A New and Efficient Method for Synthesis of 5′‐Conjugates of Oligonucleotides through Amide‐Bond Formation on Solid Phase

An efficient method for synthesis of oligonucleotide 5′‐conjugates through amide‐bond formation on solid phase is described. Protected oligonucleotides containing a 5′‐carboxylic acid function were obtained by use of a novel non‐nucleosidic phosphoramidite building block, where the carboxylic acid moiety was protected by a 2‐chlorotrityl group. The protecting group is stable to the phosphoramidite coupling conditions used in solid‐phase oligonucleotide assembly, but is easily deprotected by mild acidic treatment. The protecting group may be removed also by ammonolysis. 5′‐Carboxylate‐modified oligonucleotides were efficiently conjugated on solid support under normal peptide‐coupling conditions to various amines or to the N‐termini of small peptides to yield products of high purity. The method is well‐suited in principle for the synthesis of peptide‐oligonucleotide conjugates containing an amide linkage between the 5′‐end of an oligonucleotide and the N‐terminus of a peptide.     

Improved synthesis of oligonucleotides containing 2-thiouridine derivatives by use of diluted iodine solution

It is known that the 2-thiocarbonyl group of 2-thiouridine (s²U) derivatives reacts easily with various oxidizing agents used in oligonucleotide synthesis to give a complex mixture. In this letter, we report an improved method for the synthesis of oligonucleotides containing s²U derivatives. It turned out that the 2-thiocarbonyl group of oligonucleotides containing s²U derivatives was stable in a 0.02 M solution of iodine in pyridine-THF-H₂O. These conditions were successfully applied to the synthesis of oligonucleotides containing s²U derivatives on an automated DNA/RNA synthesizer. Moreover, no undesirable side reactions were detected so that these modified oligonucleotides could be obtained in markedly improved yields.     

A conformationally preorganized universal solid support for efficient oligonucleotide synthesis

A novel, conformationally preorganized nonnucleosidic universal solid support for oligonucleotide synthesis was developed. The solid support featured two chemically equivalent hydroxy groups locked in syn-periplanar orientation and orthogonally protected with 4,4'-dimethoxytrityl and acetyl groups. The solid support was extensively tested in the preparation of oligonucleotides and their phosphorothioate analogues containing 2'-deoxy, 2'-O-methyl, and 2'-O-methoxyethylnucleoside residues at the 3'-terminus. Upon completion of oligonucleotide chain assembly, the support-bound oligonucleotide material was treated with concentrated ammonium hydroxide, which removed the O-acetyl protection. The deprotected hydroxy group then effected the transesterification of a phosphate linkage between the solid support and the 3'-terminal nucleoside residue to result in a facile release of the oligonucleotide to solution. The kinetics of the release process was studied in a continuous flow of concentrated aqueous ammonium hydroxide at a temperature of 300.15 K. Optimal conditions for the release of oligonucleotides depending on the chemistry of the backbone and 3'-terminal nucleoside residue were formulated.     

Efficient conjugation of peptides to oligonucleotides by "native ligation"

A new strategy has been developed for conjugation of peptides to oligonucleotides. The method is based on the "native ligation" of an N-terminal thioester-functionalized peptide to a 5'-cysteinyl oligonucleotide. Two new reagents were synthesized for use in solid-phase peptide and oligonucleotide synthesis, respectively. Pentafluorophenyl S-benzylthiosuccinate was used in the final coupling step in standard Fmoc-based solid-phase peptide assembly. Deprotection with trifluoracetic acid generated in solution peptides substituted with an N-terminal S-benzylthiosuccinyl moiety. O-trans-4-(N-alpha-Fmoc-S-tert-butylsulfenyl-L-cysteinyl)aminoc yclohe xyl O-2-cyanoethyl-N,N-diisopropylphosphoramidite was used in the final coupling step in standard phosphoramidite solid-phase oligonucleotide assembly. Deprotection with aqueous ammonia solution generated in solution 5'-S-tert-butylsulfenyl-L-cysteinyl functionalized oligonucleotides. Functionalized peptides and oligonucleotides were used without purification in native ligation conjugation reactions in aqueous/organic solution using tris-(2-carboxyethyl)phosphine to remove the tert-butylsulfenyl group in situ and thiophenol as a conjugation enhancer. A range of peptide-oligonucleotide conjugates were prepared by this route and purified by reversed-phase HPLC.     

