共查询到20条相似文献,搜索用时 609 毫秒
1.
Sensitive methods recently developed to measure laser-induced fluorescence from trapped ions have been applied to study the dynamics of double- and single-stranded oligonucleotides. In this paper, the fraying of duplex terminal base pairs has been identified by measuring the donor fluorescence as a function of temperature from an oligonucleotide duplex labeled with a pair of FRET dyes. Comparison of the degree of dissociation of 14-mer duplexes observed in the mass spectra with the fluorescence intensity of the donor enables intermediate conformations of the unzipping duplex at the weaker binding end of the duplex to be identified. The autodetachment of electrons from double- and single-stranded oligonucleotide anions has been observed in a gas phase environment. To characterize this process, measurements were performed on 7-mers prepared without FRET fluorophores attached. The dependence of the decay rates of trapped anions have been measured as a function of charge state and temperature for various base compositions. An exceptionally strong dependence of the decay rate on base composition has been identified. The physical basis for this process will be discussed. 相似文献
2.
Natalya Ramzaeva Helmut Rosemeyer Peter Leonard Klaus Mühlegger Frank Bergmann Herbert vonderEltz Frank Seela 《Helvetica chimica acta》2000,83(6):1108-1126
The 2′‐deoxypseudouridine ( 5 ) was functionalized at N(1) with methyl acrylate by Michael addition. The resulting methyl 2′‐deoxypseudouridine‐1‐propanoate ( 6 ) was converted to the phosphoramidite 8 and to the amino‐functionalized derivative 9 , which was transformed into the fluorescein‐labeled phosphoramidites 14 and 16 . Fluorescent oligonucleotides were synthesized either from these building blocks or by post‐synthetic modification of oligomers containing 2′‐deoxypseudouridine subunits. The stability of oligonucleotide duplexes was determined from the melting profiles, measured by UV‐ or VIS‐light absorbance, as well as from the fluorescence emission spectra. While small spacer residues did not affect the thermal stability of the 2′‐deoxypseudouridine‐containing duplexes, large dye residues led to destabilization. 相似文献
3.
Kottysch T Ahlborn C Brotzel F Richert C 《Chemistry (Weinheim an der Bergstrasse, Germany)》2004,10(16):4017-4028
The 5-position of pyrimidines in DNA duplexes offers a site for introducing alkynyl substituents that protrude into the major groove and thus do not sterically interfere with helix formation. Substituents introduced at the 5-position of the deoxyuridine residue of dU:dA base pairs may stabilize duplexes and reinforce helices weakened by a low G/C content, which would otherwise lead to false negative results in DNA chip experiments. Here we report on a method for preparing oligonucleotides with a 5-alkynyl substituent at a 2'-deoxyuridine residue by on-support Sonogashira coupling involving the fully assembled oligonucleotide. A total of 25 oligonucleotides with 5-alkynyl substituents were prepared. The substituents either decrease the UV melting point of the duplex with the complementary strand or increase it by up to 7.1 degrees C, compared with that of the unmodified control duplex. The most duplex-stabilizing substituent, a pyrenylbutyramidopropyne moiety, is likely to intercalate but does not prevent sequence-specific base pairing of the modified deoxyuridine residue or the neighboring nucleotides. It also increases the signal for a target strand when employed on a small oligonucleotide microarray. The ability to tune the melting point of a DNA dodecamer duplex with a single side chain over a temperature range of >11 degrees C may prove useful when developing DNA sequences for biomedical applications. 相似文献
4.
