共查询到20条相似文献,搜索用时 15 毫秒
1.
The complexes of type cis-[Ru(S-DMSO)(3)(R-CO-CH═CH-R')Cl] (R = 2-hydroxyphenyl for all, R' = phenyl 1, naphthyl 2, anthracenyl 3, thiophene 4, 3-methyl thiophene 5) are synthesized and characterized using spectroscopic (IR, (1)H and (13)C NMR, and UV-vis) and single crystal X-ray diffraction techniques. Their crystal structures show the formation of both intermolecular and intramolecular H-bonding. The molecular assembly of complex 5 using secondary interactions provides a butterfly structure. The binding of complexes with calf thymus DNA is monitored using UV-vis spectral titrations. The binding interaction of complexes 1, 2, and 3 with DNA increases with increasing conjugation of aromatic rings. However, complexes 4 and 5 interact with DNA strongly. The emission from ethidium bromide (EB) bound DNA recorded in phosphate buffer solution (pH = 7.2) decreases by incremental addition of solution of the complexes. The complexes 4 and 5 (100 μM) bind with the minor groove of DNA and cleave double-stranded pBR322 DNA significantly even in the absence of an activator. In the presence of H(2)O(2), they cleave supercoiled DNA via oxidative pathway even at lower concentration (20 μM). Both complexes 4 and 5 inhibit topoisomerase II activity with IC(50) values of 18 and 13. These values suggest that 4 and 5 are potential topoisomerase II inhibitors as compared to some of known inhibitors like novobiocin and etoposide. 相似文献
2.
Potential inhibitors of DNA topoisomerase II: ruthenium(II) poly-pyridyl and pyridyl-azine complexes
Manish Chandra D.S. Pandey R.P. Tripathi V.J.M. Reddy Pedro Valerga 《Journal of organometallic chemistry》2004,689(13):2256-2267
In search of new DNA probes a series of new mono and binuclear cationic complexes [RuH(CO)(PPh3)2(L)]+ and [RuH(CO)(PPh3)2(-μ-L)RuH(CO)(PPh3)2]2+ [L=pyridine-2-carbaldehyde azine (paa), p-phenylene-bis(picoline)aldimine (pbp) and p-biphenylene-bis(picoline)aldimine (bbp)] have been synthesized. The reaction products were characterized by microanalyses, spectral (IR, UV-Vis, NMR and ESMS and FAB-MS) and electrochemical studies. Structure of the representative mononuclear complex [RuH(CO)(PPh3)2(paa)]BF4 was crystallographically determined. The crystal packing in the complex [RuH(CO)(PPh3)2(paa)]BF4 is stabilized by intermolecular π-π stacking resulting into a spiral network. Topoisomerase II inhibitory activity of the complexes and a few other related complexes [RuH(CO)(PPh3)2(L)]+ {L=2,4,6-tris(2-pyridyl)-1,3,5-triazine (tptz) and 2,3-bis(2-pyridyl)-pyrazine (bppz)} have been examined against filarial parasite Setaria cervi. Absorption titration experiments provided good support for DNA interaction and binding constants have also been calculated which were found in the range 1.2 × 103-4.01 × 104 M−1. 相似文献
3.
Romerosa A Campos-Malpartida T Lidrissi C Saoud M Serrano-Ruiz M Peruzzini M Garrido-Cárdenas JA García-Maroto F 《Inorganic chemistry》2006,45(3):1289-1298
The new water-soluble ruthenium(II) chiral complexes [RuCpX(L)(L')](n+) (X = Cl, I. L = PPh3; L' = PTA, mPTA; L = L' = PTA, mPTA) (PTA = 1,3,5-triaza-7-phosphaadamantane; mPTA = N-methyl-1,3,5-triaza-7-phosphaadamantane) have been synthesized and characterized by NMR and IR spectroscopy and elemental analysis. The salt mPTA(OSO2CF3) was also prepared and fully characterized by spectroscopic techniques. X-ray crystal structures of [RuClCp(PPh3)(PTA)] (2), [RuCpI(PPh3)(PTA)] (3), and [RuCpI(mPTA)(PPh3)](OSO2CF3) (9) have been determined. The binding properties toward DNA of the new hydrosoluble complexes have been studied using the mobility shift assay. The ruthenium chloride complexes interact with DNA depending on the hydrosoluble phosphine bonded to the metal, while the corresponding compounds with iodide, [RuCpI(PTA)2] (1), [RuCpI(PPh3)(PTA)] (3), [RuCpI(mPTA)2](OSO2CF3)2 (6), and [RuCpI(mPTA)(PPh3)](OSO2CF3) (9), do not bind to DNA. 相似文献
4.
