Stabilisation of human telomeric quadruplex DNA and inhibition of telomerase by a platinum-phenanthroline complex

Two new mono-substituted phenanthroline ligands and their platinum(II) square planar complexes have been prepared; one of the complexes has been shown to induce a high degree of quadruplex DNA stabilisation and to inhibit telomerase.     

Structural basis of DNA quadruplex recognition by an acridine drug

The crystal structure of a complex between the bimolecular human telomeric quadruplex d(TAGGGTTAGGGT)2 and the experimental anticancer drug BRACO-19, has been determined, to 2.5 A resolution. The binding site for the BRACO-19 molecule is at the interface of two parallel-folded quadruplexes, sandwiched between a G-tetrad surface and a TATA tetrad, and held in the site by networks of water molecules. The structure rationalizes the existing structure-activity data and provides a starting-point for the structure-based design of quadruplex-binding ligands     

Kinetic discrimination in recognition of DNA quadruplex targets by guanine-rich heteroquadruplex-forming PNA probes

Guanine-rich peptide nucleic acid probes hybridize to DNA G quadruplex targets with high affinity, forming PNA-DNA heteroquadruplexes. We report a surprising degree of kinetic discrimination for PNA heteroquadruplex formation with a series of DNA targets. The fastest hybridization is observed for targets folded into parallel morphologies.     

A mirror-image tetramolecular DNA quadruplex

L-DNA, the mirror image of natural DNA forms structures of opposite chirality. We demonstrate here that a short guanine rich L-DNA strand forms a tetramolecular quadruplex with the same properties as a D-DNA strand of identical sequence, besides an inverted circular dichroism spectra. L- and D-strands self exclude when mixed together, showing that the controlled parallel self-assembly of different G-rich strands can be obtained through L-DNA use.     

Fluorescent aromatic platforms for cell patterning

This paper describes a simple experimental method of patterning fluorescent organic dyes, fluorescein, and rhodamine on gold substrates by microcontact printing techniques. The development of this step-by-step protocol has allowed us to prepare striped and squared micropatterns with poly(ethylene glycol) (PEG) linkers terminated by these fluorophores using a fast, easy, and inexpensive technique. Although the rest of the surface was covered with aliphatic molecules (methyl terminated), human fibroblasts demonstrated an unexpected response, aligning themselves according to the aromatic patterns, despite the presence of PEG, which is a cell resistant molecule, in the fluorescent regions.     

Electrochemical single-molecule conductivity of duplex and quadruplex DNA

1. Download : Download high-res image (236KB)
2. Download : Download full-size image

     

Tandem mass spectrometry of platinated quadruplex DNA

Quadruplexes are higher-order structures formed by G-rich DNA strands that are involved in various processes of cell cycle regulation, such as control of telomere length and participation in gene regulation. Because of these central biological functions, quadruplex DNA represents a promising target for cancer therapy, e.g. by applying organometallic drugs, such as cisplatin. High-resolution electrospray tandem mass spectrometry is evaluated as a technique for exploring structural features of unplatinated and platinated quadruplexes. Results of experiments on tetramolecular, bimolecular and monomolecular quadruplexes provide information about the extent of platination and the binding sites of the drug. The dissociation behavior of the different types of quadruplexes is compared. Tetramolecular quadruplexes were found to weave out a strand end in order to provide a platination site, and their fragmentation is characterized by the release of an unplatinated strand and the formation of a platinated triplex. Partial opening of the structure in combination with the loss of small fragments leads to truncated quadruplex ions. For the bimolecular quadruplexes studied, strand separation is the predominant dissociation pathway. Depending on the loop sequence, cross-linking of the loops by cisplatin is demonstrated. Distinct differences in the product ion spectra of unannealed and annealed monomolecular sequences provide proof of quadruplex formation and show that platination preferentially occurs at the terminal regions.     

