共查询到20条相似文献,搜索用时 843 毫秒
1.
The first and second substitution reactions binding of the anticancer drug trans‐[Pt((CH3)2C?NOH)((CH3)2CHNH2)Cl2] to purine bases were studied computationally using a combination of density functional theory and isoelectric focusing polarized continuum model approach. Our calculations demonstrate that the trans monoaqua and diaqua reactant complexes (RCs) can generate either trans‐ or cis‐monoadducts via identical or very similar trans trigonal‐bipyramidal transition‐state structures. Furthermore, these monoadducts can subsequently close by coordination to the adjacent purine bases to form 1,2‐intrastrand Pt‐DNA adducts and eventually distort DNA in the same way as cisplatin. Thus, it is likely that the transplatin analogues have the same mechanism of anticancer activity as cisplatin. For the first substitutions, the activation free energies of monoaqua complexes are always lower than that of diaqua complexes. The lowest activation energy for monoaqua substitutions is 16.2 kcal/mol for guanine and 16.5 kcal/mol for adenine, whereas the lowest activation energy for diaqua substitutions is 17.1 kcal/mol for guanine and 25.9 kcal/mol for adenine. For the second substitutions, the lowest activation energy from trans‐monoadduct to trans‐diadduct is 19.1 kcal/mol for GG adduct and 20.7 kcal/mol for GA adduct, whereas the lowest activation energy from cis‐monoadduct to cis‐diadduct is 18.9 kcal/mol for GG adduct and 18.5 kcal/mol for GA adduct. In addition, the first and second substitutions prefer guanine over adenine, which is explained by the remarkable larger complexation energy for the initial RC in combination with lower activation energy for the guanine substitution. Overall, the hydrogen‐bonds play an important role in stabilizing these species of the first and second substitutions. © 2010 Wiley Periodicals, Inc. Int J Quantum Chem, 2011 相似文献
2.
The monofunctional substitution reactions between trans-[PtCl(H2O)(NH3)(pip)]+,trans-[Pt(H2O)2(NH3)(pip)]2+,trans-[PtCl(H2O)(pip)2]+,trans-[Pt(H2O)2(pip)2]2+ (pip = piperidine) and adenine/guanine nucleotides are explored by using B3LYP hybrid functional and IEF-PCM salvation models. For the trans-[Pt(H2O)2(NH3)(pip)]2+ and trans-[PtCl(H2O)(NH3)(pip)]+ complexes,the computed barrier heights in aqueous solution are 13.5/13.5 and 11.6/11.6 kcal/mol from trans-Pt-chloroaqua complex to trans/cis-monoadduct for adenine and guanine,and the corresponding values are 20.7/20.7 and 18.8/18.8 kcal/mol from trans-Pt-diaqua complex to trans/cis-monoadduct for adenine and guanine,respectively. For trans-[PtCl(H2O)(pip)2]+ and trans-[Pt(H2O)2(pip)2]2+,the corresponding values are 21.5/21.3 and 19.4/19.4 kcal/mol,and 26.0/26.0 and 20.7/20.8 kal/mol for adenine and guanine,respectively. Our calculations demonstrate that the barrier heights of chloroaqua are lower than the corresponding values of diaqua for adenine and guanine. In addition,the free energies of activation for guanine in aqueous solution are all smaller than that for adenine,which predicts a preference of 1.9 kcal/mol when trans-[PtCl(H2O)(NH3)(pip)]+ and trans-[Pt(H2O)2(NH3)(pip)]2+ are the active agents and ~1.9 and ~ 5.3 kcal/mol when trans-[PtCl(H2O)(pip)2]+ and trans-[Pt(H2O)2(pip)2]2+ are the active agents,respectively. For the reaction of trans-Pt-chloroaqua (or diaqua) to cis-monoadduct,we obtain the same transition-state structure as from the reaction of trans-Pt-chloroaqua (or diaqua) to trans-monoadduct,which seems that the trans-Pt-chloroaqua (or diaqua) complex can generate trans-or cis-monoadduct via the same transition-state. 相似文献
3.