Bakac A 《Dalton transactions (Cambridge, England : 2003)》2006,(13):1589-1596
In aqueous solutions, as in organic solvents, rhodium hydrides display the chemistry of one of the three limiting forms, i.e. {Rh(I)+ H+}, {Rh(II)+ H.}, and {Rh(III)+ H-}. A number of intermediates and oxidation states have been generated and explored in kinetic and mechanistic studies. Monomeric macrocyclic rhodium(II) complexes, such as L(H2O)Rh2+ (L = L1 = [14]aneN4, or L2 = meso-Me6[14]aneN4) can be generated from the hydride precursors by photochemical means or in reactions with hydrogen atom abstracting agents. These rhodium(II) complexes are oxidized rapidly with alkyl hydroperoxides to give alkylrhodium(III) complexes. Reactions of Rh(II) with organic and inorganic radicals and with molecular oxygen are fast and produce long-lived intermediates, such as alkyl, superoxo and hydroperoxo complexes, all of which display rich and complex chemistry of their own. In alkaline solutions of rhodium hydrides, the existence of Rh(I) complexes is implied by rapid hydrogen exchange between the hydride and solvent water. The acidity of the hydrides is too low, however, to allow the build-up of observable quantities of Rh(I). Deuterium kinetic isotope effects for hydride transfer to a macrocyclic Cr(v) complex are comparable to those for hydrogen atom transfer to various substrates. 相似文献
5.
6.
Summary New complexes of the general formula M(L)3Cl3 and M(5-AInz)2Cl3 · n H2O (where M = RuIII, RhIII and IrIII; L = indazole and 5-nitroindazole; n=1–2) have been synthesized and characterised by elemental analysis, molar conductance, magnetic susceptibility and i.r. and electronic spectral measurements. All the complexes are covalent and apparently have an octahedral geometry. The ligands are monocoordinated through the pyrrole nitrogen. From the far i.r. spectra amer configuration has been assigned to the indazole and 5-nitroindazole complexes. 相似文献
7.
The new water-soluble phosphine complexes of rhodium(III), [RhI(4)(mtpa)(2)]I (1), and ruthenium(II), [RuI(4)(mtpa)(2)].2H(2)O (2) and [RuI(2)(mtpa)(3)(H(2)O)]I(3).2H(2)O (3) (mtpa = 3,5-diaza-1-methyl-1-azonia-7-phosphatricyclo[3.3.1.1(3,7)]decane cation), have been prepared in the reactions of RhCl(3).3H(2)O and RuCl(3).3H(2)O in water in the presence of phosphine and potassium iodide. Properties and reactivity of the complexes have been investigated using (1)H and (31)P NMR and IR spectroscopies. The complexes have also been structurally characterized by single crystal X-ray diffraction studies. The compounds [RhI(4)(mtpa)(2)]I and [RuI(4)(mtpa)(2)].2H(2)O are zwitterionic octahedral complexes. The compounds were tested as catalysts for two-phase hydroformylation of 1-hexene and hydrogenation of cinnamaldehyde. Complex 1 is a selective catalyst for reduction of the C=C bond while complexes 2 and 3 selectively hydrogenate the C=O bond. 相似文献
8.
Ryuichi Arakawa Takekiyo Matsuo Hiroyuki Ito Itsuo Katakuse Koichi Nozaki Takeshi Ohno Masa-Aki Haga 《Journal of mass spectrometry : JMS》1994,29(6):289-294
Multiply charged ions from electrospray ionization (ESI) were observed for ruthenium-bidentate ligand complexes, such as [RuL2B]X2 and [(RuL2)2B]X4, where L is 2,2′-bipyridine, B are tetradentate ligands of 2,2′-bis(2′-pyridyl)bibenzimidazole and 2,6-bis(2′-pyridyl)benzodiimidazole, bidentate ligand of 2-(2′-pyridyl)benzimidazole and related compounds and X is CIO4- or CI-. ESI mass spectra showed a simple mass pattern for easy structural assignment and detecting impurities. The mass spectra for binuclear complexes provide a charge state distribution ranging from 4+ to 2+ for Ru(II)—Ru(II) compounds and 5+ to 2+ for Ru(II)—Rh(III) compounds. It was found that different multiply charged ions are generated by loss of counterions and by protonation/deprotonation at the proton site of ligands B. The abundances of these ions are qualitatively explained in terms of the acidity of metal complexes depending on the bridging ligand structures and the charge of the metal ions. Ions produced by removal of ligands were hardly observed. 相似文献
9.