Triplex and quadruplex DNA structures studied by electrospray mass spectrometry

DNA triplex and quadruplex structures have been successfully detected by electrospray ionization mass spectrometry (ESI-MS). Circular dichroism and UV-melting experiments show that these structures are stable in 150 mM ammonium acetate at pH 7 for the quadruplexes and pH 5.5 for the triplexes. The studied quadruplexes were the tetramer [d(TGGGGT)](4), the dimer [d(GGGGTTTTGGGG)](2), and the intramolecular folded strand dGGG(TTAGGG)(3), which is an analog of the human telomeric sequence. The absence of sodium contamination allowed demonstration of the specific inclusion of n - 1 ammonium cations in the quadruplex structures, where n is the number of consecutive G-tetrads. We also detected the complexes between the quadruplexes and the quadruplex-specific drug mesoporphyrin IX. MS/MS spectra of [d(TGGGGT)](4) and the complex with the drug are also reported. As the drug does not displace the ammonium cations, one can conclude that the drug binds at the exterior of the tetrads, and not between them. For the triplex structure the ESI-MS spectra show the detection of the specific triplex, at m/z values typically higher than those typically observed for duplex species. Upon MS/MS the antigene strand, which is bound into the major groove of the duplex, separates from the triplex. This is the same dissociation pathway as in solution. To our knowledge this is the first report of a triplex DNA structure by electrospray mass spectrometry.     

Interaction between human telomere and a carbazole derivative: a molecular dynamics simulation of a quadruplex stabilizer and telomerase inhibitor

The mechanism of inhibition of telomerase by drugs is a key factor in an understanding of guanine-quadruplex complex stabilization during human cancer. This study describes a simulated annealing docking and molecular dynamics simulation to investigate a synthesized potent inhibitor, 3,6-bis(1-methyl-4-vinylpyridinium iodine) carbazole (BMVC), which stabilizes the quadruplex structure of the human telomeric DNA sequence d[AG3(T(2)AG(3))3] and inhibits telomerase activity. The compound was predicted to selectively interact with the quadruplex structure. During our simulation, the binding affinities were calculated and used to predict the best drug-binding sites as well as enhanced selectivity compared with other compounds. Our studies suggest that the simulation results quite coincide with the experimental results. In addition, molecular modeling shows that a 2:1 binding model involving the external binding of BMVC to both ends of the G-quartet of d[AG(3)(T(2)AG)3))3] is the most stable binding mode and this agrees with the absorbance titration results that show two binding sites. Of particular interest is that one pyridinium ring and carbazole moiety of the BMVC can stack well at the end of G-quartet. This implies that BMVC is a good human quadruplex stabilizer and also a good telomerase inhibitor.     

Stabilization of G-quadruplex DNA and inhibition of telomerase activity by square-planar nickel(II) complexes

Two new alkylamine-substituted nickel(II)-salphen complexes have been prepared and their interactions with DNA investigated. FRET studies have shown that these complexes have a remarkable ability to stabilize G-quadruplex DNA. Furthermore, TRAP/Taq assays have shown that these complexes inhibit telomerase at low micromolar concentrations.     

Putative DNA quadruplex formation within the human c-kit oncogene

The DNA sequence, d(AGGGAGGGCGCTGGGAGGAGGG), occurs within the promoter region of the c-kit oncogene. We show here, using a combination of NMR, circular dichroism, and melting temperature measurements, that this sequence forms a four-stranded quadruplex structure under physiological conditions. Variations in the sequences that intervene between the guanine tracts have been examined, and surprisingly, none of these modified sequences forms a quadruplex arrangement under these conditions. This suggests that the occurrence of quadruplex-forming sequences within the human and other genomes is less than was hitherto expected. The c-kit quadruplex may be a new target for therapeutic intervention in cancers where there is elevated expression of the c-kit gene.     

Hybridization of PNA to structured DNA targets: quadruplex invasion and the overhang effect

Peptide nucleic acid (PNA) probes have been synthesized and targeted to quadruplex DNA. UV-vis and CD spectroscopy reveal that the quadruplex structure of the thrombin binding aptamer (TBA) is disrupted at 37 degrees C by a short PNA probe. The corresponding DNA probe fails to bind to the stable secondary structure at this temperature. Thermal denaturation experiments indicate surprisingly high thermal and thermodynamic stabilities for the PNA-TBA hybrid. Our results point to the nonbonded nucleobase overhangs on the DNA as being responsible for this stability. This "overhang effect" is found for two different PNA-DNA sequences and a variety of different overhang lengths and sequences. The stabilization offered by the overhangs assists the PNA in overcoming the stable secondary structure of the DNA target, an effect which may be significant in the targeting of biological nucleic acids, which will always be much longer than the PNA probe. The ability of PNA to invade a structured DNA target expands its potential utility as an antigene agent or hybridization probe.     