The thermodynamics and kinetics for the monofunctional binding of the antitumor drug cisplatin, cis-diamminedichloroplatinum(II), to a purine base site of DNA were studied computationally using guanine and adenine as model reactants. A dominating preference for initial attack at the N7-position of guanine is established experimentally, which is a crucial first step for the formation of a 1,2-intrastrand cross-link of adjacent guanine bases that leads to bending and unwinding of DNA. These structural distortions are proposed ultimately to be responsible for the anticancer activity of cisplatin. Utilizing density functional theory in combination with a continuum solvation model, we developed a concept for the initial Pt-N7 bond formation to atomic detail. In good agreement with experiments that suggested DeltaG++ = approximately 23 kcal/mol for the monofunctional platination of guanine, our model gives DeltaG++ = 24.6 kcal/mol for guanine, whereas 30.2 kcal/mol is computed when adenine is used. This result predicts that guanine is 3-4 orders of magnitude more reactive toward cisplatin than adenine. A detailed energy decomposition and molecular orbital analysis was conducted to explain the different barrier heights. Two effects are equally important to give the preference for guanine over adenine: First, the transition state is characterized by a strong hydrogen bond between the ammine-hydrogen of cisplatin and the O=C6 moiety of guanine in addition to a stronger electrostatic interaction between the two reacting fragments. When adenine binds, only a weak hydrogen bond forms between the chloride ligand of cisplatin and the H(2)N-C6 group of adenine. Second, a significantly stronger molecular orbital interaction is identified for guanine compared to adenine. A detailed MO analysis is presented to provide an intuitive view into the different electronic features governing the character of the Pt-N7 bond in platinated purine bases. 相似文献
4.
Frańska M Frański R Schroeder G Springer A Beck S Linscheid M 《Rapid communications in mass spectrometry : RCM》2005,19(8):970-974
By mixing cisplatin (cis-diamminedichloroplatinum(II)) with purine base the following ions have been obtained under electrospray ionization conditions: [A+Pt(NH3)2 Cl]+, [A+PtNH3Cl]+, [G+Pt(NH3)2 Cl]+ and [G+PtNH3)Cl]+. Their collision-induced dissociation led to the loss of NH3 and HCl and formation of the protonated base. The last process is strongly favoured for adenine over guanine. It confirms that, analogously as for DNA, formation of the guanine-cisplatin complex is favoured over that of the adenine complex and, as a consequence, it suggests that the mass spectrometric study of nucleic base complexes with platinum may provide some information on the interactions of DNA with other platinum drugs. The loss of NH3 accompanied by that of CO from the guanine ring has experimentally confirmed the presence of a strong hydrogen bond between the NH3 molecule and the O=C6 moiety of guanine found by theoretical calculations. 相似文献
5.
The bifunctional binding of the anticancer drug cisplatin to two adjacent nucleobases in DNA is modeled using density functional theory. Previous experimental studies revealed that cisplatin binding to adjacent guanine and adenine is sensitive to nucleobase sequence. Whereas AG 1,2-intrastrand cross-links are commonly observed, the analogous GA adducts are not known. This study focuses on understanding this directional preference by constructing a full reaction profile using quantum chemical simulation methods. Monofunctional and bifunctional cisplatin adducts were generated, and the transition states that connect them were located for the dinucleotides d(pApG) and d(pGpA), assuming that initial platination takes place at the guanine site. Our computer simulations reveal a significant kinetic preference for formation of the AG over the GA adduct. The activation free energies of approximately 23 kcal/mol for AG and approximately 32 kcal/mol for GA suggest that bifunctional closure is approximately 6 orders of magnitude faster for AG than for GA. A strong hydrogen bond between one of the ammine ligands of cisplatin and the 5' phosphate group of the DNA backbone is responsible for the stabilization of the transition state that affords the AG adduct. This interaction is absent in the transition state that leads to the GA adduct because the right-handed helix of the DNA backbone places the phosphate out of reach for the ammine ligand. We found only an insignificant thermodynamic difference between AG and GA adducts and conclude that the preference of AG over GA binding is largely under kinetic control. The puckering of the deoxyribose ring plays an important role in determining the energetics of the bifunctional platination products. Whereas the 3'-nucleoside remains in the native C2'-endo/C3'-exo form of B-DNA, the deoxyribose of the 5'-nucleoside always adopts the C2'-exo/C3'-endo puckering in our simulations. A detailed analysis of the energies and structures of the bifunctional adducts revealed that the observed sugar puckering patterns are necessary for platinum to bind in a relaxed coordination geometry. 相似文献
6.
