Chemical synthesis of oligoribonucleotides containing 2-aminopurine: substrates for the investigation of ribozyme function

The chemical synthesis of a fully protected ribonucleoside phosphoramidite, containing 2-aminopurine as the base component, and its incorporation into short oligoribonucleotides as substrates for an engineered ribozyme from Tetrahymena is described.     

Chemical synthesis of RNA via 2′-O-cyanoethylated intermediates

It was found that 2′-O-cyanoethyl group could be removed from 2′-O-cyanoethylated ribonucleoside derivatives by treatment with Bu₄NF. This finding was successfully applied to the synthesis of oligoribonucleotides via their 2′-O-cyanoethylated derivatives as key intermediates where a cyanoethyl group was used as the 2′-hydroxyl protecting group. The rate of condensation using this protecting group in the presence of various activators was generally faster than that observed when a TBDMS group was used as the protecting group.     

Synthesis of Phospholipid?Ribavirin Conjugates

New conjugates of antiviral nucleoside Ribavirin (=1‐(β‐D ‐ribofuranosyl)‐1H‐1,2,4‐triazole‐3‐carboxamide; 1 ) with 1,2‐ and 1,3‐diacyl glycerophosphates have been synthesized by the phosphoramidite method. A combination of 2′,3′‐phenylboronate protecting group for the sugar moiety of the ribonucleoside 1 and 2‐cyanoethyl protection for the phosphate fragment ensured the preparation of the desired compounds with reasonable yields via a small number of synthetic steps.     

Synthesis of 2'-O-[2-(N-methylcarbamoyl)ethyl]ribonucleosides using oxa-Michael reaction and chemical and biological properties of oligonucleotide derivatives incorporating these modified ribonucleosides

To develop oligonucleotides containing new 2'-O-modified ribonucleosides as nucleic acid drugs, we synthesized three types of ribonucleoside derivatives modified at the 2'-hydroxyl group with 2-(methoxycarbonyl)ethyl (MOCE), 2-(N-methylcarbamoyl)ethyl (MCE), and 2-(N,N-dimethylcarbamoyl)ethyl (DMCE) groups, as key intermediates, via the oxa-Michael reaction of the appropriately protected ribonucleoside (U, C, A, and G) derivatives. Among them, the 2'-O-MCE ribonucleosides were found to be the most stable under basic conditions. To study the effects of the 2'-O-modification on the nuclease resistance of oligonucleotides incorporating the 2'-O-modified ribonucleosides and their hybridization affinities for the complementary RNA and DNA strands, 2'-O-MCE-ribonucleoside phosphoramidite derivatives were successfully synthesized and subjected to the synthesis of 2'-O-MCE-oligonucleotides and 2'-O-methyl-oligonucleotides incorporating 2'-O-MCE-ribonucleosides. The 2'-O-MCE-oligonucleotides and chimeric oligomers with 2'-O-MCE and 2'-O-methyl groups thus obtained demonstrated complementary RNA strands and much higher nuclease resistances than the corresponding 2'-O-methylated species. Finally, we incorporated the 2'-O-MCE-ribonucleosides into antisense 2'-O-methyl-oligoribonucleotides to examine their exon-skipping activities in splicing reactions related to pre-mRNA of mouse dystrophin. The exon-skipping assay of these 2'-O-methyl-oligonucleotide incorporating 2'-O-MCE-uridines showed better efficacies than the corresponding 2'-O-methylated oligoribonucleotide phosphorothioate derivatives.     

Large scale synthesis of oligoribonucleotides on PEG by the phosphite triester approach

Large scale synthesis of oligoribonucleotides has been successfully performed on PEG support by the phosphoramidite approach using t-butyldimethylsilyl to protect the 2'-hydroxyl group of ribonucleoside. By means of this procedure, the dodecamer r(AGUGGUCUUUGU) was synthesized in 98.1% average coupling yield, and 55 mg pure product was obtained from one gram of functionalized PEG.     