Synthesis of Pentaerythritol-Based Branching Reagents for Modification of Proteins and Nucleic Acids by [2+3] Dipolar Cycloaddition Reaction

Alkylation of pentaerythritol symmetrically substituted with propylene glycol with propargyl bromide afforded compounds containing two or three alkyne moieties. Amidophosphite reagents and solid supports were prepared for the introduction of two and three acetylene fragments into oligonucleotides at the 3'- and 5'-positions and inside the chain under conditions of automated solid-phase oligonucleotide synthesis. Based on the trialkynyl derivative, an N-hydroxysuccinimide ester was obtained which can be used to modify biomolecules attacking the amino group. Conjugates obtained can be used for multiple modifications by [3+2] dipolar cycloaddition reaction.     

New solid support for the synthesis of 3'-oligonucleotide conjugates through glyoxylic oxime bond formation

A novel solid support 1 was synthesized to incorporate glyoxylic aldehyde functionality at the oligonucleotide 3'-terminus. 6-mer and 11-mer oligonucleotide sequences containing 3'-glyoxylic aldehyde functionality were prepared by using this support. These modified oligonucleotides were coupled to reporters containing an aminooxy group to prepare oligonucleotide 3'-conjugates through glyoxylic oxime bond formation. The hydrolytic stability of a glyoxylic oxime linkage was also investigated. [reaction: see text].     

Oligonucleotide conjugation to a cell-penetrating (TAT) peptide by Diels-Alder cycloaddition

Modifed oligonucleotides are routinely employed as analytical probes for use in diagnostics, e.g. in the examination of specific RNA sequences for infectious diseases, however, a major limiting factor in oligonucleotide-based diagnostics is poor cellular uptake of naked oligonucleotides. This problem can be overcome by covalent attachment of a so-called 'cell-penetrating peptide' to form an oligonucleotide peptide conjugate. Stepwise solid phase synthesis of such a conjugate is difficult and expensive due to the conflicting chemistries of oligonucleotides and peptides. A simple approach to overcome this is post-synthetic conjugation. Diels-Alder cycloaddition is an attractive methodology for oligonucleotide peptide conjugation; the reaction is fast, chemoselective and the reaction rate is greatly enhanced in aqueous media - ideal conditions for biological moieties. An oligodeoxyribonucleotide sequence has been derivatised with a series of dienes at the 5'-terminus, using a series of unique dienyl-modified phosphoramidites, and investigation into the effect of diene type on the efficiency of conjugation, using Diels-Alder cycloaddition with a maleimido-derivatised cell-penetrating (TAT) peptide, has been performed. This led to the observation that the optimal diene for conjugation was cyclohexadiene, allowing conjugation of oligodeoxyribonucleotides to a cell-penetrating peptide by Diels-Alder cycloaddition for the first time.     

Simple Methods for Preparing Oligonucleotides Containing 1) Thiol Groups at their 5′-Termini, 2) 5′-Phosphates

Abstract

A simple method has been developed for synthesising oligonucleotides containing a thiol group at their 5′-termini. The sequence required is prepared using standard solid phase phosphoramidite methods and an extra round of synthesis is then performed with S-triphenylmethyl O-methoxymorpholino-phosphinyl 3-mercaptopropan (1) ol. After normal deblocking this gives an oligonucleotide containing a tritylthiol group attached to the 5′-phosphate of an oligonucleotide via a 3-carbon spacer arm. The trityl group can be removed with AgNO₃ at pH 5 to give the free thiol. This compound is stable at pH 8 and reacts cleanly and rapidly with sulphydryl specific probes (eg fluorescent iodoacetates) at this pH value. This method can be used to prepare a wide variety of usefully labelled oligonucleotides and it is envisaged that fluorescent oligonucleotides will be useful in the study of protein nucleic acid interactions and to replace ³²P labelled hybridisation probes.     