In this paper, we report a new strategy for highly sensitive determination of hydrogen peroxide, glucose and uric acid based on fluorescence resonance energy transfer (FRET) using gold nanoparticles (AuNPs) as energy acceptors. The principle is based on highly sensitive reaction of tetramethyl rhodamine (TMR) labeled tyramide and hydrogen peroxide catalysed by horseradish peroxidase (HRP), and the fluorescence spectrum of TMR (EX(max) 575 nm) partially overlaps with the visible absorption bands of AuNPs. We demonstrated an efficient FRET between tyramide labeled TMR (as energy donors) and HRP (BSA) conjugated AuNPs (as energy acceptors) due to the formation of TMR-labeled HRP-AuNPs or TMR-labeled BSA-AuNPs in the presence of H(2)O(2). We observed that the quenching of the fluorescence signal depended linearly on the H(2)O(2) concentration within a range of concentrations from 25 to 400 nM and the detection limit of this assay was 10 nM. Based on the principle for determination of H(2)O(2), we developed a new strategy for assay of glucose and uric acid by coupling with glucose oxidase (GOx)-mediated and uricase-mediated reaction. The established methods were successfully used for determination of glucose and uric acid levels in human sera, and the results obtained are in good agreement with commercially available methods. Our methods are at least 1 order of magnitude more sensitive than the commercially available methods. More importantly, our method described here can be extended to other assay designs using different oxidase enzymes, energy donors and energy acceptors, such as fluorescent quantum dots, near-infrared (NIR)-to-visible upconversion nanoparticles and even other metallic nanoparticles. 相似文献
5.
Bulge insertions of (R)-1-O-[4-(1-pyrenylethynyl)phenylmethyl]glycerol (5) into the middle of homopyrimidine oligodeoxynucleotides (twisted intercalating nucleic acids, TINA) obtained via postsynthetic Sonogashira coupling reaction led to extraordinary high thermal stability of Hoogsteen-type triplexes and duplexes, whereas Watson-Crick-type duplexes of the same nucleotide content were destabilized. Modified oligonucleotides were synthesized using the phosphoramidite of (S)-1-(4,4'-dimethoxytriphenylmethyloxy)-3-(4-iodo-benzyloxy)-propan-2-ol followed by treatment of the oligonucleotide on a CPG-support with the Sonogashira-coupling reaction mixture containing different ethynylaryls. Bulged insertion of the pyrene derivative 5 into oligonucleotides was found to be the best among the tested modifications for binding to the Hoogsteen-type triplexes and duplexes. Thus, at pH 7.2 an oligonucleotide with cytidine content of 36% possessing two bulged insertions of 5 separated by three bases formed a stable triplex (T(m) = 43.0 degrees C), whereas the native oligonucleotide was unable to bind to the target duplex. The corresponding Watson-Crick-type duplex with the same oligonucleotide had T(m) of 38.0 degrees C at pH 7.2, while the T(m) of unmodified dsDNA was 47.0 degrees C. Experiments with mismatched oligonucleotides, luminescent properties, and potential applications of TINA technology is discussed. 相似文献
6.
David C. Galefn Richard D. Smithcor 《Journal of the American Society for Mass Spectrometry》1995,6(12):1154-1164
The noncovalent complex formed in solution between minor groove binding molecules and an oligonucleotide duplex was investigated by electrospray ionization-mass spectrometry (ESI-MS). The oligonucleotide duplex formed between two sequence-specific 14-base pair oligonucleotides was observed intact by ESI-MS and in relatively high abundance compared to the individual single-stranded components. Only sequence-specific A:B duplexes were observed, with no evidence of random nonspecific aggregation (i.e., A:A or B:B) occurring under the conditions utilized. Due to the different molecular weights of the two 14-base pair oligonucleotides, unambiguous determination of each oligonucleotide and the sequence-specific duplex was confirmed through their detection at unique mass-to-charge ratios. The noncovalent complexes formed between the self-complementary 5′-dCGCAAATTTGCG-3′ oligonucleotide and three minor groove binding molecules (distamycin A, pentamidine, and Hoechst 33258) were also observed. Variation of several electrospray ionization interface parameters as well as collision-induced dissociation methods were utilized to characterize the nature and stability of the noncovalent complexes. The noncovalent complexes upon collisional activation dissociated into single-stranded oligonucleotides and single-stranded oligonucleotides associated with a minor groove binding molecule. ESI-MS shows potential for the study of small molecule-oligonucleotide duplex interactions and determination of small molecule binding stoichiometry. 相似文献
7.