Semisynthesis of 3′(2′)‐O‐(Aminoacyl)‐tRNA Derivatives as Ribosomal Substrate

An efficient synthesis of (3′‐terminally) 3′(2′)‐O‐aminoacylated pCpA derivatives is described, which could lead to the production of (aminoacyl)‐tRNAs following T4 RNA ligase mediated ligation. The tetrahydrofuranyl (thf) group was used as a permanent protective group for the 2′‐OH of the cytidine moiety which can be removed during the purification of the 3′(2′)‐O‐aminoacylated‐pCpA. This approach allowed for a general synthesis of (3′‐terminally) 3′(2′)‐O‐aminoacylated oligonucleotides. The fully protected pCpA 14 was synthesized by phosphoramidite chemistry and treated with NH₃ solution to remove the 2‐cyanoethyl and benzoyl groups (→ 15 ; Schemes 1 and 2). The 2′‐O‐thf‐protected‐pCpA 15 was coupled with α‐amino acid cyanomethyl esters, and the products 20a – c were deprotected and purified with AcOH buffer to afford 3′(2′)‐O‐aminoacylated pCpA 21a – c in high yields. The 3′(2′)‐O‐aminoacylated pCpA were efficiently ligated with tRNA(? CA) to yield (aminoacyl)‐tRNA which was an active substrate for the ribosome.     

2-(4-Tolylsulfonyl)ethoxymethyl (TEM)-a new 2'-OH protecting group for solid-supported RNA synthesis

The 2-(4-tolylsulfonyl)ethoxymethyl (TEM) as a new 2'-OH protecting group is reported for solid-supported RNA synthesis using phosphoramidite chemistry. The usefulness of the 2'-O-TEM group is exemplified by the synthesis of 12 different oligo-RNAs of various sizes (14-38 nucleotides long). The stepwise coupling yield varied from 97-99% with an optimized coupling time of 120 s. The synthesis of all four pure phosphoramidite building blocks is also described. Two new reliable parameters, delta(C2')-delta(C3') and delta(H2')-delta(H3'), have been suggested for the characterization of isomeric 2'-O-TEM and 3'-O-TEM as well as other isomeric mono 2'/3'-protected ribonucleoside derivatives. The most striking feature of this strategy is that the crude RNA prepared using our 2'-O-TEM strategy is sufficiently pure (>90%) for molecular biology research without any additional purification step, thereby making oligo-RNAs easily available at a relatively low cost, saving both time and lab resources.     

Synthesis and properties of aminoacylamido-AMP: chemical optimization for the construction of an N-acyl phosphoramidate linkage

This paper describes the design and synthesis of a new type of aminoacyl-adenylate analogue (aa-AMPN) having an N-acyl phosphoramidate linkage where the oxygen atom of the mixed anhydride bond of aminoacyl-adenylate (aa-AMP) is replaced by an amino group. This new type of aa-AMP analogue is expected to be useful as material for studies on the recognition mechanism of the aminoacylation of tRNA and other biochemical reactions. The condensation of phosphoramidite derivatives of carboxamides with nucleoside derivatives failed, because the activated phosphoramidite derivatives reacted with not only the hydroxyl groups but also another reactive species. An alternative approach was examined by the reaction of 5'-O-phosphoramidite adenosine derivatives with carboxamide derivatives. The TBTr and TSE groups were chosen for protection of the amino group of amino acid amides and the phosphate group, respectively. Detailed studies revealed that the use of 5-(3,5-dinitrophenyl)-1H-tetrazole as an activating catalyst of phosphoramidites resulted in rapid condensation within 10 min to give fully protected aa-AMPN derivatives. No side reaction occurred. Deprotection of these products via a two-step procedure gave aa-AMPN derivatives in good yields. It also turned out that aa-AMPNs thus obtained are stable under both acidic and basic conditions, such as 0.1 M HCl (pH 1.0) and 0.1 M NaOH (pH 13.0).     

Synthesis of 2'-N-methylamino-2'-deoxyguanosine and 2'-N,N-dimethylamino-2'-deoxyguanosine and their incorporation into RNA by phosphoramidite chemistry