New phosphoramidite derivatives for the preparation of oligonucleotides containing a hydrazide group in any specified position of the oligonucleotide chain

A new versatile method for the preparation of oligonucleotides containing hydrazide groups in any position of the oligonucleotide chain by standard phosphoramidite automated oligonucleotide synthesis is proposed. The method is based on the use of a series of new modified components for oligonucleotide synthesis. An original protecting group for the hydrazide group is proposed. The presence of the hydrazide group in the obtained oligonucleotides and its high reactivity were demonstrated by the reaction with 4-methoxybenzaldehyde in solution. Published in Russian in Izvestiya Akademii Nauk. Seriya Khimicheskaya, No. 11, pp. 2585–2595, November, 2005.     

Oligodeoxynucleotides Containing 2′‐Deoxy‐1‐methyladenosine and Dimroth Rearrangement

2′‐Deoxy‐1‐methyladenosine was incorporated into synthetic oligonucleotides by phosphoramidite chemistry. Chloroacetyl protecting group and controlled anhydrous deprotection conditions were used to avoid Dimroth rearrangement. Hybridization studies of intramolecular duplexes showed that introduction of a modified residue into the loop region of the oligonucleotide hairpin increases the melting temperature. It was shown that modified oligonucleotides may be easily transformed into oligonucleotides containing 2′‐deoxy‐N⁶‐methyladenosine.     

Thermolytic properties of 3-(2-pyridyl)-1-propyl and 2-[N-methyl-N-(2-pyridyl)]aminoethyl phosphate/thiophosphate protecting groups in solid-phase synthesis of oligodeoxyribonucleotides

Thermolytic groups may serve as alternatives to the conventional 2-cyanoethyl group for phosphate/thiophosphate protection in solid-phase oligonucleotide synthesis to prevent DNA alkylation by acrylonitrile generated under the basic conditions used for oligonucleotide deprotection. Additionally, thermolytic groups are attractive in the context of engineering a "heat-driven" process for the synthesis of oligonucleotides on diagnostic microarrays. In these regards, the potential application of pyridine derivatives as thermolytic phosphate/thiophosphate protecting groups has been investigated. Specifically, 2-pyridinepropanol and 2-[N-methyl-N-(2-pyridyl)]aminoethanol were incorporated into deoxyribonucleoside phosphoramidites 7a-d and 9, which were found as efficient as 2-cyanoethyl deoxyribonucleoside phosphoramidites in solid-phase oligonucleotide synthesis. Whereas the removal of 3-(2-pyridyl)-1-propyl phosphate/thiophosphate protecting groups from oligonucleotides is effected within 30 min upon heating at 55 degrees C in concentrated NH4OH or in an aqueous buffer at pH 7.0, cleavage of 2-[N-methyl-N-(2-pyridyl)]aminoethyl groups occurs spontaneously when their phosphate or phosphorothioate esters are formed during oligonucleotide synthesis. The deprotection of these groups follows a cyclodeesterification process generating the bicyclic salts 13 and 14 as side products. These salts do not alkylate or otherwise modify any DNA nucleobases and do not desulfurize a phosphorothioate diester model under conditions mimicking large-scale oligonucleotide deprotection.     