UV spectroscopy of DNA duplex and quadruplex structures in the gas phase

UV absorption spectroscopy is one of the most widely used methods to monitor nucleic acid folding in solution, but the absorption readout is the weighted average contribution of all species present in solution. Mass spectrometry, on the other hand, is able to separate constituents of the solution based on their mass, but methods to probe the structure of each constituent are needed. Here, we explored whether gas-phase UV spectroscopy can give an indication of DNA folding in ions isolated by electrospray mass spectrometry. Model DNA single strands, duplexes, and G-quadruplexes were extracted from solution by electrospray; the anions were stored in a quadrupole ion trap and irradiated by a tunable laser to obtain the UV action spectra of each complex. We found that the duplex and quadruplex spectra are significantly different from the spectra of single strands, thereby suggesting that electronic spectroscopy can be used to probe the DNA gas-phase structure and obtain information about the intrinsic properties of high-order DNA structure.     

Interpolyelectrolyte complexes of conjugated copolymers and DNA: platforms for multicolor biosensors

Interchain interactions modulate the frequency of emission from a cationic water-soluble conjugated polymer. The polymer, PFPB, is obtained by a Suzuki copolymerization of p-phenylenebisboronic acid with a 95:5 mixture of 2,7-dibromo-9,9-bis(6'-bromohexyl)fluorene and 4,7-dibromo-2,1,3-benzothiadiazole, followed by quarternization of the pendant groups by addition of NMe3. The structure of PFPB contains 5% of the 2,1,3-benzothiadiazole (BT) chromophore within a cationic poly(fluorene-co-phenylene) polymer chain. The emission of PFPB is blue under dilute conditions (<1 x 10-6 M in repeat units) and green at higher concentrations. Energy transfer to dye-labeled ss-DNA is more efficient, relative to the parent polymer poly(9,9-bis(6'-N,N,N,-trimethylammonium)hexyl)fluorene-co-alt-1,4-phenylene) dibromide (PFP), as a result of improved spectral overlap. By using a peptide nucleic acid (PNA-C*) labeled with a red-emitting chromophore one can obtain three different emission colors, depending on the nature of the substrate under interrogation. If no ss-DNA is present, the solution emits blue. With a ss-DNA that is noncomplementary to PNA-C*, green emission is observed. Red emission occurs upon addition of ss-DNA complementary to the PNA sequence.     

Long-distance radical cation transport in DNA: Horizontal charge hopping in a dimeric quadruplex

A series of DNA hairpins were synthesized and shown to associate to form quadruplexes formed by stacking five G-quartets in an antiparallel orientation. One of the hairpins in the quadruplex was linked covalently at the 5'-end to an anthraquinone (AQ) group and a 32P label was incorporated either at the 3'-terminus of the AQ-containing hairpin or on its partner hairpin in the quadruplex. Irradiation of the AQ group with UV light leads to the one-electron oxidation of the DNA and concomitant introduction of a radical cation into the DNA. Analysis by PAGE and autoradiography shows that the radical cation reacts at guanines both on the AQ-containing strand and with its partner hairpin in the quadruplex. This observation demonstrates that charge migration in DNA occurs vertically along a DNA chain and horizontally within a G-quartet.     

Promoting the formation and stabilization of human telomeric G-quadruplex DNA, inhibition of telomerase and cytotoxicity by phenanthroline derivatives

Four new di-substituted phenanthroline-based compounds a-d have been designed and prepared, and they have been shown to induce the formation of anti-parallel structure of human telomeric G-quadruplex DNA by CD spectra. FRET assay indicates that the melting temperature increases (ΔT(m) values) of G-quadruplex in buffer (pH 7.4) containing 100 mM NaCl are 31.6, 34.6, 17.8 and 32.6 °C for the compounds (1.0 μM) a, b, c and d, respectively. Competitive FRET assay shows that the four compounds exhibit a high G-quadruplex DNA selectivity over duplex DNA. Three of the compounds are the potent telomerase inhibitors and HeLa cell proliferation inhibitors.