The B3LYP/6-31G(d) level of theory was used for the optimization of [Pt(NH(3))(4)](2+), [Pt(NH(3))(3)(H(2)O)](2+), cis-[Pt(NH(3))(2)(H(2)O)(2)](2+), and related platinum complexes. In addition, water or ammonium ligands were replaced by DNA purine bases so that finally cis-diammineplatinum with two bases (Pt-bridged complexes) is obtained. Single point calculations using the MP2/6-31+G(d) method were performed on the obtained reference geometries and were utilized for estimating bond dissociation energies (BDEs) and stabilization energies, and for electron density analyses. After reoptimization, IR spectra were determined from HF second derivatives. It was found that replacement of both water and ammonium by the DNA base is an exothermic process (20-50 kcal/mol depending on the ligands present in the complex). Asymmetric structures with one interbase H-bond were obtained for cis-diammine[bond](N(7),N(7)'-diadenine)[bond]platinum and mixed cis-diammine[bond](N(7)-adenine)[bond](N(7)-guanine)[bond]platinum complexes. In the case of the diguanine Pt-bridge, a symmetrical complex with two ammonium...O(6) H-bonds was found. The higher stabilization energy of the di-guanine complex is linked to a larger component of the Coulombic interaction. However, the BDE of Pt[bond]N(7)(G) is smaller in this complex than the BDE of Pt[bond]N(7)(G) from the mixed Pt[bond]AG complex. Also, steric repulsion of the ligands is about 10 kcal/mol smaller for the asymmetrical Pt[bond]AA and Pt[bond]AG bridges. The influence of the trans effect on DBE can be clearly seen. Adenine exhibits the largest trans effect, followed by guanine, ammonium, and water. The strength of the H-bond can be determined from the IR spectra. The strongest H-bond is the interbase H-bridge between adenine and guanine in the mixed Pt[bond]AG complex; otherwise, the H-bonds of adenine complexes are weaker than in guanine complexes. BDE can be traced in the guanine-containing complexes. The nature of the covalent bonding is analyzed in terms of partial charges and MO. A general explanation of the lower affinity of transition metals to oxygen than nitrogen can be partially seen in the less favorable geometrical orientation of lone electron pairs of oxygen. 相似文献
7.
Schröder G Kozelka J Sabat M Fouchet MH Beyerle-Pfnür R Lippert B 《Inorganic chemistry》1996,35(6):1647-1652
A model compound of the second most abundant DNA adduct of the antitumor agent cisplatin has been synthesized and structurally and spectroscopically characterized and its conformational behavior examined: cis-[(NH(3))(2)Pt(9-MeA-N7)(9-EtGH-N7)](NO(3))(2).2H(2)O (9-MeA = 9-methyladenine; 9-EtGH = 9-ethylguanine) crystallizes in the monoclinic system, space group P2(1)/n (No. 14) with a = 7.931(2), b = 11.035(3), c = 26.757(6) ?, beta = 94.94(2) degrees, and Z = 4. The two purine bases adopt a head-to-head orientation, with NH(2) of 9-MeA and CO of 9-EtGH being at the same side of the Pt coordination plane. A theoretical conformational analysis of the complex cis-[(NH(3))(2)Pt(Ade)(Gua)](2+) (Ade = adenine; Gua = guanine) based on molecular mechanics calculations of the nonbonded energy has revealed four minimum-energy zones similar to those derived previously for cis-[(NH(3))(2)Pt(Gua)(2)](2+) (Kozelka; et al. Eur. J. Biochem. 1992, 205, 895). This conformational analysis has allowed, together with the calculation of chemical shifts due to ring effects, the attribution of the two conformers observed for cis-[(NH(3))(2)Pt{d(ApG)}](+) by Dijt et al. (Eur. J. Biochem. 1989, 179, 344) to the two head-to-head conformational zones. The orientation of the two nucleobases in the crystal structure of cis-[(NH(3))(2)Pt(9-MeA)(9-EtGH)](2+) corresponds, according to our analysis, roughly to that preferentially assumed by the minor rotamer of cis-[(NH(3))(2)Pt{d(ApG)}](+). 相似文献
8.
The alkylation reaction of 9-methyladenine and 9-methylguanine (as prototype substrates of deoxy-adenosine and -guanosine), by the parent o-quinone methide (o-QM), has been investigated in the gas phase and in aqueous solution, using density functional theory at the B3LYP/6-311+G(d,p) level. The effect of the medium on the reactivity, and on the stability of the resulting adducts, has been investigated by using the C-PCM solvation model to assess which adduct arises from the kinetically favorable path, or from an equilibrating process. The calculations indicate that the most nucleophilic site of the methyl-substituted nucleobases in the gas phase is the guanine oxygen atom (O(6)) (DeltaG()(gas) = 5.6 kcal mol(-)(1)), followed by the adenine N1 (DeltaG)(gas) = 10.3 kcal mol(-)(1)), while other centers exhibit a substantially lower nucleophilicity. The bulk effect of water as a solvent is the dramatic reduction of the nucleophilicity of both 9-methyladenine N1 (DeltaG)(solv) = 14.5 kcal mol(-)(1)) and 9-methylguanine O(6) (DeltaG)(solv) = 17.0 kcal mol(-)(1)). As a result there is a reversal of the nucleophilicity order of the purine bases. While O(6) and N7 nucleophilic centers of 9-methylguanine compete almost on the same footing, the reactivity gap between N1 and N7 of 9-methyladenine in solution is highly reduced. Regarding product stability, calculations predict that only two of the adducts of o-QM with 9-methyladenine, those at NH(2) and N1 positions, are lower in energy than reactants, both in the gas phase and in water. However, the adduct at N1 can easily dissociate in water. The adducts arising from the covalent modification of 9-methylguanine are largely more stable than reactants in the gas phase, but their stability is markedly reduced in water. In particular, the oxygen alkylation adduct becomes slightly unstable in water (DeltaG(solv) = +1.4 kcal mol(-)(1)), and the N7 alkylation product remains only moderately more stable than free reactants (DeltaG(solv) = -2.8 kcal mol(-)(1)). Our data show that site alkylations at the adenine N1 and the guanine O(6) and N7 in water are the result of kinetically controlled processes and that the selective modification of the exo-amino groups of guanine N2 and adenine N6 are generated by thermodynamic equilibrations. The ability of o-QM to form several metastable adducts with purine nucleobases (at guanine N7 and O(2), and adenine N1) in water suggests that the above adducts may act as o-QM carriers. 相似文献
9.