We have applied fluorescence anisotropy and fluorescence resonance energy transfer (FRET) techniques to study the interaction between EcoRI DNA methyltransferase (M.EcoRI) and its target DNA in solution. Upon binding with M.EcoRI, the dsDNA containing GAATTC bends to flip out the second adenine for methylation. The binding affinity of M.EcoRI to two dsDNA fragments (20 and 38 bp) was studied with fluorescence anisotropy. Their binding constants at different temperatures from 20 to 40 degrees C were obtained, and the thermodynamic parameters of binding were derived. The results showed that M.EcoRI had a higher binding affinity to the short dsDNA strand than to the long one, and its binding to DNA was primarily entropy-driven. By labeling the 5' ends of the 20-bp dsDNA with two fluorescent dyes, fluorescein (FAM) and tetramethylrhodamine (TMR), we were able to monitor the enhanced TMR fluorescence in the presence of M.EcoRI. The end-to-end distance of the dsDNA determined from the FRET efficiency was changed from 72.4 to 63.4 A, and the DNA bending angle was estimated as 57.8 degrees . 相似文献
8.
A heptamer composed of C5-(1-propynyl) pyrimidines (Y(p)'s) is a potent and specific antisense agent against the mRNA of SV40 large T antigen (Wagner, R. W.; Matteucci, M. D.; Grant, D.; Huang, T.; Froehler, B. C. Nat. Biotechnol. 1996, 14, 840-844). To characterize the role of the propynyl groups in molecular recognition, thermodynamic increments associated with substitutions in DNA:RNA duplexes, such as 5'-dCCUCCUU-3':3'-rGAGGAGGAAAU-5', have been measured by UV melting experiments. For nucleotides tested, an unpaired dangling end stabilizes unmodified and propynylated duplexes similarly, except that addition of a 5' unpaired rA is 1.4 kcal/mol more stabilizing on the propynylated, PODN:RNA, duplex than on the DNA:RNA duplex. Free energy increments for addition of single propynyl groups range from 0 to -4.0 kcal/mol, depending on the final number and locations of substitutions. A preliminary model for predicting the stabilities of Y(p)-containing hybrid duplexes is presented. Eliminating one amino group, and therefore a hydrogen bond, by substituting inosine (I) for guanosine (G), to give 5'-dC(p)C(p)U(p)C(p)C(p)U(p)U(p)-3':3'-rGAGIAGGAAAU-5', destabilizes the duplex by 3.9 kcal/mol, compared to 1.7 kcal/mol for the same change within the unpropynylated duplex. This 2.2 kcal/mol difference is eliminated by removing a single propynyl group three base pairs away. CD spectra suggest that single propynyl deletions within the PODN:RNA duplex have position-dependent effects on helix geometry. The results suggest long-range cooperativity between propynyl groups and provide insights for rationally programming oligonucleotides with enhanced binding and specificity. This can be exploited in developing technologies that are dependent upon nucleic acid-based molecular recognition. 相似文献
9.
A small-angle X-ray scattering study showed that the action of tetrahydrocortisol (THC) in complex with apolipoprotein A I (ApoA-I) on DNA leads to local melting of DNA. The most probable site of interaction between this complex and DNA is the (GCC)n-type sequence. Oligonucleotides (duplexes) of this type have been synthesized. It was demonstrated that the interaction of this oligonucleotide with the THC-ApoA-I complex leads to dissociation into complementary oligonucleotides. The latter ones also interact with the THC-ApoA-I complex. The kinetics of this multistep process is presented. The mechanism of interaction between hormones or their ApoA-I complexes and duplex CC(GCC)5.GG(CGG)5Li2 was studied using IR spectroscopy. It was shown that the interaction with THC or the THC-ApoA-I complex leads to the formation of hydrogen bonds between the OH group of the hormone A-ring and the C=O group of cytosine or guanine. Interaction with cortisol or the cortisol-ApoA-I complex leads to the formation of a hydrogen bond with the NH group of cytosine; in addition, THC and cortisol form hydrogen bonds with the PO2 group of the duplex and with the OH group of the monosaccharide. The interaction of ApoA-I with the duplex is accompanied by the formation of hydrogen bonds between the protein NH2 group and the C=O group of cytosine and the P=O group. The order-to-order structural transition takes place in the duplex under the action of THC or cortisol, with THC causing a higher ordering as compared to cortisol. The order-to-disorder structural transition occurs in the duplex under the action of the THC-ApoA-I, cortisol-ApoA-I, or ApoA-I complexes. Shifting the pH of the medium from 7.2 to 6.0 also leads to an order-to-disorder-type structural transition. 相似文献
10.