《Polyhedron》1988,7(5):417-418
The synthesis and characterization of the platinum metal—1,3-diaryltriazenido complexes [Ru(ArNNNAr)(CO)3]2, [Ru(ArNNNAr)2]2, cis-Ru(ArNNNAr)2(CO)2, MX2(ArNNNAr)(PPh3)2 (M = Ru, Os; X = Cl, Br) and M′(ArNNNAr)3 (M′= Ru, Os, Rh and Ir) are reported. Axial ligand substitution in [Ru(ArNNNAr)(CO)3]2 and adduct formation by [Ru(ArNNNAr)2]2 are described. In contrast to other known Ru(II)/Ru(II) “lantern” molecules, the species [Ru(ArNNNAr)2]2 have measured magnetic moments equivalent to ca one unpaired electron per dimer, which are presumably due to population of the spin states σ2π4δ2π*4 and σ2π4δ2π*3σ*1. 相似文献
10.
Yasuhiro Yamamoto Hideki Nakamura Jian-Fang Ma 《Journal of organometallic chemistry》2001,640(1-2):10-20
Reactions of [(η6-arene)RuCl2]2 (1) (η6-arene=p-cymene (1a), 1,3,5-Me3C6H3 (1b), 1,2,3-Me3C6H3 (1c) 1,2,3,4-Me4C6H2(1d), 1,2,3,5-Me4C6H2 (1e) and C6Me6 (1f)) or [Cp*MCl2]2 (M=Rh (2), Ir (3); Cp*=C5Me5) with 4-isocyanoazobenzene (RNC) and 4,4′-diisocyanoazobenzene (CN–R–NC) gave mononuclear and dinuclear complexes, [(η6-arene)Ru(CNC6H4N=NC6H5)Cl2] (4a–f), [Cp*M(CNC6H4N=NC6H5)Cl2] (5: M=Rh; 6: M=Ir), [{(η6-arene)RuCl2}2{μ-CNC6H4N=NC6H4NC}] (8a–f) and [(Cp*MCl2)2(μ-CNC6H4N=NC6H4NC)}] (9: M=Rh; 10: M=Ir), respectively. It was confirmed by X-ray analyses of 4a and 5 that these complexes have trans-forms for the ---N=N--- moieties. Reaction of [Cp*Rh(dppf)(MeCN)](PF6)2 (dppf=1,1′-bis (diphenylphosphino)ferrocene) with 4-isocyanoazobenzene gave [Cp*Rh(dppf)(CNC6H4N=NC6H5)](PF6)2 (7), confirmed by X-ray analysis. Complex 8b reacted with Ag(CF3SO3), giving a rectangular tetranuclear complex 11b, [{(η6-1,3,5-Me3C6H3)Ru(μ-Cl}4(μ-CNC6H4N=NC6H4NC)2](CF3SO3)4 bridged by four Cl atoms and two μ-diisocyanoazobenzene ligands. Photochemical reactions of the ruthenium complexes (4 and 8) led to the decomposition of the complexes, whereas those of 5, 7, 9 and 10 underwent a trans-to-cis isomerization. In the electrochemical reactions the reductive waves about −1.50 V for 4 and −1.44 V for 8 are due to the reduction of azo group, [---N=N---]→[---N=N---]2−. The irreversible oxidative waves at ca. 0.87 V for the 4 and at ca. 0.85 V for 8 came from the oxidation of Ru(II)→Ru(III). 相似文献
11.