Jirí Kozelka Roger Savinelli Gaston Berthier Jean-Pierre Flament Richard Lavery 《Journal of computational chemistry》1993,14(1):45-53
The antitumor drug cis-diamminedichloroplatinum(II) (cisplatin) binds preferentially to GpG and ApG sequences of DNA, forming N7,N7 intrastrand chelates. Molecular modeling of the intrastrand adducts have been handicapped, so far, by the lack of force-field data describing the Pt–guanine and Pt–adenine binding. We used ab initio calculations with relativistic pseudopotentials to evaluate three important parameters for the platinum–adenine model complex [Pt(NH3)3(Ade)]2+: (1) the force constant for the Pt? N7 bond bending out of the adenine plane; (2) the energy profile for the torsion about Pt? N7; (3) a set of fractional atomic charges that reproduce the ab initio potential for a number of space points placed around the adduct. A population analysis and comparative study on the tetrammine complex [Pt(NH3)4]2+ have shown that for platinum adenine is a better σ-donor than NH3, but its capacity as a π-acceptor is weak. © 1993 John Wiley & Sons, Inc. 相似文献
10.
REN Xiu-Li ZHOU Li-Xin 《结构化学》2009,28(12):1579-1588
The mechanisms of action on monofunctional guanine adducts of analogues of transplatin with aliphatic amine ligands,such as trans-[Pt(Am)(isopropylamine)(G)(H2O)] where Am represents dimethylamine,propylamine or isopropylamine and their cis isomers reacting with sulfur- and nitrogen-containing amino acid residues,were explored. Histidine and lysine residues are chosen as the model ligands of nitrogen-containing amino acid residues of proteins; meanwhile,methionine and cysteine residues are chosen as the model ligands of sulfur-containing amino acid residues of proteins. A dominating preference for sulfur-containing ligand over nitrogen-containing ligand is established. The calculated smallest activation barrier for sulfur-containing ligand is 9.9,and 21.1 kcal/mol for nitrogen-containing ligand in aqueous solution,and both of them have trans configurations. The difference in activation energy is 11.2 kcal/mol,indicating the platination of sulfur-containing amino acid residues is faster by seven to eight orders of magnitude than that of nitrogen-containing amino acid residues. 相似文献
11.
The thermochemistry of the formation of Lewis base adducts of BH(3) in tetrahydrofuran (THF) solution and the gas phase and the kinetics of substitution on ammonia borane by triethylamine are reported. The dative bond energy of Lewis adducts were predicted using density functional theory at the B3LYP/DZVP2 and B3LYP/6-311+G** levels and correlated ab initio molecular orbital theories, including MP2, G3(MP2), and G3(MP2)B3LYP, and compared with available experimental data and accurate CCSD(T)/CBS theory results. The analysis showed that the G3 methods using either the MP2 or the B3LYP geometries reproduce the benchmark results usually to within ~1 kcal/mol. Energies calculated at the MP2/aug-cc-pVTZ level for geometries optimized at the B3LYP/DZVP2 or B3LYP/6-311+G** levels give dative bond energies 2-4 kcal/mol larger than benchmark values. The enthalpies for forming adducts in THF were determined by calorimetry and compared with the calculated energies for the gas phase reaction: THFBH(3) + L → LBH(3) + THF. The formation of NH(3)BH(3) in THF was observed to yield significantly more heat than gas phase dative bond energies predict, consistent with strong solvation of NH(3)BH(3). Substitution of NEt(3) on NH(3)BH(3) is an equilibrium process in THF solution (K ≈ 0.2 at 25 °C). The reaction obeys a reversible bimolecular kinetic rate law with the Arrhenius parameters: log A = 14.7 ± 1.1 and E(a) = 28.1 ± 1.5 kcal/mol. Simulation of the mechanism using the SM8 continuum solvation model shows the reaction most likely proceeds primarily by a classical S(N)2 mechanism. 相似文献
12.