Highly efficient synthesis of peptide-oligonucleotide conjugates: chemoselective oxime and thiazolidine formation

A convergent strategy for the synthesis of peptide-oligonucleotide conjugates (POC) is presented. Chemoselective ligation of peptide to oligonucleotide was accomplished by oxime and thiazolidine formation. Oxime conjugation was performed by treating an oxyamine-containing peptide with an aldehyde-containing oligonucleotide or vice versa. Ligation by thiazolidine formation was achieved by coupling a peptide, acylated with a cysteine residue, to an oligonucleotide that was derivatised by an aldehyde function. For both approaches, the conjugates were obtained in good yield without the need for a protection strategy and under mild aqueous conditions. Moreover, the oxime ligation proved useful for directly conjugating duplex oligonucleotides. Combined with molecular biology tools, this methodology opens up new prospects for post-functionalisation of high-molecular-weight DNA structures.     

Generation of oligonucleotide conjugates via one-pot diselenide-selenoester ligation–deselenization/alkylation

A breadth of strategies are needed to efficiently modify oligonucleotides with peptides or lipids to capitalize on their therapeutic and diagnostic potential, including the modulation of in vivo chemical stability and for applications in cell-targeting and cell-permeability. The chemical linkages typically used in peptide oligonucleotide conjugates (POCs) have limitations in terms of stability and/or ease of synthesis. Herein, we report an efficient method for POC synthesis using a diselenide-selenoester ligation (DSL)-deselenization strategy that rapidly generates a stable amide linkage between the two biomolecules. This conjugation strategy is underpinned by a novel selenide phosphoramidite building block that can be incorporated into an oligonucleotide by solid-phase synthesis to generate diselenide dimer molecules. These can be rapidly ligated with peptide selenoesters and, following in situ deselenization, lead to the efficient generation of POCs. The diselenide within the oligonucleotide also serves as a flexible functionalisation handle that can be leveraged for fluorescent labelling, as well as for alkylation to generate micelles.

An efficient and versatile approach for the late-stage generation of oligonucleotide conjugates by diselenide-selenoester ligation (DSL)–deselenization/alkylation was developed.     

The 3-(N-tert-butylcarboxamido)-1-propyl group as an attractive phosphate/thiophosphate protecting group for solid-phase oligodeoxyribonucleotide synthesis

Among the various phosphate/thiophosphate protecting groups suitable for solid-phase oligonucleotide synthesis, the 3-(N-tert-butylcarboxamido)-1-propyl group is one of the most convenient, as it can be readily removed, as needed, under thermolytic conditions at neutral pH. The deprotection reaction proceeds rapidly (t(1/2) approximately 100 s) through an intramolecular cyclodeesterification reaction involving the amide function and the release of the phosphate/thiophosphate group as a 2-(tert-butylimino)tetrahydrofuran salt. Incorporation of the 3-(N-tert-butylcarboxamido)-1-propyl group into the deoxyribonucleoside phosphoramidites 1a-d is achieved using inexpensive raw materials. The coupling efficiency of 1a-d in the solid-phase synthesis of d(ATCCGTAGCTAAGGTCATGC) and its phosphorothioate analogue is comparable to that of commercial 2-cyanoethyl deoxyribonucleoside phosphoramidites. These oligonucleotides were phosphate/thiophosphate-deprotected within 30 min upon heating at 90 degrees C in Phosphate-Buffered Saline (PBS buffer, pH 7.2). Since no detectable nucleobase modification or significant phosphorothioate desulfurization occurs, the 3-(N-tert-butylcarboxamido)-1-propyl group represents an attractive alternative to the 2-cyanoethyl group toward the large-scale preparation of therapeutic oligonucleotides.     

Protein assembly by orthogonal chemical ligation methods

Chemical synthesis harbors the potential to provide ready access to natural proteins as well as to create nonnatural ones. The Staudinger ligation of a peptide containing a C-terminal phosphinothioester with a peptide containing an N-terminal azide gives an amide with no residual atoms. This method for amide bond formation is orthogonal and complementary to other ligation methods. Herein, we describe the first use of the Staudinger ligation to couple peptides on a solid support. The fragment thus produced is used to assemble functional ribonuclease A via native chemical ligation. The synthesis of a protein by this route expands the versatility of chemical approaches to protein production.     