Deoxynucleic guanidine (DNG), a DNA analogue in which positively charged guanidine replaces the phosphodiester linkages, tethering to Hoechst 33258 fluorophore by varying lengths has been synthesized. A pentameric thymidine DNG was synthesized on solid phase in the 3' --> 5' direction that allowed stepwise incorporation of straight chain amino acid linkers and a bis-benzimidazole (Hoechst 33258) ligand at the 5'-terminus using PyBOP/HOBt chemistry. The stability of (DNA)(2).DNG-H triplexes and DNA.DNG-H duplexes formed by DNG and DNG-Hoechst 33258 (DNG-H) conjugates with 30-mer double-strand (ds) DNA, d(CGCCGCGCGCGCGAAAAACCCGGCGCGCGC)/d(GCGGCGCGCGCGCTTTTTGGGCCGCGCGCG), and single-strand (ss) DNA, 5'-CGCCGCGCGCGCGAAAAACCCGGCGCGCGC-3', respectively, has been evaluated by thermal melting and fluorescence emission experiments. The presence of tethered Hoechst ligand in the 5'-terminus of the DNG enhances the (DNA)(2).DNG-H triplex stability by a DeltaT(m) of 13 degrees C. The fluorescence emission studies of (DNA)(2).DNG-H triplex complexes show that the DNG moiety of the conjugates bind in the major groove while the Hoechst ligand resides in the A:T rich minor groove of dsDNA. A single G:C base pair mismatch in the target site decreases the (DNA)(2).DNG triplex stability by 11 degrees C, whereas (DNA)(2).DNG-H triplex stability was decreased by 23 degrees C. Inversion of A:T base pair into T:A base pair in the center of the binding site, which provides a mismatch selectively for DNG moiety, decreases the triplex stability by only 5-6 degrees C. Upon hybridization of DNG-Hoechst conjugates with the 30-mer ssDNA, the DNA.DNG-H duplex exhibited significant increase in the fluorescence emission due to the binding of the tethered Hoechst ligand in the generated DNA.DNG minor groove, and the duplex stability was enhanced by DeltaT(m) of 7 degrees C. The stability of (DNA)(2).DNG triplexes and DNA.DNG duplexes is independent of pH, whereas the stability of (DNA)(2).DNG-H triplexes decreases with increase in pH. 相似文献
11.
Cross-linked DNA was constructed by a "stepwise click" reaction using a bis-azide. The reaction is performed in the absence of a template, and a monofunctionalized oligonucleotide bearing an azido-function is formed as intermediate. For this, an excess of the bis-azide has to be used compared to the alkynylated oligonucleotide. The cross-linking can be carried out with any alkynylated DNA having a terminal triple bond at any position of the oligonucleotide, independent of chain length or sequence with identical or nonidentical chains. Short and long linkers with terminal triple bonds were introduced in the 7-position of 8-aza-7-deaza-2'-deoxyguanosine (1 or 2), and the outcome of the "stepwise" click and the "bis-click" reaction was compared. The cross-linked DNAs form cross-linked duplexes when hybridized with single-stranded complementary oligonucleotides. The stability of these cross-linked duplexes is as high as respective individual duplexes when they were ligated at terminal positions with linkers of sufficient length. The stability decreases when the linkers are incorporated at central positions. The highest duplex stability was reached when two complementary cross-linked oligonucleotides were hybridized. 相似文献
12.
Beljanski V Villanueva JM Doetsch PW Natile G Marzilli LG 《Journal of the American Chemical Society》2005,127(45):15833-15842
The N7-Pt-N7 adjacent G,G intrastrand DNA cross-link responsible for cisplatin anticancer activity is dynamic, promotes local "melting" in long DNA, and converts many oligomer duplexes to single strands. For 5'-d(A1T2G3G4G5T6A7C8C9C10A11T12)-3' (G3), treatment of the (G3)2 duplex with five pairs of [LPt(H2O)2]2+ enantiomers (L = an asymmetric diamine) formed mixtures of LPt-G3 products (1 Pt per strand) cross-linked at G3,G4 or at G4,G5 in all cases. L chirality exerted little influence. For primary diamines L with bulk on chelate ring carbons (e.g., 1,2-diaminocyclohexane), the duplex was converted completely into single strands (G3,G4 coils and G4,G5 hairpins), exactly mirroring results for cisplatin, which lacks bulk. In sharp contrast, for secondary diamines L with bulk on chelate ring nitrogens (e.g., 2,2'-bipiperidine, Bip), unexpectedly stable duplexes having two platinated strands (even a unique G3,G4/G4,G5 heteroduplex) were formed. After enzymatic digestion of BipPt-G3 duplexes, the conformation of the relatively nondynamic G,G units was shown to be head-to-head (HH) by HPLC/mass spectrometric characterization. Because the HH conformation dominates at the G,G lesion in duplex DNA and in the BipPt-G3 duplexes, the stabilization of the duplex form only when the L nitrogen adducts possess bulk suggests that H-bonding interactions of the Pt-NH groups with the flanking DNA lead to local melting and to destabilization of oligomer duplexes. The marked dependence of adduct properties on L bulk and the minimal dependence on L chirality underscore the need for future exploration of the roles of the L periphery in affecting anticancer activity. 相似文献
13.
