to prevent, in neutral liquid environment, the release of Cr-Ni surface ions thanks to self-assembling in an inner sphere adsorption on the passive film surface. The phosphate group is covalently anchored to the surface. However, the phenyl ring has two roles: (i) it strongly contributes to the self-assembling and (ii) it acts as a hydrophobic function.     

Structure Effect of Imidazolium-Based Dicationic Ionic Liquids on Claisen Rearrangement

A large group of imidazolium-based dicationic ionic liquids (DILs) has been prepared in good yields. Thermal stability of all DILs has been determined. The effects of the reaction time, cation, imidazolium C₂–H acidity, and anion on the Claisen rearrangement of allyl phenyl ether have been investigated. Type of anion and the presence of the acidic C₂–H bond in the imidazolium moieties have proven to be essential for this reaction. The simple procedure and the possibility of avoiding the use catalysts and volatile organic solvents make this synthetic method environmentally benign and adaptable for large-scale applications.     

Micellar effect of ionic surfactants in the reaction ofo-dimethylaminomethylphenol withp-nitrophenyl diphenyl phosphate

The effect of cetylpyridinium bromide (CPB) and sodium dodecyl sulphate (SDS) on the direction and the rate of the reaction ofo-dimethylaminomethylphenol (MP) withp-nitrophenyl diphenyl phosphate (1) has been studied by³¹P NMR and spectrophotometry. It was shown that the reaction of MP with1 proceeds in two steps both with and without the surfactant. The product of transesterification is formed in the first step. The second step is hydrolysis catalyzed by the aminomethyl group yielding equal amounts of diphenyl phosphate ando-dimethylaminomethyl phenyl phosphate. The reaction of MP with1 is catalyzed by CPB and inhibited by SDS. The ratio between the rates of the first and the second stages changes in the presence of surfactant. The parameters of the reaction of MP with1 inhibited by micellar SDS were calculated.Translated fromIzvestiya Akademii Nauk. Seriya Khimicheskaya, No. 2, pp. 242–245, February, 1994.     

Imidazole‐coordinated monodentate NHC–Pd(II) complex derived from proline and its application to the coupling reaction of arylboronic acids with carboxylic acid anhydrides in water at room temperature

Cleavage of a C N bond of imidazolium salt derived from N‐phenyl‐substituted proline was observed in this laboratory. A novel imidazole‐coordinated monodentate NHC–Pd(II) complex 5 was obtained as the sole product in good yield in the reaction of imidazolium salt 4 with Pd(OAc)₂ in refluxing THF. The structure of complex 5 was determined unambiguously by an X‐ray diffraction. The complex was found to be a good catalyst in the cross‐coupling reaction of arylboronic acids with carboxylic acid anhydrides in water at room temperature. Copyright © 2011 John Wiley & Sons, Ltd.     

Cu2{[18]ane-N6} complexes: structures, magnetism, and phosphate monoester binding

A novel Cu(II)2 complex of the [18]ane-N6 macrocycle ([18]ane-N6 = 1,4,7,10,13,16-hexaazacyclooctadecane) was prepared from the reaction between [18]ane-N6 and Cu(II) salts such as Cu(NO3)2 and Cu(OAc)2. A structural study of the complex derived from Cu(OAc)2 (1) revealed a Cu(II)2 core encircled by a [18]ane-N6 ligand and two mu-O-OAc ligands. The facile replacement of mu-O-OAc by a phosphate monoester [PO3(OR)2-] yielded a number of bis(phosphate monoester)dicopper complexes with ROPO3(2-) as hydrogen phosphate (HPO4(2-), 3a), phenyl phosphate [PO3(OPh)2-, 3b], glycerol 2-phosphate [PO3(OCH(CH2OH)2)2-, 3c], alpha-d-gluocose phosphate [PO3(C6H11O6)2-, 3d], and dl-alpha-glycerol phosphate [PO3(OCH2CHOHCH2OH)2-, 3e]. Structural studies of compounds 3a-d confirmed both the retention of the Cu2{[18]ane-N6} core and a mu-O-PO3(OR) coordination mode. Displacement of acetate by a phosphate monoester in an aqueous solution was accompanied by a significant change in the visible absorption, which enables the establishment of relative association constants of PO3(OR)2- on the order of 10(4) in the unbuffered solution and 10(3) in the buffered solution (HEPES). Measurement of the magnetic susceptibility of compound 3a over the temperature range of 5-300 K and subsequent modeling revealed a weak antiferromagnetic coupling (J = -1.1 cm(-1)) between two Cu(II) centers.     