McGowan G Parsons S Sadler PJ 《Chemistry (Weinheim an der Bergstrasse, Germany)》2005,11(15):4396-4404
cis-[PtCl2(NH3)(2-picoline)] (AMD473) is a sterically-hindered anticancer complex with a profile of chemical and biological activity that differs significantly from that of cisplatin. Adducts of AMD473 with neutral 9-ethylguanine (9-EtGH) and anionic (N1-deprotonated) 9-ethylguanine (9-EtG) as perchlorate and nitrate salts, and also a nitrate salt of the trans isomer (AMD443), were prepared and their structures determined by X-ray crystallography: cis-[Pt(NH3)(2-pic)(9-EtGH)2](ClO4)2 (1).2H(2)OMe(2)CO, cis-[Pt(NH3)(2-pic)(9-EtGH)2](NO3)2 (2).2H2O, cis-[Pt(NH3)(2-pic)(9-EtGH)(9-EtG)]NO3 (3),3.5 H2O, trans-[Pt(NH3)(2-pic)(9-EtGH)(9-EtG)]NO3 (4).8H2O. In all cases, platinum coordination is through N7 of neutral (1, 2) and anionic (3, 4) guanine. In each complex, the guanine bases are arranged in the head-to-tail conformation. In complex 1, there is an infinite array of six-molecule cycles, based on both hydrogen bonding and pi-pi stacking of the 2-picoline and guanine rings. Platinum(II) coordinated at N7 acidifies the N1 proton of neutral 9-ethylguanine (pKa = 9.57) to give pKa1 = 8.40 and pKa2 = 8.75 for complex 2, and pKa1 = 7.77 and pKa2 = 9.00 for complex 4. In complexes 3 and 4, three intermolecular hydrogen bonds are formed between neutral and deprotonated guanine ligands involving O6, N1 and N2 sites. Unusually, both of the platinated guanine bases of complexes 3 and 4 participate in this triple G triple bond G hydrogen bonding. This is the first report of X-ray crystal structures of nucleobase adducts of the promising anticancer drug AMD473. 相似文献
13.
Zdenk Futera Julia Klenko Judit E. poner Jií poner Jaroslav V. Burda 《Journal of computational chemistry》2009,30(12):1758-1770
Piano stool ruthenium complexes of the composition [Ru(II)(η6‐arene)(en)Cl]+/2+ (en = ethylenediamine) represent an emerging class of cisplatin‐analogue anticancer drug candidates. In this study, we use computational quantum chemistry to characterize the structure, stability and reactivity of these compounds. All these structures were optimized at DFT(B3LYP)/6‐31G(d) level and their single point properties were determined by the MP2/6‐31++G(2df,2pd) method. Thermodynamic parameters and rate constants were determined for the aquation process, as a replacement of the initial chloro ligand by water and subsequent exchange reaction of aqua ligand by nucleobases. The computations were carried out at several levels of DFT and ab initio theories (B3LYP, MP2 and CCSD) utilizing a range of bases sets (from 6‐31G(d) to aug‐cc‐pVQZ). Excellent agreement with experimental results for aquation process was obtained at the CCSD level and reasonable match was achieved also with the B3LYP/6‐31++G(2df,2pd) method. This level was used also for nucleobase‐water exchange reaction where a smaller rate constant for guanine exchange was found in comparison with adenine. Although adenine follows a simple replacement mechanism, guanine complex passes by a two‐step mechanism. At first, Ru‐O6(G) adduct is formed, which is transformed through a chelate TS2 to the Ru‐N7(G) final complex. In case of guanine, the exchange reaction is more favorable thermodynamically (releasing in total by about 8 kcal/mol) but according to our results, the rate constant for guanine substitution is slightly smaller than the analogous constant in adenine case when reaction course from local minimum is considered. © 2008 Wiley Periodicals, Inc. J Comput Chem, 2009 相似文献
14.
