A general method for the synthesis of 2'-O-cyanoethylated oligoribonucleotides having promising hybridization affinity for DNA and RNA and enhanced nuclease resistance

[reaction: see text] An effective method for the synthesis of 2'-O-cyanoethylated oligoribonucleotides as a new class of 2'-O-modified RNAs was developed. The reaction of appropriately protected ribonucleoside derivatives with acrylonitrile in t-BuOH in the presence of Cs2CO3 gave 2'-O-cyanoethylated ribonucleoside derivatives in excellent yields, which were converted by a successive selective deprotection/protection strategy to 2'-O-cyanoethylated 5'-O-dimethoxytritylribonucleoside 3'-phosphoramidite derivatives in high yields. Fully 2'-O-cyanoethylated oligoribonucleotides, (Uce)12 and (GceAceCceUce)3, were successfully synthesized in the phosphoramidite approach by use of the phosphoramidite building blocks. It was also found that oligoribonucleotides having a 2'-O-cyanoethylated ribonucleoside (Uce, Cce, Ace, or Gce) could be obtained by the selective removal of the TBDMS group from fully protected oligoribonucleotide intermediates without loss of the cyanoethyl group by use of NEt3 x 3HF as a desilylating reagent. The detailed T(m) experiments revealed that oligoribonucleotides containing 2'-O-cyanoethylated ribonucleosides have higher hybridization affinity for both DNA and RNA than the corresponding unmodified and 2'-O-methylated oligoribonucleotides. In addition, introduction of a cyanoethyl group into the 2'-position of RNA resulted in significant increase of nuclease resistance toward snake venom and bovine spleen phosphodiesterases compared with that of the methyl group.     

Nucleotides. Part LXXIII

The (2‐cyano‐1‐phenylethoxy)carbonyl (2c1peoc) group was developed as a new base‐labile protecting group for the 5′‐OH function in solid‐phase synthesis of oligoribonucleotides via the phosphoramidite approach. The half‐lives of its β‐elimination process by 0.1M DBU (1,8‐diazabicyclo[5.4.0]undec‐7‐ene) were determined to be 7–14 s by HPLC investigations. The 2′‐OH function was protected with the acid‐labile tetrahydro‐4‐methoxy‐2H‐pyran‐4‐yl (thmp) group, while the 2‐(4‐nitrophenyl)ethyl (npe) and 2‐(4‐nitrophenyl)ethoxycarbonyl (npeoc) groups were used for the protection of the base and phosphate moieties. The syntheses of the monomeric building blocks, both phosphoramidites and nucleoside‐functionalized supports, as well as the build‐up of oligoribonucleotides by means of this approach are described.     

Chemical synthesis of oligoribonucleotides containing 2-aminopurine: substrates for the investigation of ribozyme function

The chemical synthesis of a fully protected ribonucleoside phosphoramidite, containing 2-aminopurine as the base component, and its incorporation into short oligoribonucleotides as substrates for an engineered ribozyme from Tetrahymena is described.     

Solid phase synthesis of the 3′-terminal nonadecaribonucleoside octadecaphosphate sequence of yeast alanine transfer ribonucleic acid

The rapid synthesis of the 3′-terminal decaribonucleoside nonaphosphate and nonadecaribonucleoside octadecaphosphate sequences of yeast tRNA^Ala by the phosphoramidite approach on controlled pore glass is described; the synthetic products were found to be identical to the authentic oligoribonucleotides, prepared by the phosphotriester approach in solution.     

Nucleotides. Part XLIII. Solid-phase synthesis of oligoribonucleotides using the 2-dansylethoxycarbonyl (  2-{[5-(dimethylamino)naphthalen-1-yl]sulfonyl}ethoxycarbonyl; dnseoc) group for 5′-hydroxy protection

A new efficient method for solid-phase synthesis of oligoribonucleotides via the phosphoramidite approach is described. The combination of the base-labile 2-dansylethoxycarbonyl (Dnseoc) group for 5′-OH protection with the acid-labile tetrahydro-4-methoxy-2H-pyran-4-yl (Thmp) group as 2′-OH blocking group is orthogonal regarding cleavage reactions and fulfills the requirements of an automated synthesis in an excellent manner if the phosphoramidite function carries the N,N-diethyl-O-[2-(4-nitrophenyl)ethyl] substitution.     