Reactions of bis(2,4-dinitrophenyl) phosphate with hydroxylamine

For dephosphorylation of bis(2,4-dinitrophenyl) phosphate (BDNPP) by hydroxylamine in water, pH region 4-12, the observed first-order rate constant, k(obs), initially increases as a function of pH, but is pH-independent between pH 7.2 and pH 10. The initial BDNPP cleavage by nonionic NH(2)OH (<0.2 M) involves attack by the OH group and follows first-order kinetics, but the overall initial reaction of BDNPP liberates ca. 1.7 mol of 2,4-dinitrophenoxide ion (DNP). This initial reaction generates a short-lived O-phosphorylated hydroxylamine, 2, followed by three possible reactions: (1) reaction of 2 with hydroxylamine, generating 2,4-dinitrophenyl phosphate (DNPP, 3), which subsequently forms DNP; (2) intramolecular displacement of the second DNP group and rapid decomposition of the cyclic intermediate to form phosphonohydroxylamine and eventually inorganic phosphate; (3) a novel rearrangement with intramolecular aromatic nucleophilic substitution involving a cyclic intermediate and migration of the 2,4-dinitrophenyl group from O to N. Values of k(obs) increase modestly with pH > 10, the reaction is biphasic, and the yield of DNP increases. An increase in [NH(2)OH] also increases the yield of DNP, due largely to accelerated hydrolysis of DNPP.     

Photolysis of triphenyl phosphate in aqueous methanol

Upon UV irradiation in methanol, triphenyl phosphate ( 1a ) gave biphenylyl phenyl phosphate ( 2a ) as the main product, whereas the addition of water to the solution caused an increase of the yield of biphenyl ( 3a ). These products were formed through a singlet excited state and an intramolecular excimer, respectively. © 1996 John Wiley & Sons, Inc.     

T-shaped ionic liquid crystals based on the imidazolium motif: exploring substitution of the C-2 imidazolium carbon atom

In this contribution the first examples of so‐called rigid‐core, T‐shaped imidazolium ionic liquid crystals, in which the C‐2 atom of the imidazolium ring is substituted with an aryl moiety decorated with one or two alkoxy chains, are described. The length of the alkoxy chain(s) was varied from six to eighteen carbon atoms (n=6, 10, 14–18). Whereas the compounds with one long alkoxy chain display only smectic A phases, the salts containing two alkoxy chains exhibit smectic A, multicontinuous cubic, as well as hexagonal columnar phases, as evidenced by polarising optical microscopy, differential scanning calorimetry, and powder X‐ray diffraction. Structural models are proposed for the self‐assembly of the molecules within the mesophases. The imidazolium head groups and the iodide counterions were found to adopt a peculiar orientation in the central part of the columns of the hexagonal columnar phases. The enantiotropic cubic phase shown by the 1,3‐dimethyl‐2‐[3,4‐bis(pentadecyloxy)phenyl]imidazolium iodide salt has a multicontinuous Pm$\bar 3In this contribution the first examples of so-called rigid-core, T-shaped imidazolium ionic liquid crystals, in which the C-2 atom of the imidazolium ring is substituted with an aryl moiety decorated with one or two alkoxy chains, are described. The length of the alkoxy chain(s) was varied from six to eighteen carbon atoms (n=6, 10, 14-18). Whereas the compounds with one long alkoxy chain display only smectic A phases, the salts containing two alkoxy chains exhibit smectic A, multicontinuous cubic, as well as hexagonal columnar phases, as evidenced by polarising optical microscopy, differential scanning calorimetry, and powder X-ray diffraction. Structural models are proposed for the self-assembly of the molecules within the mesophases. The imidazolium head groups and the iodide counterions were found to adopt a peculiar orientation in the central part of the columns of the hexagonal columnar phases. The enantiotropic cubic phase shown by the 1,3-dimethyl-2-[3,4-bis(pentadecyloxy)phenyl]imidazolium iodide salt has a multicontinuous Pm ?3m structure. To the best of our knowledge, this is the first example of a thermotropic cubic mesophase of this symmetry.     