The 2'-hydroxyl groups within RNA contribute in essential ways to RNA structure and function. Previously, we designed an atomic mutation cycle (AMC) that uses ribonucleoside analogues bearing different C-2'-substituents, including -OCH(3), -NH(2), -NHMe, and -NMe(2), to identify hydroxyl groups within RNA that donate functionally significant hydrogen bonds. To enable AMC analysis of the nucleophilic guanosine cofactor in the Tetrahymena ribozyme reaction and at other guanosines whose 2'-hydroxyl groups impart critical functional contributions, we describe here the syntheses of 2'-methylamino-2'-deoxyguanosine (G(NHMe)) and 2'-N,N-dimethylamino-2'-deoxyguanosine (G(NMe(2))) and their corresponding phosphoramidites. The key step in obtaining the nucleosides involved S(N)2 displacement of 2'-β-triflate from an appropriate guanosine derivative by methylamine or dimethylamine. We readily obtained the G(NMe(2)) phosphoramidite and incorporated it into RNA. However, the G(NHMe) phosphoramidite posed a significantly greater challenge due to lack of a suitable -2'-NHMe protecting group. After testing several strategies, we established that allyloxycarbonyl (Alloc) provided suitable protection for 2'-N-methylamino group during the phosphoramidite synthesis and the subsequent RNA synthesis. This work enables AMC analysis of guanosine's 2'-hydroxyl group within RNA.     

Pyrrolo-dC and pyrrolo-C: fluorescent analogs of cytidine and 2-deoxycytidine for the study of oligonucleotides

Pyrrolo-dC (1a, 6-methyl-3-(2-deoxy-β-d-ribofuranosyl)-3H-pyrrolo[2,3-d]pyrimidin-2-one) and its cyanoethyl phosphoramidite 2a were synthesized. The latter was incorporated into oligodeoxyribonucleotides by standard automated synthesis techniques, where pyrrolo-dC was found to serve as a fluorescent analog of deoxycytidine. The cyanoethylphosphoramidite (2b) of pyrrolo-C (2a, 6-methyl-3-(β-d-ribofuranosyl)-3H-pyrrolo[2,3-d]pyrimidin-2-one) was also synthesized and may find use for the site-specific incorporation of a fluorescent cytidine analog into oligoribonucleotides.     

Acid/azole complexes as highly effective promoters in the synthesis of DNA and RNA oligomers via the phosphoramidite method

The utility of various kinds of acid salts of azole derivatives as promoters for the condensation of a nucleoside phosphoramidite and a nucleoside is investigated. Among the salts, N-(phenyl)imidazolium triflate, N-(p-acetylphenyl)imidazolium triflate, N-(methyl)benzimidazolium triflate, benzimidazolium triflate, and N-(phenyl)imidazolium perchlorate have shown extremely high reactivity in a liquid phase. These reagents serve as powerful activators of deoxyribonucleoside 3'-(allyl N,N-diisopropylphosphoramidite)s or 3'-(2-cyanoethyl N,N-diisopropylphosphoramidite)s employed in the preparation of deoxyribonucleotides, and 3'-O-(tert-butyldimethylsilyl)ribonucleoside 2'-(N,N-diisopropylphosphoramidite)s or 2'-O-(tert-butyldimethylsilyl)ribonucleoside 3'-(N,N-diisopropylphosphoramidite)s used for the formation of 2'-5' and 3'-5' internucleotide linkages between ribonucleosides, respectively. The azolium salt has allowed smooth and high-yield condensation of the nucleoside phosphoramidite and a 5'-O-free nucleoside, in which equimolar amounts of the reactants and the promoter are employed in the presence of powdery molecular sieves 3A in acetonitrile. It has been shown that some azolium salts serve as excellent promoters in the solid-phase synthesis of oligodeoxyribonucleotides and oligoribonucleotides. For example, benzimidazolium triflate and N-(phenyl)imidazolium triflate can be used as effective promoters in the synthesis of an oligodeoxyribonucleotide, (5')CGACACCCAATTCTGAAAAT(3') (20mer), via a method using O-allyl/N-allyloxycarbonyl-protected deoxyribonucleoside 3'-phosphoramidites or O-(2-cyanoethyl)/N-phenoxyacetyl-protected deoxyribonucleotide 3'-phosphoramidite as building blocks, respectively, on high-cross-linked polystyrene resins. Further, N-(phenyl)imidazolium triflate is useful for the solid-phase synthesis of oligoribonucleotides, such as (5')AGCUACGUGACUACUACUUU(3') (20mer), according to an allyl/allyloxycarbonyl-protected strategy. The utility of the azolium promoter has been also demonstrated in the liquid-phase synthesis of some biologically important substances, such as cytidine-5'-monophosphono-N-acetylneuraminic acid (CMP-Neu5Ac) and adenylyl(2'-5')adenylyl(2'-5')adenosine (2-5A core).     