Template-free segmental synthesis of oligonucleotides containing nonnative linkages

Protected oligonucleotides containing 3'-alkyl carboxylic acids or 3'-alkylamines were obtained from photolabile solid-phase synthesis supports (1 and 4). Protected oligonucleotides containing 5'-alkylamines and 3'-hydroxyl groups were obtained using a photolabile solid-phase synthesis support (2) and a commercially available phosphoramidite reagent (3). Depending upon the source of alkylamine-containing oligonucleotide, the segments were coupled under mild conditions to form products containing either 5'-3' or 3'-3' linkages in good yield and high purity. Oligonucleotides as long as 40 nucleotides were prepared, and coupling yields of protected biopolymer segments were independent of length over the range examined. This method is particularly well suited for the convergent synthesis of oligonucleotides containing nonnative linkages and should be useful for the rapid assembly of modified biopolymers that are useful in biochemical studies.     

Alpha-keto amide peptides: a synthetic strategy to resin-bound peptide isosteres for protease inhibitor screening on solid support

A synthetic strategy for the formation of resin-bound internal alpha-keto amide peptides suitable for protease inhibitor screening on solid support is presented. This general approach is based on the incorporation of alpha-keto amide building blocks during solid-phase peptide synthesis (SPPS). Such dipeptidyl building blocks were accessible using the acylcyanophosphorane methodology. The acid-labile alpha-keto carbonyl functionality was protected as a 1,3-dithiolane derivative. This protective group is fully compatible with standard SPPS reaction conditions and can be efficiently removed with N-bromosuccinimide in 10% aqueous acetone. The alpha-keto amide peptides were assembled on SPOCC-1500 resin and were characterized with high-resolution magic angle spinning (HR-MAS) NMR on bead. The methodology was evaluated and tested with a variety of building blocks containing natural and nonnatural amino acid moieties.     

Duplex‐forming Oligonucleotide of Triazole‐linked RNA

An oligonucleotide of triazole‐linked RNA (^TLRNA) was synthesized by performing consecutive copper‐catalyzed azide‐alkyne cycloaddition reactions for elongation. The reaction conditions that had been optimized for the synthesis of 3‐mer ^TLRNA were found to be inappropriate for longer oligonucleotides, and the conditions were reoptimized for the solid‐phase synthesis of an 11‐mer ^TLRNA oligonucleotide. Duplex formation of the 11‐mer ^TLRNA oligonucleotide was examined with the complementary oligonucleotide of natural RNA to reveal the effects of the 2′‐OH groups on the duplex stability.     

Nalpha-2-mercaptobenzylamine-assisted chemical ligation

[reaction: see text] The selective formation of an amide bond in the presence of unprotected functional groups is a challenging problem of peptide chemistry. A 2-mercaptobenzyl group tethered at the N-terminus of model peptides was observed to facilitate amide bond formation when a peptide thioester was added under mild aqueous conditions.     

New strategies for cyclization and bicyclization of oligonucleotides by click chemistry assisted by microwaves

The synthesis of cyclic, branched, and bicyclic oligonucleotides was performed by copper-catalyzed azide-alkyne cycloaddition assisted by microwaves in solution and on solid support. For that purpose, new phosphoramidite building blocks and new solid supports were designed to introduce alkyne and bromo functions into the same oligonucleotide by solid-phase synthesis on a DNA synthesizer. The bromine atom was then substituted by sodium azide to yield azide oligonucleotides. Cyclizations were found to be more efficient in solution than on solid support. This method allowed the efficient preparation of cyclic (6- to 20-mers), branched (with one or two dangling sequences), and bicyclic (2 x 10-mers) oligonucleotides.