Synthesis of phosphate end‐functional polymers and application to thermally latent polymeric initiators

Novel phosphates, O‐p‐(hydroxymethyl)benzyl O,O‐diethyl phosphate ( 1 ) and O‐(2‐bromoisobutyryloxymethyl)benzyl O,O‐diethyl phosphate ( 2 ) were synthesized by the reaction of diethyl phosphorochloridate with 1,4‐benzenedimethanol and the successive reaction with 2‐bromoisobutyryl bromide in the presence of triethylamine and submitted to the polymerization of ?‐caprolactone and methyl methacrylate as the initiators. They afforded phosphate end‐functional poly(?‐caprolactone) and poly(methyl methacrylate) with controlled molecular weights and polydispersity ratios by living ring‐opening polymerization and samarium‐induced polymerization. The polymerization of glycidyl phenyl ether (GPE) was carried out with the phosphate end‐functional polymers as the latent polymeric initiators in the presence of ZnCl₂. The polymerization of GPE did not proceed below 90 °C, but it rapidly proceeded to afford poly(GPE) above the temperature. © 2001 John Wiley & Sons, Inc. J Polym Sci Part A: Polym Chem 39: 3832–3840, 2001     

An unprecedented tandem 1,3-dipolar cycloaddition-cheletropic elimination: a facial approach to novel push-pull olefins

The interaction of 2-(phenylthiocarbamoyl) imidazolium inner salts with dimethyl acetylenedicarboxylate produced dimethyl 2-(imidazolin-2-ylidene)-3-thioxobutanedioates in moderate to good yields. The process involved a tandem reaction comprising a 1,3-dipolar cycloaddition and an unprecedented cheletropic elimination of the phenyl isonitrile from a 2-phenyliminodihydrothiophene moiety. NMR and X-ray diffraction studies confirmed that the 2-(imidazolin-2-ylidene)-3-thioxobutanedioates are novel push-pull olefins and have potential applications in nonlinear optical materials.     

Synthesis and application of chiral N-heterocyclic carbene-oxazoline ligands: iridium-catalyzed enantioselective hydrogenation

Two libraries of enantiomerically pure imidazolium salts bearing an oxazoline unit were synthesized. Deprotonation of the imidazolium salts and complexation of the resulting oxazoline-carbene ligands to iridium(I) was achieved in one step by mixing the imidazolium salts with NaOtBu and [(eta(4)-cod)IrCl](2) in THF at room temperature. The air-stable complexes were purified by flash chromatography. All complexes were analyzed by two-dimensional (2D) NMR methods and one compound from each family was characterized by X-ray structure analysis. The two libraries of iridium complexes were successfully tested in the asymmetric hydrogenation of unfunctionalized and functionalized olefins. Enantioselectivities of up to 90 % ee were obtained with trans-alpha-methylstilbene. Upon complexation of imidazolium salt 15 p with R(1) = phenyl, C-H bond activation of the phenyl ring gave rise to iridium(III) complex 17, which was fully characterized by NMR spectroscopy and X-ray structure analysis. Complex 17 proved to be catalytically inactive in the hydrogenation.     

Theoretical evaluation of the substrate-assisted catalysis mechanism for the hydrolysis of phosphate monoester dianions

Quantum chemistry methods coupled with a continuum solvation model have been applied to evaluate the substrate-assisted catalysis (SAC) mechanism recently proposed for the hydrolysis of phosphate monoester dianions. The SAC mechanism, in which a proton from the nucleophile is transferred to a nonbridging phosphoryl oxygen atom of the substrate prior to attack, has been proposed in opposition to the widely accepted mechanism of direct nucleophilic reaction. We have assessed the SAC proposal for the hydrolysis of three representative phosphate monoester dianions (2,4-dinitrophenyl phosphate, phenyl phosphate, and methyl phosphate) by considering the reactivity of the hydroxide ion toward the phosphorus center of the corresponding singly protonated monoesters. The reliability of the calculations was verified by comparing the calculated and the observed values of the activation free energies for the analogous S_N2(P) reactions of F⁻ with the monoanion of the monoester 2,4-dinitrophenyl phosphate and its diester analogue, methyl 2,4-dinitrophenyl phosphate. It was found that the orientation of the phosphate hydrogen atom has important implications with regard to the nature of the transition state. Hard nucleophiles such as OH⁻ and F⁻ can attack the phosphorus atom of a singly protonated phosphate monoester only if the phosphate hydrogen atom is oriented toward the leaving-group oxygen atom. As a result of this proton orientation, the SAC mechanism in solution is characterized by a small Brønsted coefficient value (β_lg=−0.25). This mechanism is unlikely to apply to aryl phosphates, but becomes a likely possibility for alkyl phosphate esters. If oxyanionic nucleophiles of pK_a<11 are involved, as in alkaline phosphatase, then the S_N2(P) reaction may proceed with the phosphate hydrogen atom oriented toward the nucleophile. In this situation, a large negative value of β_lg (−0.95) is predicted for the substrate-assisted catalysis mechanism.     