Jun-Teng Huang Xiang-Li Wang Yang Zhang Mian HR Mahmood Yan-Yuan Huang Xiao Ying Liang-Nian Ji Hai-Yang Liu 《Transition Metal Chemistry》2013,38(3):283-289
The interaction of a water-soluble sulfonated Mn(III) corrole Mn(tpfc)(SO3Na)2 [tpfc = 5,10,15-tris(pentafluorophenyl)corrole] with calf thymus DNA (ct-DNA) has been studied by spectroscopic methods, and the nuclease activity of this complex has also been examined by agarose gel electrophoresis. Mn(tpfc)(SO3Na)2 exhibits weak aggregation tendency in buffer solution and can bind to ct-DNA via an outside binding mode with a binding constant of 1.25 × 104 M?1. The observed increase in Stern–Volmer quenching constant with increasing temperature indicates that the competition of the manganese corrole and ethidium bromide with ct-DNA is a dynamic process. Moreover, the manganese corrole displays good chemical nuclease activity in the presence of hydrogen peroxide via oxidative cleavage of DNA. 相似文献
12.
S. Arounaguiri D. Easwaramoorthy A. Ashokkumar Aparna Dattagupta Bhaskar G. Maiya 《Journal of Chemical Sciences》2000,112(1):1-17
DNA binding and photocleavage characteristics of a series of mixed-ligand complexes of the type [M(phen)2LL]n+ (where M = Co(III), Ni(II) or Ru(II), LL = 1,10-phenanthroline (phen), phenanthroline-dione (phen-dione) or dipyridophenazine
(dppz) andn = 3 or 2) have been investigated in detail. Various physico-chemical and biochemical techniques including UV/Visible, fluorescence
and viscometric titration, thermal denaturation, and differential pulse voltammetry have been employed to probe the details
of DNA binding by these complexes; intrinsic binding constants (K
b) have been estimated under a similar set of experimental conditions. Analysis of the results suggests that intercalative
ability of the coordinated ligands varies as dppz>phen>phen-dione in this series of complexes. While the Co(II) and Ru(II)
complexes investigated in this study effect photocleavage of the supercoiled pBR 322 DNA, the corresponding Ni(II) complexes
are found to be inactive under similar experimental conditions. Results of detailed investigations carried out inquiring into
the mechanistic aspects of DNA photocleavage by [Co(phen)2(dppz)]3+ have also been reported. 相似文献
13.
14.
《Journal of organometallic chemistry》1987,328(3):387-391
The solvento species obtained by treatment of the complexes [Rh(1,5-cyclooctadiene)Cl]2, [Rh(norbornadiene)Cl]2, [Rh(CO)2Cl]2, C5H5Rh(CO)I2, [C5Me5RhCl2]2, and [Ru(C6H6)Cl2]2 with AgPF6 in acetone or acetonitrile react with a large excess of Me2NNS to give the compounds [Rh(1,5-C8H12)-(SNNMe2)2]PF6 (1a), [Rh(C7H8)(SNNMe2)2]PF6 (1b), [Rh(CO)2(SNNMe2)2]PF6 (2), [C5H5Rh(SNNMe2)3](PF6)2 (3), [C5Me5Rh(SNNMe2)3](PF6)2 (4), and [Ru(C6H6(SNNMe2)3](PF6) (5). If the thionitroso ligand is not preent in large excess decomposition often occurs. The use of AgClO4 allows isolation of the perchlorate salts of 1a, 1b, 2, 4, and 5, and the complexes [C5H5Rh-(SNNMe2)2(ClO4)ClO4 (6) and Rh(1,5-C8H12)(SNNMe2)(ClO4) (7). In the H1 NMR spectra the methyl protons of Me2NNS are observed as two quadruplets, in the range δ 3.75–4.25 (4J(HH) ca. 0.7 Hz) because of restricted rotation around the NN bond. The rhodium(I) complexes (1a, 1b, and 2) reacts with PPh3 or p-tolylPPh2 to give labile products, and only [Rh(1,5-C8H12)(SNNMe2)(PPh3)]ClO4 (8) and [Rh(1,5-C8H12)(SNNMe2)(p-tolylPPh2)]ClO4 (9) were isolated and characterized. 相似文献
15.