The bond dissociation energies for a series of silyl peroxides have been calculated at the G2 and CBS-Q levels of theory. A comparison is made with the O-O BDE of the corresponding dialkyl peroxides, and the effect of the O-O bond strength on the activation barrier for oxygen atom transfer is discussed. The O-O bond dissociation enthalpies (DeltaH(298)) for bis (trimethylsilyl) peroxide (1) and trimethylsilyl hydroperoxide (2) are 54.8 and 53.1 kcal/mol, respectively at the G2 (MP2) and CBS-Q levels of theory. The O-O bond dissociation energies computed at G2 and G2(MP2) levels for bis(tert-butyl) peroxide and tert-butyl hydroperoxide are 45.2 and 48.3 kcal/mol, respectively. The barrier height for 1,2-methyl migration from silicon to oxygen in trimethylsilyl hydroperoxide is 47.9 kcal/mol (MP4//MP2/6-31G). The activation energy for the oxidation of trimethylamine to its N-oxide by bis(trimethylsilyl) peroxide is 28.2 kcal/mol (B3LYP/6-311+G(3df,2p)// B3LYP/6-31G(d)). 1,2-Silicon bridging in the transition state for oxygen atom transfer to a nucleophilic amine results in a significant reduction in the barrier height. The barrier for the epoxidation of E-2-butene with bis(dimethyl(trifluoromethyl))silyl peroxide is 25.8 kcal/mol; a reduction of 7.5 kcal/mol relative to epoxidation with 1. The activation energy calculated for the epoxidation of E-2-butene with F(3)SiOOSiF(3) is reduced to only 2.2 kcal/mol reflecting the inductive effect of the electronegative fluorine atoms. 相似文献
15.
The existence of DNA adducts bring the danger of carcinogenesis because of mispairing with normal DNA bases. 1,N6-ethenoadenine adducts (epsilonA) and 1,N6-ethanoadenine adducts (EA) have been considered as DNA adducts to study the interaction with thymine, as DNA base. Several different stable conformers for each type of adenine adduct with thymine, [epsilonA(1)-T(I), epsilonA(2)-T(I), epsilonA(3)-T(I) and EA(1)-T(I), EA(2)-T(I), EA(3)-T(I)] and [epsilonA(1)-T(II), epsilonA(2)-T(II), epsilonA(3)-T(II) and EA(1)-T(II), EA(2)-T(II), EA(3)-T(II)], have been considered with regard to their interactions. The differences in their geometrical structures, energetic properties, and hydrogen-bonding strengths have also been compared with Watson-Crick adenine-thymine base pair (A-T). Single-point energy calculations at MP2/6-311++G** levels on B3LYP/6-31+G* optimized geometries have also been carried out to better estimate the hydrogen-bonding strengths. The basis set superposition error corrected hydrogen-bonding strength sequence at MP2/6-311++G**//B3LYP/6-31+G* for the most stable complexes is found to be EA(2)-T(I) (15.30 kcal/mol) > EA(1)-T(II) (14.98 kcal/mol) > EA(3)-T(II) (14.68 kcal/mol) > epsilonA(2)-T(I) (14.54 kcal/mol) > epsilonA(3)-T(II) (14.22 kcal/mol) > epsilonA(3)-T(II) (13.64 kcal/mol) > A-T (13.62 kcal/mol). The calculated reaction enthalpy value for epsilonA(2)-T(I) is 10.05 kcal/mol, which is the highest among the etheno adduct-thymine complexes and about 1.55 kcal/mol more than those obtained for Watson-Crick A-T base pair and the reaction enthalpy value for EA(1)- T(II) is 10.22 kcal/mol, which is highest among the ethano addcut-thymine complexes and about 1.72 kcal/mol more than those obtained for Watson-Crick A-T base pair. The aim of this research is to provide fundamental understanding of adenine adduct and thymine interaction at the molecular level and to aid in future experimental studies toward finding the possible cause of DNA damage. 相似文献
16.
The hydrolyzed Ru(η 6 -C6H5(CH2)2OH)Cl2(DAPTA) (DAPTA = 3,7-diacetyl-1,3,7-triaza-5-phosphabicyclo[3.3.1]nonane) binding to guanine(G), adenine (A), cytosine(C), cysteine (Cys), and histidine (His) residues were explored using the B3LYP hybrid functional and IEF-PCM solvation models. The computed activation barriers for the reactions of diaqua complex were lower than those of chloroaqua complex except for binding to cytosine. For the chloroaqua complex, the activation free energy was lowest when binding to cytosine (10.5 kcal/mol). Whereas, the substitution reaction of diaqua complex binding to cysteine showed the lowest activation free energy with 10.1 kcal/mol, closely followed by histidine (15.8 kcal/mol), adenine (20.1 kcal/mol), cytosine (20.7 kcal/mol), and guanine (24.4 kcal/mol) by turns. It could be deduced that the completely hydrolyzed Ru(η 6 -C6H5(CH2)2OH)Cl2(DAPTA) compounds might preferentially bind to amino acids residues in vivo. In addition, to simulate the protein and DNA environment in vivo, a detailed investigation of the activation free energies for the substitution reactions in dependence of the dielectric constant ε (4, 24, and 78.39) was systematically performed as well. The calculated results demonstrated that the environmental effect had a little impact on these substitution reactions. 相似文献
17.