Functionalized Ionic (Poly)Styrenes and their Application as Catalysts in the Cycloaddition of CO2 to Epoxides

Valorization of CO₂, an abundant C(1) synthon, into platform chemicals is of growing interest. In this context, a key reaction is the cycloaddition of CO₂ to epoxides to form carbonates (CCE). A series of organocatalysts for this reaction, based on imidazolium salts modified with a styrene functional group and a second variable functional group, were prepared and characterized. Both the ionic salts and ionic polymers derived from the salts were evaluated in this reaction. In general, the monomers perform slightly better than the polymers; however, the latter are considerably more convenient to use. Of the catalysts studied, the ionic polystyrene imidazolium salt with an ammonium functionality shows highest activity, tolerates a range of epoxides, and can be recycled multiple times without loss of activity.     

Cross—Coupling of Aryl Iodides with Malononitrile Catalyzed by Palladium N—Heterocyclic Carbene Complex System

Eight N-heterocyclic carbenes (NHC),generated in situ from their imidazolium salts,as ligands of palladium complexes were used for the catalytic coupling of iodobenzene with malononi-trile anion,It was found that 1,3-bis(2,4,6-trimethylphenyl)-imidazolium chloride (IMesHCl)-Pd2(dba)3 catalytic system has the highest activity to obtain phenyl malononitrile among the imidazolium salts.The substituted iodoarenes reacted with malononitrile anions by using the catalytic system to give cross-coupling products in yields from 50% to 96%.     

Acid/azole complexes as highly effective promoters in the synthesis of DNA and RNA oligomers via the phosphoramidite method

The utility of various kinds of acid salts of azole derivatives as promoters for the condensation of a nucleoside phosphoramidite and a nucleoside is investigated. Among the salts, N-(phenyl)imidazolium triflate, N-(p-acetylphenyl)imidazolium triflate, N-(methyl)benzimidazolium triflate, benzimidazolium triflate, and N-(phenyl)imidazolium perchlorate have shown extremely high reactivity in a liquid phase. These reagents serve as powerful activators of deoxyribonucleoside 3'-(allyl N,N-diisopropylphosphoramidite)s or 3'-(2-cyanoethyl N,N-diisopropylphosphoramidite)s employed in the preparation of deoxyribonucleotides, and 3'-O-(tert-butyldimethylsilyl)ribonucleoside 2'-(N,N-diisopropylphosphoramidite)s or 2'-O-(tert-butyldimethylsilyl)ribonucleoside 3'-(N,N-diisopropylphosphoramidite)s used for the formation of 2'-5' and 3'-5' internucleotide linkages between ribonucleosides, respectively. The azolium salt has allowed smooth and high-yield condensation of the nucleoside phosphoramidite and a 5'-O-free nucleoside, in which equimolar amounts of the reactants and the promoter are employed in the presence of powdery molecular sieves 3A in acetonitrile. It has been shown that some azolium salts serve as excellent promoters in the solid-phase synthesis of oligodeoxyribonucleotides and oligoribonucleotides. For example, benzimidazolium triflate and N-(phenyl)imidazolium triflate can be used as effective promoters in the synthesis of an oligodeoxyribonucleotide, (5')CGACACCCAATTCTGAAAAT(3') (20mer), via a method using O-allyl/N-allyloxycarbonyl-protected deoxyribonucleoside 3'-phosphoramidites or O-(2-cyanoethyl)/N-phenoxyacetyl-protected deoxyribonucleotide 3'-phosphoramidite as building blocks, respectively, on high-cross-linked polystyrene resins. Further, N-(phenyl)imidazolium triflate is useful for the solid-phase synthesis of oligoribonucleotides, such as (5')AGCUACGUGACUACUACUUU(3') (20mer), according to an allyl/allyloxycarbonyl-protected strategy. The utility of the azolium promoter has been also demonstrated in the liquid-phase synthesis of some biologically important substances, such as cytidine-5'-monophosphono-N-acetylneuraminic acid (CMP-Neu5Ac) and adenylyl(2'-5')adenylyl(2'-5')adenosine (2-5A core).     

Recognition of phosphate monoester dianion by an alkoxide-bridged dinuclear zinc(II) complex

Recognition of phosphate monoester dianion by an alkoxide-bridged dinuclear zinc(II) complex (Zn2L3+) has been studied (L = alkoxide species of 1,3-bis[bis(pyridin-2-ylmethyl)amino]propan-2-ol). Potentiometric pH titration study disclosed a 1 : 1 phenyl phosphate complexation with Zn2L3+ in aqueous solution. The dissociation constant (= [Zn2L3+][PhOPO3(2-)]/[Zn2L3+-PhOPO3(2-)]) is an extremely small value of 2.5 x 10(-8) mol dm(-3) at 25 degrees C with I = 0.10 (NaNO3). The X-ray crystal analysis of the dizinc(II) complex with p-nitrophenyl phosphate showed that the phosphate dianion binds as a bridging ligand to the two zinc(II) ions.     