Rajagopal Gurusamy Prasanna Nagarajan Athappan Periakaruppan 《Transition Metal Chemistry》1999,24(3):251-257
Metal complexes of general formula [Cu(L)](ClO4)2, [Ru(L)(PPh3)2]Cl2 and [Ru(L)(PPh3)Cl]Cl2[L = 1,4-di- (o-benzylidiminophenoxy/benzylidiminophenylthio)butane] containing N2O2 or N2S2 donor atoms have been prepared and characterised by spectral, magnetic and cyclic voltammetric studies. The rhombic nature of the e.s.r. spectra of the RuIII complexes indicates an asymmetry in the electronic environment around the Ru atom. e.s.r. spectra of the CuII complexes show a typical four-line spectrum with approximate tetrahedral distortion. The observed low A values in the CuII complexes, of the order of 132–160 × 10–4cm–1, indicates a tetrahedrally distorted square planar structure.The influence of modified ligands is reflected in the metal-centered redox potentials. CuII complexes having the N2S2 chromophore, in MeCN on a glassy carbon electrode, undergo quasi-reversible reduction in the 540–680 mV range. A depression in E1/2 values for the open chain N2S2 chromophoric macrocyclic CuII complexes, compared to electronically similar cyclic tetradentate CuII analogues, is due to the increased stabilization of the CuI state by added flexibility provided through the open chain donor sites. 相似文献
16.
Ruthenium(II) polypyridyl complexes [Ru(phen)2(APIP)](ClO4)21 and [Ru(phen)2(HAPIP)](ClO4)22 have been synthesized and characterized. The DNA-binding behaviors were investigated by electronic absorption titration, luminescence spectra, viscosity measurements, thermal denaturation and photoactivated cleavage. The DNA-binding constants Kb for complexes 1 and 2 were determined to be 3.38 (±0.42) × 105 M−1 (s = 1.48) and 3.93 (±0.60) × 105 M−1 (s = 3.14), respectively. The studies on the photocleavage demonstrated that the effects of cleavage are concentration-dependent. The results showed that complexes 1 and 2 interact with CT-DNA by intercalative mode. The cytotoxicity of complexes 1 and 2 has been evaluated by MTT method. The apoptosis assay was carried out with acridine orange/ethidium bromide (AO/EB) staining methods. The cellular uptake showed that complexes can enter into the cytoplasm and accumulate in the nuclei. The antioxidant activity studies suggested that the ligands and complexes may be potential drugs to eliminate the radical. 相似文献
17.
Spillane CB Morgan JL Fletcher NC Collins JG Keene FR 《Dalton transactions (Cambridge, England : 2003)》2006,(25):3122-3133
The two enantiomers of [Ru(bpy)2(bbtb)]2+{bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the Lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+{Me(2)bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association with hairpin oligonucleotides, again with the Lambda enantiomer binding more strongly. A (1)H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents. 相似文献
18.
Merkle AC McQuarters AB Lehnert N 《Dalton transactions (Cambridge, England : 2003)》2012,41(26):8047-8059
In this paper, the synthesis, structural and spectroscopic characterization of a series of new Ru(III)-nitrosyls of {RuNO}(6) type with the coligand TPA (tris(2-pyridylmethyl)amine) are presented. The complex [Ru(TPA)Cl(2)(NO)]ClO(4) (2) was prepared from the Ru(III) precursor [Ru(TPA)Cl(2)]ClO(4) (1) by simple reaction with NO gas. This led to the surprising displacement of one of the pyridine (py) arms of TPA by NO (instead of the substitution of a chloride anion by NO), as confirmed by X-ray crystallography. NO complexes where TPA serves as a tetradentate ligand were obtained by reacting the new Ru(II) precursor [Ru(TPA)(NO(2))(2)] (3) with a strong acid. This leads to the dehydration of nitrite to NO(+), and the formation of the {RuNO}(6) complex [Ru(TPA)(ONO)(NO)](PF(6))(2) (4), which was also structurally characterized. Derivatives of 4 where nitrite is replaced by urea (5) or water (6) were also obtained. The nitrosyl complexes obtained this way were then further investigated using IR and FT-Raman spectroscopy. Complex 2 with the two anionic chloride coligands shows the lowest N-O and highest Ru-NO stretching frequencies of 1903 and 619 cm(-1) of all the complexes investigated here. Complexes 5 and 6 where TPA serves as a tetradentate ligand show ν(N-O) at higher energy, 1930 and 1917 cm(-1), respectively, and ν(Ru-NO) at lower energy, 577 and 579 cm(-1), respectively, compared to 2. These vibrational energies, as well as the inverse correlation of ν(N-O) and ν(Ru-NO) observed along this series of complexes, again support the Ru(II)-NO(+) type electronic structure previously proposed for {RuNO}(6) complexes. Finally, we investigated the photolability of the Ru-NO bond upon irradiation with UV light to determine the quantum yields (φ) for NO photorelease in complexes 2, 4, 5, and additional water-soluble complexes [Ru(H(2)edta)(Cl)(NO)] (7) and [Ru(Hedta)(NO)] (8). Although {RuNO}(6) complexes are frequently proposed as NO delivery agents in vivo, studies that investigate how φ is affected by the solvent water are lacking. Our results indicate that neutral water is not a solvent that promotes the photodissociation of NO, which would present a major obstacle to the goal of designing {RuNO}(6) complexes as photolabile NO delivery agents in vivo. 相似文献
19.