RNA synthesis via dimer and trimer phosphoramidite block coupling

The solid-phase synthesis of oligoribonucleotides using dimer and trimer phosphoramidite blocks is described. This method significantly reduces the total number of steps required in the synthesis of a target RNA sequence, provides more material, and simplifies separation of the product from shorter failure sequences. The procedure is illustrated by the synthesis of UpU, ApA, and UpUpU phosphoramidite blocks and their use in the rapid synthesis of oligoribonucleotides on a solid support. Dimer and trimer amidite blocks will likely find use in the large scale solution (or solid)-phase synthesis of siRNA drugs.     

An efficient reagent for the phosphorylation of deoxyribonucleosides, DNA oligonucleotides, and their thermolytic analogues

[reaction: see text] The phosphoramidite 11 was prepared in three steps from methyl 2-mercaptoacetate and demonstrated efficiency in the synthesis of conventional 5'-/3'-phosphate/thiophosphate monoester derivatives of 2'-deoxyribonucleosides and DNA oligonucleotides. Moreover, the use of 11 has enabled the preparation of the dinucleoside phosphorothioate analogue 26 in high yields (>95%) with minimal cleavage (<2%) of the thermolytic thiophosphate protecting group.     

Synthesis,Molecular Recognition,and Enzymology of Oligonucleotides Containing the Non-standard Base Pair between 5-Aza-7-deazaisoguanine and 6-Amino-3-methylpyrazin-2(1H)-one,a Donor-Acceptor-Acceptor Purine Analog and an Acceptor-Donor-Donor Pyrimidine Analog

A 6-aminopyrazin-2(1H)-one (pyADD), when incorporated as a pyrimidine-base analog into an oligonucleotide chain, presents a H-bond acceptor-donor-donor pattern to 5-aza-7-deazaisoguanine (puDAA), the complementrary donor-acceptor-acceptor purine analog. Reported here are the syntheses of the phosphoramidite of the 2′-deoxyribonucleoside bearing the puDAA base, oligonucleotides containing this nucleoside unit, the enzyme-assisted synthesis of oligoribonucleotides containing the pyADD ribonucleoside, and the molecular-recognition properties of this non-standard base pair in an oligonucleotide context. A series of melting experiments suggests that the pyADD · puDAA base pair contributes to the relative stability of a duplex structure approximately the same as an A · T base pair, and significantly more than mismatches between these non-standard bases and certain standard nucleobases. The pyADD nucleoside bisphosphate is accepted by T4 RNA ligase, but the triphosphate of the pyADD nucleoside was not incorported by T7 RNA polymerase opposite the puDAA nucleobase in a template. Oligonucleotides containing the pyADD base slowly undergo a reversible first-order reaction, presumably an epimerization process to give the α-D -anomer. These experiments provide the tools for laboratory-based use of the pyADD · puDAA base pair as a component of an oligonucleotide-like molecular-recognition system based on an expanded genetic alphabet.     

Studies on the chemical synthesis of oligodeoxynucleotides containing the s5T(6-4)T photoproduct: side reactions derived from the methylsulfenyl thiol protection elucidated by MALDI mass spectrometry

Attempts to incorporate the phosphoramidite of the thymine-thymine (6-4) photoproduct C5 thiol analogue (s(5)T(6-4)T PP), whose sulfur atom was protected with the methylsulfenyl group, into oligodeoxynucleotides (ODNs), are reported. Using matrix-assisted laser desorption-ionisation mass spectrometry (MALDI-MS) coupled to enzymatic digestion, accurate mass measurements and tandem mass spectrometry experiments, we demonstrated that ODNs containing the (2-cyanoethylthio)(5)T(6-4)T PP were obtained. Supported by model reactions, these results were explained 1) by the incorporation, during oligonucleotide synthesis, of the sulfur deprotected phosphoramidite that arose from a Michaelis-Arbusov-type rearrangement, and 2) the Michael addition to the thiol of acrylonitrile released upon the cyanoethyl phosphotriester deprotection. To avoid the formation of the cyanoethyl adduct, the phosphotriester deprotection was carried out in the presence of a thiol in excess. This afforded the ODN containing the h(5)T(6-4)T PP.     

Synthesis and analysis of RNA containing 6-trifluoromethylpurine ribonucleoside

We report the synthesis of a 5'-DMT-2'-TBDMS-protected phosphoramidite of 6-trifluoromethylpurine ribonucleoside ((TFM)P) and its use in the site-specific incorporation of 6-trifluoromethylpurine into RNA. Properties of (TFM)P-substituted RNA suggest it will be valuable in the study of RNA structure and the binding of RNA-modifying enzymes, particularly the RNA-editing adenosine deaminases. Reaction: see text.     