Nucleotides. Part LXXI

A new labelling technique attaching fluorescein via a carbamoyl linker directly to the amino groups of the nucleobases was developed. The amino groups were first converted to the phenoxycarbonyl derivatives (→ 10, 15, 19, 58 ), which reacted under mild conditions with 5‐aminofluorescein to give the corresponding N‐[(fluorescein‐5‐ylamino)carbonyl] derivatives (→ 11 – 14, 16, 17, 20, 59, 60 ). The introduction of the 5‐aminofluorescein residue into properly protected adenylyl‐adenosine dimers (→ 39, 40 ) and trimer (→ 50 ) worked well, and final deprotection of these uniformly blocked precursors led on treatment with DBU (1,8‐diazabicyclo[5.4.0]undec‐7‐ene), in one step to dimer 41 and trimer 51 . Synthesis of an appropriately protected monomeric phosphoramidite building block (→ 75 ) was more difficult, since introduction of the 2‐(4‐nitrophenyl)ethyl residue into the fluorescein moiety in 59 led mainly to trisubstitution to give 61 including the urea function. Formation of the adenylyl dimer 66 and trimer 67 proceeded in the usual manner by phosphoramidite chemistry; however, deprotection of 67 with DBU was incomplete since the O‐alkyl group at the urea moiety was found to be very stable. Finally, the appropriate phosphoramidite building block 75 could be synthesized by the sequence 59 → 72 → 73 → 74 → 75 . The phosphoramidite 75 was used for the synthesis of dimer 77 and trimer 79 by solution chemistry, as well as for that of various oligonucleotides by the machine‐aided approach on solid support carrying the fluorophore at different positions of the chain (→ 84 – 87 ). The attachment of the fluorescein fluorophor via a short carbamoyl linker onto the 6‐amino group of 2′‐deoxyadenosine enables such molecules to function very well in fluorescence‐polarization experiments.     

Large scale synthesis of oligoribonucleotides on PEG by the phosphite triester approach

Large scale synthesis of oligoribonucleotides has been successfully performed on PEG support by the phosphoramidite approach using t-butyldimethylsilyl to protect the 2'-hydroxyl group of ribonucleoside. By means of this procedure, the dodecamer r(AGUGGUCUUUGU) was synthesized in 98.1% average coupling yield, and 55 mg pure product was obtained from one gram of functionalized PEG.     

Acid/azole complexes as highly effective promoters in the synthesis of DNA and RNA oligomers via the phosphoramidite method

The utility of various kinds of acid salts of azole derivatives as promoters for the condensation of a nucleoside phosphoramidite and a nucleoside is investigated. Among the salts, N-(phenyl)imidazolium triflate, N-(p-acetylphenyl)imidazolium triflate, N-(methyl)benzimidazolium triflate, benzimidazolium triflate, and N-(phenyl)imidazolium perchlorate have shown extremely high reactivity in a liquid phase. These reagents serve as powerful activators of deoxyribonucleoside 3'-(allyl N,N-diisopropylphosphoramidite)s or 3'-(2-cyanoethyl N,N-diisopropylphosphoramidite)s employed in the preparation of deoxyribonucleotides, and 3'-O-(tert-butyldimethylsilyl)ribonucleoside 2'-(N,N-diisopropylphosphoramidite)s or 2'-O-(tert-butyldimethylsilyl)ribonucleoside 3'-(N,N-diisopropylphosphoramidite)s used for the formation of 2'-5' and 3'-5' internucleotide linkages between ribonucleosides, respectively. The azolium salt has allowed smooth and high-yield condensation of the nucleoside phosphoramidite and a 5'-O-free nucleoside, in which equimolar amounts of the reactants and the promoter are employed in the presence of powdery molecular sieves 3A in acetonitrile. It has been shown that some azolium salts serve as excellent promoters in the solid-phase synthesis of oligodeoxyribonucleotides and oligoribonucleotides. For example, benzimidazolium triflate and N-(phenyl)imidazolium triflate can be used as effective promoters in the synthesis of an oligodeoxyribonucleotide, (5')CGACACCCAATTCTGAAAAT(3') (20mer), via a method using O-allyl/N-allyloxycarbonyl-protected deoxyribonucleoside 3'-phosphoramidites or O-(2-cyanoethyl)/N-phenoxyacetyl-protected deoxyribonucleotide 3'-phosphoramidite as building blocks, respectively, on high-cross-linked polystyrene resins. Further, N-(phenyl)imidazolium triflate is useful for the solid-phase synthesis of oligoribonucleotides, such as (5')AGCUACGUGACUACUACUUU(3') (20mer), according to an allyl/allyloxycarbonyl-protected strategy. The utility of the azolium promoter has been also demonstrated in the liquid-phase synthesis of some biologically important substances, such as cytidine-5'-monophosphono-N-acetylneuraminic acid (CMP-Neu5Ac) and adenylyl(2'-5')adenylyl(2'-5')adenosine (2-5A core).     