Ingale SA Pujari SS Sirivolu VR Ding P Xiong H Mei H Seela F 《The Journal of organic chemistry》2012,77(1):188-199
7-Deazapurine and 8-aza-7-deazapurine nucleosides related to dA and dG bearing 7-octadiynyl or 7-tripropargylamine side chains as well as corresponding oligonucleotides were synthesized. "Click" conjugation with 1-azidomethyl pyrene (10) resulted in fluorescent derivatives. Octadiynyl conjugates show only monomer fluorescence, while the proximal alignment of pyrene residues in the tripropargylamine derivatives causes excimer emission. 8-Aza-7-deazapurine pyrene "click" conjugates exhibit fluorescence emission much higher than that of 7-deazapurine derivatives. They are quenched by intramolecular charge transfer between the nucleobase and the dye. Oligonucleotide single strands decorated with two "double clicked" pyrenes show weak or no excimer fluorescence. However, when duplexes carry proximal pyrenes in complementary strands, strong excimer fluorescence is observed. A single replacement of a canonical nucleoside by a pyrene conjugate stabilizes the duplex substantially, most likely by stacking interactions: 6-12 °C for duplexes with a modified "adenine" base and 2-6 °C for a modified "guanine" base. The favorable photophysical properties of 8-aza-7-deazapurine pyrene conjugates improve the utility of pyrene fluorescence reporters in oligonucleotide sensing as these nucleoside conjugates are not affected by nucleobase induced quenching. 相似文献
14.
Incorporation of metalated nucleosides into DNA through covalent modification is crucial to measurement of thermal electron-transfer rates and the dependence of these rates with structure, distance, and position. Here, we report the first synthesis of an electron donor-acceptor pair of 5' metallonucleosides and their subsequent incorporation into oligonucleotides using solid-phase DNA synthesis techniques. Large-scale syntheses of metal-containing oligonucleotides are achieved using 5' modified phosporamidites containing [Ru(acac)(2)(IMPy)](2+) (acac is acetylacetonato; IMPy is 2'-iminomethylpyridyl-2'-deoxyuridine) (3) and [Ru(bpy)(2)(IMPy)](2+) (bpy is 2,2'-bipyridine; IMPy is 2'-iminomethylpyridyl-2'-deoxyuridine) (4). Duplexes formed with the metal-containing oligonucleotides exhibit thermal stability comparable to the corresponding unmetalated duplexes (T(m) of modified duplex = 49 degrees C vs T(m) of unmodified duplex = 47 degrees C). Electrochemical (3, E(1/2) = -0.04 V vs NHE; 4, E(1/2) = 1.12 V vs NHE), absorption (3, lambda(max) = 568, 369 nm; 4, lambda(max) = 480 nm), and emission (4, lambda(max) = 720 nm, tau = 55 ns, Phi = 1.2 x 10(-)(4)) data for the ruthenium-modified nucleosides and oligonucleotides indicate that incorporation into an oligonucleotide does not perturb the electronic properties of the ruthenium complex or the DNA significantly. In addition, the absence of any change in the emission properties upon metalated duplex formation suggests that the [Ru(bpy)(2)(IMPy)](2+)[Ru(acac)(2)(IMPy)](2+) pair will provide a valuable probe for DNA-mediated electron-transfer studies. 相似文献
15.