C−H Insertion Reactions of Nucleophilic Carbenes

Syntheses and characterizations are described for C−H insertion products derived from 1,3-dimesityldihydroimidazol-2-ylidene ( 1 ) with acetylene, acetonitrile, methyl phenyl sulfone, and chloroform. In the reaction with acetylene, both acetylenic H-atoms are reactive so that 1 : 1 and 2 : 1 adducts can be obtained. The acetylene and methyl-phenyl-sulfone adducts are structurally characterized by means of single-crystal X-ray structure determinations. The reactions of 1,3,4,5-tetramethylimidazolidin-2-ylidene ( 8 ) with chloroform or chlorodifluoromethane are shown to yield 2-(dihaloalkyl)imidazolium salts that arise from a failure of the intermediate 2-protioimidazolium salt to capture the initially formed halocarbanion.     

Removal of phosphate from solution by adsorption and precipitation of calcium phosphate onto monohydrocalcite

The sorption behavior and mechanism of phosphate on monohydrocalcite (CaCO₃?H₂O: MHC) were examined using batch sorption experiments as a function of phosphate concentrations, ionic strengths, temperatures, and reaction times. The mode of PO₄ sorption is divisible into three processes depending on the phosphate loading. At low phosphate concentrations, phosphate is removed by coprecipitation of phosphate during the transformation of MHC to calcite. The sorption mode at the low-to-moderate phosphate concentrations is most likely an adsorption process because the sorption isotherm at the conditions can be fitted reasonably with the Langmuir equation. The rapid sorption kinetics at the conditions is also consistent with the adsorption reaction. The adsorption of phosphate on MHC depends strongly on ionic strength, but slightly on temperature. The maximum adsorption capacities of MHC obtained from the regression of the experimental data to the Langmuir equation are higher than those reported for stable calcium carbonate (calcite or aragonite) in any conditions. At high phosphate concentrations, the amount of sorption deviates from the Langmuir isotherm, which can fit the low-to-moderate phosphate concentrations. Speciation–saturation analyses of the reacted solutions at the conditions indicated that the solution compositions which deviate from the Langmuir equation are supersaturated with respect to a certain calcium phosphate. The obtained calcium phosphate is most likely amorphous calcium phosphate (Ca₃(PO₄)₂?xH₂O). The formation of the calcium phosphate depends strongly on ionic strength, temperature, and reaction times. The solubility of MHC is higher than calcite and aragonite because of its metastability. Therefore, the higher solubility of MHC facilitates the formation of the calcium phosphates more than with calcite and aragonite.     

Detection of metaphosphate intermediates in reaction solutions of phosphate esters: Chromatographic and spectroscopic studies

This study was undertaken to gain a better understanding of uncatalysed phosphoryl transfer reactions under neutral pH conditions in aqueous media. A combination of chromatographic (Ultra high performance liquid chromatography, UHPLC) and spectroscopic (Quadrupole time-of-flight-mass spectrometry- qTOF-MS;) UV-vis; and FTIR techniques were utilized to probe the mechanism of reaction under physiological conditions (aqueous medium; pH 7.0; 25°C). Mass spectroscopic data from these studies reveal that the phosphate monoesters, phenyl phosphate (PP) and 4-nitrophenyl phosphate (NPP) undergo collision-induced dissociation dynamics through the formation of the metaphosphate intermediate, [PO₃]^? – m/z 79, a process that was found to be independent of the pKa of the leaving group. Under conditions of the present experiment, the metaphosphate intermediate does not undergo protonation to either metaphosphoric acid, HPO₃ or the dibasic phosphonic acid, H₃PO₃.     

Quantum mechanical calculations on phosphate hydrolysis reactions

Multiple biological processes are regulated by kinases and phosphatases. This study aims to provide nonenzymatic models for phosphorylation and dephosphorylation of serine, threonine, and tyrosine phosphate using ab initio guantum mechanical calculations. We reduce the problem to methyl phosphate hydrolysis to model serine/threonine, and the hydrolysis of phenyl phosphate to model the tyrosine. HF, B3LYP, and MP2 calculations with a 6‐31+G(d) basis set were employed. The effect of water as a catalyst was also analyzed. As expected, the activation energy barrier is lowered. © 2000 John Wiley & Sons, Inc. J Comput Chem 21: 43–51, 2000