Synthesis of 2'- or 3'-o-(4-methoxybenzyl)nucleosides and its application in the 3'-terminal nonanucleotide sequence of rous sarcoma virus 35S RNA synthesis

2'- or 3'-O-(4-Methoxybenzyl)nucleoside derivatives were synthesized by treatment of uridine, N⁴-benzoylcytidine, N⁶-benzoyladenosine, and N²-benzoylguanosine with 4-methoxy-phenyldiazomethane. The separation of 2'- or 3'-isomers became possible on a silica gel column chromatography by using N-acylated nucleosides and these compounds could be used as useful starting materials for the synthesis of oligoribonucleotides by the phosphotriester method. The trimer blocks, U-U-Cp, A-C-Cp, and A-C-A were synthesized by the rapid method. The 3'-terminal nonanucleotide, U-U-C-A-C-C-A-C-A, of Rous Sarcoma Virus 35S RNA was obtained by the block condensation of trimers.     

Synthesis of a benzotriazole azo dye phosphoramidite for labelling of oligonucleotides

The synthesis of a benzotriazole azo dye phosphoramidite and the subsequent use in solid phase synthesis of oligonucleotides is reported. The azo dye is shown as a surface enhanced resonance Raman label for oligonucleotides that is capable of immobilisation of the oligonucleotide on metal surfaces such as silver nanoparticles.     

New strategies for cyclization and bicyclization of oligonucleotides by click chemistry assisted by microwaves

The synthesis of cyclic, branched, and bicyclic oligonucleotides was performed by copper-catalyzed azide-alkyne cycloaddition assisted by microwaves in solution and on solid support. For that purpose, new phosphoramidite building blocks and new solid supports were designed to introduce alkyne and bromo functions into the same oligonucleotide by solid-phase synthesis on a DNA synthesizer. The bromine atom was then substituted by sodium azide to yield azide oligonucleotides. Cyclizations were found to be more efficient in solution than on solid support. This method allowed the efficient preparation of cyclic (6- to 20-mers), branched (with one or two dangling sequences), and bicyclic (2 x 10-mers) oligonucleotides.     

A New and Efficient Method for Synthesis of 5′‐Conjugates of Oligonucleotides through Amide‐Bond Formation on Solid Phase

An efficient method for synthesis of oligonucleotide 5′‐conjugates through amide‐bond formation on solid phase is described. Protected oligonucleotides containing a 5′‐carboxylic acid function were obtained by use of a novel non‐nucleosidic phosphoramidite building block, where the carboxylic acid moiety was protected by a 2‐chlorotrityl group. The protecting group is stable to the phosphoramidite coupling conditions used in solid‐phase oligonucleotide assembly, but is easily deprotected by mild acidic treatment. The protecting group may be removed also by ammonolysis. 5′‐Carboxylate‐modified oligonucleotides were efficiently conjugated on solid support under normal peptide‐coupling conditions to various amines or to the N‐termini of small peptides to yield products of high purity. The method is well‐suited in principle for the synthesis of peptide‐oligonucleotide conjugates containing an amide linkage between the 5′‐end of an oligonucleotide and the N‐terminus of a peptide.     

Nucleotides,Part LXIX,Synthesis of Phosphoramidite Building Blocks of Isoxanthopterin N8‐(2′‐Deoxy‐β‐D‐ribonucleosides): New Fluorescence Markers for Oligonucleotide Synthesis

The chemical synthesis of isoxanthopterin and 6‐phenylisoxanthopterin N⁸‐(2′‐deoxy‐β‐D ‐ribofuranosyl nucleosides) is described as well as their conversion into suitably protected 3′‐phosphoramidite building blocks to be used as marker molecules for DNA synthesis. Applying the npe/npeoc (=2‐(4‐nitrophenyl)ethyl/[2‐(4‐nitrophenyl)ethoxy]carbonyl) strategy, we used the new building blocks in the preparation of oligonucleotides by an automated solid‐support approach. The hybridization properties of a series of labelled oligomers were studied by UV‐melting techniques. It was found that the newly synthesized markers only slightly interfered with the abilities of the labelled oligomers to form stable duplexes with complementary oligonucleotides.     

Liquid‐Phase RNA Synthesis by Using Alkyl‐Chain‐Soluble Support

Recent progress in the RNA therapeutics has increased demand for the synthesis of large quantities of oligoribonucleotides. The assembly of RNA oligomers relies mainly on solid‐phase approaches. These allow rapid product purification and the ability to drive a target reaction to completion through the use of excess reagents. Despite the known advantages of solid‐phase synthesis, some issues in the process remain to be addressed, such as low and limited scale, reagent accessibility, and the use of a very large excess of reagents. Herein, we report a highly efficient and practical method of liquid‐phase synthesis of RNA oligomers by using alkyl‐chain‐soluble support. We demonstrate the utility of the liquid‐phase method through 21‐mer RNA synthesis on a gram scale.     

Fluorous linker facilitated synthesis of teichoic acid fragments

The use of perfluorooctylpropylsulfonylethanol as a new phosphate protecting group and fluorous linker is evaluated in the stepwise solution phase synthesis of a number of biologically relevant (carbohydrate substituted) glycerol teichoic acid fragments. Teichoic acid fragments, up to the dodecamer level, were assembled by means of phosphoramidite chemistry, using a relatively small excess of the building blocks and a repetitive efficient purification procedure of the protected intermediates by fluorous solid phase extraction (F-SPE).     