The title reaction was theoretically investigated, where cis-[RhH(2)(PH(3))(3)](+) and cis-[RhH(2)(PH(3))(2)(H(2)O)](+) were adopted as models of the catalyst. The first step of the catalytic cycle is the CO(2) insertion into the Rh(III)-H bond, of which the activation barrier (E(a)) is 47.2 and 28.4 kcal/mol in cis-[RhH(2)(PH(3))(3)](+) and cis-[RhH(2)(PH(3))(2)(H(2)O)](+), respectively, where DFT(B3LYP)-calculated E(a) values (kcal/mol unit) are given hereafter. These results indicate that an active species is not cis-[RhH(2)(PH(3))(3)](+) but cis-[RhH(2)(PH(3))(2)(H(2)O)](+). After the CO(2) insertion, two reaction courses are possible. In one course, the reaction proceeds through isomerization (E(a) = 2.8) of [RhH(eta(1)- OCOH)(PH(3))(2)(H(2)O)(2)](+), five-centered H-OCOH reductive elimination (E(a) = 2.7), and oxidative addition of H(2) to [Rh(PH(3))(2)(H(2)O)(2)](+) (E(a) = 5.8). In the other one, the reaction proceeds through isomerization of [RhH(eta(1)-OCOH)(PH(3))(2)(H(2)O)(H(2))](+) (E(a) = 5.9) and six-centered sigma-bond metathesis of [RhH(eta(1)-OCOH)(PH(3))(2)(H(2)O)](+) with H(2) (no barrier). RhH(PH(3))(2)-catalyzed hydrogenation of CO(2) proceeds through CO(2) insertion (E(a) = 1.6) and either the isomerization of Rh(eta(1)-OCOH)(PH(3))(2)(H(2)) (E(a) = 6.1) followed by the six-centered sigma-bond metathesis (E(a) = 0.3) or H(2) oxidative addition to Rh(eta(1)-OCOH)(PH(3))(2) (E(a) = 7.3) followed by isomerization of RhH(2)(eta(1)-OCOH)(PH(3))(2) (E(a) = 6.2) and the five-centered H-OCOH reductive elimination (E(a) = 1.9). From these results and our previous results of RuH(2)(PH(3))(4)-catalyzed hydrogenation of CO(2) (J. Am. Chem. Soc. 2000, 122, 3867), detailed discussion is presented concerning differences among Rh(III), Rh(I), and Ru(II) complexes. 相似文献
20.
de Lima Renata Galvão Lever A.B.P. Ito Izabel Y. Santana da Silva Roberto 《Transition Metal Chemistry》2003,28(3):272-275
New catecholamine ruthenium(III) complexes with potentially interesting biological activity are described. The complexes were prepared by reacting catecholamine with [RuCl(NH3)5]Cl2. The newly prepared species were formulated as [RuIII(NH3)4(catecholamine-R)]
n+ where catecholamine-R = noradrenaline, dopamine and isoproterenol, and were characterized by elemental analysis, e.p.r., electronic absorption and f.t.-i.r. They were moderately stable in water at room temperature for at least 1 week. In vitro tests of antifungal activity showed the ruthenium–catecholamine complexes had strong inhibitory action against the pathogenic yeast Candida albicans, Candida glabrata and Candida tropicalis. Free catecholamine does not show any antifungal activity. 相似文献