Reactions of cis-[Rh(2)(DTolF)(2)(NCCH(3))(6)](BF(4))(2) with the dinucleotides d(GpA) and d(ApG) proceed to form [Rh(2)(DTolF)(2){d(GpA)}] and [Rh(2)(DTolF)(2){d(ApG)}], respectively, with bridging purine bases spanning the Rh-Rh unit in the equatorial positions. Both dirhodium adducts exhibit head-to-head (HH) arrangement of the bases, as indicated by the presence of H8/H8 NOE cross-peaks in the 2D ROESY NMR spectra. The guanine bases bind to the dirhodium core at positions N7 and O6, a conclusion that is supported by the absence of N7 protonation at low pH values and the notable increase in the acidity of the guanine N1H sites (pK(a) approximately 7.4 in 4:1 CD(3)CN/D(2)O), inferred from the pH-dependence titrations of the guanine H8 proton resonances. In both dirhodium adducts, the adenine bases coordinate to the metal atoms through N6 and N7, which induces stabilization of the rare imino tautomer of the bases with a concomitant substantial decrease in the basicity of the N1H adenine sites (pK(a) approximately 7.0-7.1 in 4:1 CD(3)CN/D(2)O), as compared to the imino form of free adenosine. The presence of the adenine bases in the rare imino form is further corroborated by the observation of DQF-COSY H2/N1H and ROE N1H/N6H cross-peaks in the 2D NMR spectra of [Rh(2)(DTolF)(2){d(GpA)}] and [Rh(2)(DTolF)(2){d(ApG)}] in CD(3)CN at -38 degrees C. The 2D NMR spectroscopic data and the molecular modeling results suggest the presence of right-handed variants, HH1R, in solution for both adducts (HH1R refers to the relative base canting and the direction of propagation of the phosphodiester backbone with respect to the 5' base). Complete characterization of [Rh(2)(DTolF)(2){d(GpA)}] and [Rh(2)(DTolF)(2){d(ApG)}] by 2D NMR spectroscopy and molecular modeling supports anti-orientation of the sugar residues for both adducts about the glycosyl bonds as well as N- and S-type conformations for the 5'- and 3'-deoxyribose residues, respectively. 相似文献
18.
The formation of adducts between cis-[Pt(NH(3))(2)Cl(2)], Zn(II), and Mn(II) and double-stranded oligodeoxynucleotides was studied by 1D and 2D (1)H, (31)P, and (15)N NMR spectroscopy. For labile adducts involving Zn(II) and Mn(II), both (1)H chemical shifts (Zn(II)) and (1)H line-broadening effects (Mn(II)) showed that in the hexamer [d(GGCGCC)](2) I, the terminal G(1)-N7 is the exclusive binding site, while for the dodecamer [d(GGTACCGGTACC)](2) II, which contains both a terminal and internal GG pair, the preference for metal binding is the internal guanine G(7). Zn(II) binding to II was confirmed by natural-abundance 2D [(1)H,(15)N] HMBC NMR spectroscopy, which unambiguously showed that G(7)-N7 is the preferred binding site. The long duplex [d(GGTATATATACCGGTATATATACC)](2) III was expected to have a more pronounced accumulation of electrostatic potential towards the central part of the sequence (vs the terminal part) than does II. However, the Zn(II) titration of III showed no increase in coordination with the internal Gs (vs the terminal Gs), compared with what was observed for II. The reaction between the nonlabile metal complex cis-[PtCl(2)((15)NH(3))(2)] (cisplatin) and II showed a slight preference for the internal GG pair over the terminal GG pair. However, when the diaqua form of cisplatin cis-[Pt((15)NH(3))(2)(H(2)O)(2)] was reacted with II a more pronounced binding preference for the internal GG pair was observed. 相似文献
19.