Reliable Chemical Synthesis of Oligoribonucleotides (RNA) with 2′‐O‐[(Triisopropylsilyl)oxy]methyl(2′‐O‐tom)‐Protected Phosphoramidites

A method for the introduction of the 2′‐O‐[(triisopropylsilyl)oxy]methyl (=tom) group into N‐acetylated, 5′‐O‐dimethoxytritylated ribonucleosides is presented. The corresponding 2′‐O‐tom‐protected phosphoramidite building blocks were obtained in pure form and were successfully employed for the routine synthesis of oligoribonucleotides on DNA synthesizers. Under DNA coupling conditions (2.5 min coupling time for a 1.5‐μmol synthesis scale) and with 5‐(benzylthio)‐1H‐tetrazole (BTT) as activator, 2′‐O‐tom‐protected phosphoramidites exhibited average coupling yields >99.4%. The combination of N‐acetyl and 2′‐O‐tom protecting groups allowed a reliable and complete two‐step deprotection, first with MeNH₂ in EtOH/H₂O and then with Bu₄NF in THF, without concomitant destruction of the product RNA sequences.     

Cyclic phosphate-linked oligosaccharides: synthesis and conformational behavior of novel cyclic oligosaccharide analogues

CyPLOS (cyclic phosphate-linked oligosaccharides), that is, novel cyclic oligosaccharide surrogates, consisting of two, three, and four phenyl-beta-D-glucopyranoside units, 4,6-linked through stable phosphodiester bonds, were prepared by a straightforward and efficient solid-phase protocol. The assembly of the linear precursors was achieved by standard phosphoramidite chemistry on an automated DNA synthesizer, using a suitably protected 4-phosphoramidite derivative of D-glucose as the building block. For the crucial cyclization step a phosphotriester methodology was exploited, followed by a mild basic treatment releasing the desired cyclic molecules in solution in a highly pure form. The cyclic dimer and trimer were also independently prepared by classical solution synthesis, basically following the same approach. The solution structural preferences of the cyclic dimer and trimer, obtained by detailed NMR analysis, are also reported.     

An Improved Approach for Practical Synthesis of 5-Hydroxymethyl-2′-deoxycytidine (5hmdC) Phosphoramidite and Triphosphate

5-Hydroxymethyl-2′-deoxycytidine (5hmdC) phosphoramidite and triphosphate are important building blocks in 5hmdC-containing DNA synthesis for epigenetic studies. However, efficient and practical methods for the synthesis of these compounds are still limited. The current research provides an intensively improved synthetic method that enables the preparation of commercially available cyanoethyl-protected 5hmdC phosphoramidite with an overall yield of 39% on 5 g scale. On the basis of facile and efficient accesses to cyanoethyl protected-5hmdU and 5hmdC intermediates, two efficient synthetic routes for 5hmdC triphosphate were also developed.     

Solid-phase synthesis and on-column deprotection of RNA from 2'- (and 3'-) O-levulinated (Lv) ribonucleoside monomers

[reaction: see text] The solid-phase synthesis of oligoribonucleotides derived from ribonucleosides esterified at the 2'- (or 3'-) position with the levulinyl (Lv) group is described. The oligomers can be released from the solid support as 2'-O-Lv ester derivatives or fully deprotected while still attached to the solid support.     

Chemical synthesis of selenium-modified oligoribonucleotides and their enzymatic ligation leading to an U6 SnRNA stem-loop segment

The derivatization of nucleic acids with selenium is highly promising to facilitate nucleic acids structure determination by X-ray crystallography using the multiwavelength anomalous dispersion (MAD) technique. The foundation for such an approach has been laid by Huang, Egli, and co-workers and was exemplified on small DNA duplexes. Here, we present a comprehensive study on the preparation of RNAs containing 2'-Se-methylpyrimidine nucleoside labels. This includes the synthesis of a novel 2'-Se-methylcytidine phosphoramidite 11 and its incorporation into oligoribonucleotides by solid-phase synthesis. Deprotection of the oligonucleotides is achieved in the presence of millimolar amounts of threo-1,4-dimercapto-2,3-butandiol (DTT). With this additive, oxidation products and follow-up side-products are suppressed and acceptable HPLC traces of the crude material are obtained, so far tested for sequences of up to 22-mers. Moreover, an extensive investigation on the enzymatic ligation of the selenium-containing oligoribonucleotides demonstrates the high flexibility of the selenium approach. Our target sequence, an U6 snRNA stem-loop motif comprising all naturally occurring nucleoside modifications beside the Se-label is achieved by ligation using T4 RNA ligase.