Johansson MK Fidder H Dick D Cook RM 《Journal of the American Chemical Society》2002,124(24):6950-6956
Many genomics assays use profluorescent oligonucleotide probes that are covalently labeled at the 5' end with a fluorophore and at the 3' end with a quencher. It is generally accepted that quenching in such probes without a stem structure occurs through F?rster resonance energy transfer (FRET or FET) and that the fluorophore and quencher should be chosen to maximize their spectral overlap. We have studied two dual-labeled probes with two different fluorophores, the same sequence and quencher, and with no stem structure: 5'Cy3.5-beta-actin-3'BHQ1 and 5'FAM-beta-actin-3'BHQ1. Analysis of their absorption spectra, relative fluorescence quantum yields, and fluorescence lifetimes shows that static quenching occurs in both of these dual-labeled probes and that it is the dominant quenching mechanism in the Cy3.5-BHQ1 probe. Absorption spectra are consistent with the formation of an excitonic dimer, an intramolecular heterodimer between the Cy3.5 fluorophore and the BHQ1 quencher. 相似文献
16.
Rozners E Katkevica D Bizdena E Strömberg R 《Journal of the American Chemical Society》2003,125(40):12125-12136
Oligoribonucleotide analogues having amide internucleoside linkages (AM1: 3'-CH(2)CONH-5' and AM2: 3'-CH(2)NHCO-5') at selected positions have been synthesized and the thermal stability of duplexes formed by these analogues with complementary RNA fragments has been evaluated by UV melting experiments. Two series of oligomers with either 2'-OH or 2'-OMe vicinal to the amide linkages were studied. Monomeric synthons (3' and 5'-C amines and carboxylic acids) were synthesized as follows: For synthesis of the AM1 analogue, the known sequence of radical allylation followed by the cleavage of the double bond was adopted. For synthesis of the AM2 analogue, novel routes via addition of nitromethane followed by conversion of the nitro function to either amino or carboxyl groups were developed. Coupling of monomeric amines and carboxylic acids followed by protecting group manipulation and phosphonylation gave dimeric 3'-hydrogenphosphonate building blocks for oligonucleotide synthesis. Monomeric model compounds having 3'-amide and 2'-OH or 2'-OMe groups were also prepared and their conformational equilibrium was determined by (1)H NMR. The AM1 and AM2 models showed equal preferences for the North conformers (at 40 degrees C, 88-89% with 2'-OH, and 92-93% with 2'-OMe). At physiological salt concentration (0.1 M NaCl) the duplexes between AM1 modified oligonucleotides and RNA had stability similar to unmodified RNA-RNA duplexes (Delta t(m)= -0.2 to +0.7 degrees C per modification). However, the AM2 modification resulted in substantial stabilization of duplexes: Delta t(m)= +1 to +2.4 degrees C per modification compared to all RNA. A 2'-O-methyl vicinal to the AM2 linkage further increased the duplex stability. Our results suggest that RNA analogues having amide internucleoside bonds are very promising candidates for medicinal applications. 相似文献
17.
Semiconductor quantum dots (QDs) coated with thioalkyl acid ligands are often used as probes and reporters for nucleic acid sensing, or protein sensing using aptamers, and are also potential vectors for gene delivery. In such applications, the interactions that potentially lead to the adsorption of oligonucleotides onto the surface of colloidal QDs are an important consideration. To explore such interactions, fluorescence resonance energy transfer (FRET) between QDs and oligonucleotides labeled with a fluorescent dye was used to identify and characterize a set of conditions that favor strong adsorption on 3-mercaptopropionic acid (MPA)-coated CdSe/ZnS QDs. Adsorption curves and competitive binding experiments were used to determine that the order of affinity for nucleobase adsorption was dC>dA≥dG?dT. The length of the oligonucleotide sequence was also important, with an 80-mer sequence adsorbing more strongly than its 20-mer analog. Adsorption decreased with increasing pH and corresponded to the ionization of the carboxylic acid groups of the MPA ligands. Increased ionic strength partially offsets ligand ionization and increased the extent of adsorption. The interaction between QDs and oligonucleotides was labile, with increases in adsorption at lower concentrations of oligonucleotide and with an increasing number of oligonucleotides per QD. The results were consistent with a hydrogen-bonding model for adsorption, where neutral thioalkyl acid ligands interact favorably with nucleobases and ionized ligands resist adsorption. 相似文献
18.