Choi S Vastag L Larrabee YC Personick ML Schaberg KB Fowler BJ Sandwick RK Rawji G 《Inorganic chemistry》2008,47(4):1352-1360
Guanosine derivatives with a nucleophilic group at the 5' position (G-5') are oxidized by the Pt (IV) complex Pt( d, l)(1,2-(NH 2) 2C 6H 10)Cl 4 ([Pt (IV)(dach)Cl 4]). The overall redox reaction is autocatalytic, consisting of the Pt (II)-catalyzed Pt (IV) substitution and two-electron transfer between Pt (IV) and the bound G-5'. In this paper, we extend the study to improve understanding of the redox reaction, particularly the substitution step. The [Pt (II)(NH 3) 2(CBDCA-O,O')] (CBDCA = cyclobutane-1,1-dicarboxylate) complex effectively accelerates the reactions of [Pt (IV)(dach)Cl 4] with 5'-dGMP and with cGMP, indicating that the Pt (II) complex does not need to be a Pt (IV) analogue to accelerate the substitution. Liquid chromatography/mass spectroscopy (LC/MS) analysis showed that the [Pt (IV)(dach)Cl 4]/[Pt (II)(NH 3) 2(CBDCA-O,O')]/cGMP reaction mixture contained two Pt (IV)cGMP adducts, [Pt (IV)(NH 3) 2(cGMP)(Cl)(CBDCA-O,O')] and [Pt (IV)(dach)(cGMP)Cl 3]. The LC/MS studies also indicated that the trans, cis-[Pt (IV)(dach)( (37)Cl) 2( (35)Cl) 2]/[Pt (II)(en)( (35)Cl) 2]/9-EtG mixture contained two Pt (IV)-9-EtG adducts, [Pt (IV)(en)(9-EtG)( (37)Cl)( (35)Cl) 2] and [Pt (IV)(dach)(9-EtG)( (37)Cl)( (35)Cl) 2]. These Pt (IV)G products are predicted by the Basolo-Pearson (BP) Pt (II)-catalyzed Pt (IV)-substitution scheme. The substitution can be envisioned as an oxidative addition reaction of the planar Pt (II) complex where the entering ligand G and the chloro ligand from the axial position of the Pt (IV) complex are added to Pt (II) in the axial positions. From the point of view of reactant Pt (IV), an axial chloro ligand is thought to be substituted by the entering ligand G. The Pt (IV) complexes without halo axial ligands such as trans, cis-[Pt(en)(OH) 2Cl 2], trans, cis-[Pt(en)(OCOCF 3) 2Cl 2], and cis, trans, cis-[Pt(NH 3)(C 6H 11NH 2)(OCOCH 3) 2Cl 2] ([Pt (IV)(a,cha)(OCOCH 3) 2Cl 2], satraplatin) did not react with 5'-dGMP. The bromo complex, [Pt (IV)(en)Br 4], showed a significantly faster substitution rate than the chloro complexes, [Pt (IV)(en)Cl 4] and [Pt (IV)(dach)Cl 4]. The results indicate that the axial halo ligands are essential for substitution and the Pt (IV) complexes with larger axial halo ligands have faster rates. When the Pt (IV) complexes with different carrier ligands were compared, the substitution rates increased in the order [Pt (IV)(dach)Cl 4] < [Pt (IV)(en)Cl 4] < [Pt (IV)(NH 3) 2Cl 4], which is in reverse order to the carrier ligand size. These axial and carrier ligand effects on the substitution rates are consistent with the BP mechanism. Larger axial halo ligands can form a better bridging ligand, which facilitates the electron-transfer process from the Pt (II) to Pt (IV) center. Smaller carrier ligands exert less steric hindrance for the bridge formation. 相似文献
20.
Spiegel K Magistrato A Carloni P Reedijk J Klein ML 《The journal of physical chemistry. B》2007,111(41):11873-11876
Dinuclear azole-bridged Pt compounds bind to DNA helices, forming intrastrand crosslinks between adjacent guanines in a similar way to cisplatin. Their cytotoxic profile is, however, different from that of first and second generation Pt drugs in that they lack cross resistance in cisplatin-resistant cell lines. In contrast to cisplatin, which induces a large kink in DNA duplex, structural NMR studies and molecular dynamics simulations have shown that azole-bridged diplatinum compounds induce only small structural changes in double-stranded DNA. These structural differences have been invoked to explain the different cytotoxic profile of these compounds. Here, we show that in addition to the small structural changes in DNA, dinuclear Pt compounds also affect DNA minor groove flexibility in a different way than cisplatin. Free-energy calculations on azole-bridged diplatinum DNA adducts reveal that opening of the minor groove requires a higher free-energy cost (DeltaG ~ 7-15 kcal/mol) than in the corresponding cisplatin-DNA adduct (DeltaG ~ 0 kcal/mol). This could prevent minor groove binding proteins from binding to diplatinum-DNA adducts thus leading to a different cellular response than cisplatin and possibly decreasing the activity of excision repair enzymes. Although the development of drug resistance is a highly complex mechanism, our findings provide an additional rationale for the improved cytotoxic activity of these compounds in cell lines resistant to cisplatin. 相似文献