Synthesis of C4-linked imidazole ribonucleoside phosphoramidite with pivaloyloxymethyl (POM) group

A novel C4-linked imidazole ribonucleoside phosphoramidite was designed and successfully synthesized starting from tribenzylribofuranosylimidazole. This phosphoramidite product enables incorporation of the imidazole moiety into an RNA sequence and hence allows study of its role in the general acid and base catalysis of ribozymes. Pivaloyloxymethyl (POM) was first introduced as an N-protecting group for the imidazole ribonucleoside that can be readily removed under mild basic condition.     

An improved phosphoramidite approach for the chemical synthesis of 3′,5′-cyclic diguanylic acid

3′,5′-Cyclic diguanylic acid (c-di-GMP) plays important roles as a signaling and effector molecule in prokaryotes as well as inducing innate and adaptive immune responses in mammalian cells through activation of cell death pathways. An improved phosphoramidite method for the synthesis of c-di-GMP is reported herein. The method is based on the use of an unprecedented 5′-O-formyl ester, which can efficiently and chemoselectively be cleaved from a dinucleotide phosphoramidite intermediate to permit a 1H-tetrazole-mediated cyclocondensation reaction leading to a fully protected c-di-GMP product in a yield of 78%. The native c-di-GMP is isolated in an overall yield of 36% based on the commercial ribonucleoside used as starting material.     

Nucleotides,Part LXVIII,Acetals as New 2′‐O‐Protecting Functions for the Synthesis of Oligoribonucleotides: Synthesis of Monomeric Building Units and Oligoribonucleotides

For the efficient synthesis of oligoribonucleotides by the 5′‐O‐(4,4′‐dimethoxytrityl) phosphoramidite approach, the 2′‐O‐[1‐(benzyloxy)ethyl]acetals 56 – 67 were investigated. Studies with the 2′‐O‐[1‐(benzyloxy)ethyl]‐5′‐O‐(dimethoxytrityl)ribonucleoside 3′‐phosphoramidites 56 – 59 gave, however, only reasonable results. The oligoribonucleotides obtained showed some impurities since the acid stabilities of the acetal and dimethoxytrityl functions are too close to guarantee a high selectivity. A combination of new acid‐labile protected 2′‐O‐protecting groups with the 2‐(4‐nitrophenyl)ethyl/[2‐(4‐nitrophenyl)ethoxy]carbonyl (npe/npeoc) strategy for base protection was more successful. The synthesis and physical properties of the monomeric building units and their intermediates 8 – 67 and the conditions for the automated generation of homo‐ and mixed oligoribonucleotides is described. The new 2′‐acetal protecting group could be cleaved off in a two step procedure and was designed for levelling their stability with regard to the attached nucleobase as well. Therefore, we used the 1‐{{3‐fluoro‐4‐{{[2‐(4‐nitrophenyl)ethoxy]carbonyl}oxy}benzyl}oxy}ethyl (fnebe) moiety for the protection of 2′‐OH of uridine, and for that of 2′‐OH of A, C, and G, the 1‐{{4‐{{[2‐(4‐nitrophenyl)ethoxy]carbonyl}oxy}benzyl}oxy}ethyl (nebe) residue. After selective deprotection by β‐elimination induced by a strong organic base like DBU, the remaining activated acetal was hydrolyzed under very mild acidic protic conditions, which reduced 2′‐3′ isomerization and chain cleavage. Also storage, handling, and purification of the chemically and enzymatically sensitive oligomers was simplified by this approach.     

Nucleosides. Part LV. Efficient synthesis of arabinoguanosine building blocks

From guanosine ( 1 ) as starting molecule, protected arabinoguanosine derivatives such as phosphoramidite precursors and arabinoguanosine ( 18 ) itself were prepared in high yields. Inversion of the configuration at C(2′) was achieved by introduction of the (trifluoromethyl)sulfonyl residue and subsequent displacement by nucleophiles like acetate, bromide, and azide. The guanine moiety was protected at the amide function by the 2-(4-nitrophenyl)ethyl (npe) group on O⁶ and at the NH₂ function by the 2-(4-nitrophenyl)ethoxycarbonyl (npeoc) group.