Variants of the hc ligase ribozyme, which catalyzes ligation of the 3' end of an RNA substrate to the 5' end of the ribozyme, were utilized to evolve a ribozyme that catalyzes ligation reactions on an external RNA template. The evolved ribozyme catalyzes the joining of an oligonucleotide 3'-hydroxyl to the 5'-triphosphate of an RNA hairpin molecule. The ribozyme can also utilize various substrate sequences, demonstrating a largely sequence-independent mechanism for substrate recognition. The ribozyme also carries out the ligation of two oligonucleotides that are bound at adjacent positions on a complementary template. Finally, it catalyzes addition of mononucleoside 5'-triphosphates onto the 3' end of an oligonucleotide primer in a template-dependent manner. The development of ribozymes that catalyze polymerase-type reactions contributes to the notion that an RNA world could have existed during the early history of life on Earth. 相似文献
19.
Fluorescence-quenching phenomenon by photoinduced electron transfer between a fluorescent dye and a nucleotide base. 总被引:7,自引:0,他引:7
M Torimura S Kurata K Yamada T Yokomaku Y Kamagata T Kanagawa R Kurane 《Analytical sciences》2001,17(1):155-160
Fluorescently labeled oligonucleotide probes have been widely used in biotechnology, and fluorescence quenching by the interaction between the dyes and a nucleobase has been pointed out. This quenching causes big problem in analytical methods, but is useful in some other cases. Therefore, it is necessary to estimate the fluorescence quenching intensity under various conditions. We focused on the redox properties of some commercially available fluorescent dyes, and investigated dye-nucleotide interactions between a free dye and a nucleotide in aqueous solution by electrochemical and spectroscopic techniques. Our results suggested that the quenching was accompanied by photoinduced electron transfer between a thermodynamically quenchable excited dye and a specific base. Several kinds of fluorescent dyes labeled to the 5'-end of oligonucleotide C10T6 were prepared, and their quenching ratios compared upon hybridization with the complementary oligonucleotide A6G10. The quenching was completely reversible and their efficiencies depended on the attached fluorophore types. The fluorescence of 5-FAM, BODIPY FL or TAMRA-modified probe was strongly quenched by hybridization. 相似文献
20.
Fluorescence properties and photophysics of the sulfoindocyanine Cy3 linked covalently to DNA 总被引:3,自引:0,他引:3
Sanborn ME Connolly BK Gurunathan K Levitus M 《The journal of physical chemistry. B》2007,111(37):11064-11074
The sulfoindocyanine Cy3 is one of the most commonly used fluorescent dyes in the investigation of the structure and dynamics of nucleic acids by means of fluorescence methods. In this work, we report the fluorescence and photophysical properties of Cy3 attached covalently to single-stranded and duplex DNA. Steady-state and time-resolved fluorescence techniques were used to determine fluorescence quantum yields, emission lifetimes, and fluorescence anisotropy decays. The existence of a transient photoisomer was investigated by means of transient absorption techniques. The fluorescence quantum yield of Cy3 is highest when attached to the 5' terminus of single-stranded DNA (Cy3-5' ssDNA), and decreases by a factor of 2.4 when the complementary strand is annealed to form duplex DNA (Cy3-5' dsDNA). Substantial differences were also observed between the 5'-modified strands and strands modified through an internal amino-modified deoxy uridine. The fluorescence decay of Cy3 became multiexponential upon conjugation to DNA. The longest lifetime was observed for Cy3-5' ssDNA, where about 50% of the decay is dominated by a 2.0-ns lifetime. This value is more than 10 times larger than the fluorescence lifetime of the free dye in solution. These observations are interpreted in terms of a model where the molecule undergoes a trans-cis isomerization reaction from the first excited state. We observed that the activation energy for photoisomerization depends strongly on the microenvironment in which the dye is located. The unusually high activation energy measured for Cy3-5' ssDNA is an indication of dye-ssDNA interactions. In fact, the time-resolved fluorescence anisotropy decay of this sample is dominated by a 2.5-ns rotational correlation time, which evidences the lack of rotational freedom of the dye around the linker that separates it from the terminal 5' phosphate. The remarkable variations in the photophysical properties of Cy3-DNA constructs demonstrate that caution should be used when Cy3 is used in studies employing DNA conjugates. 相似文献