Synthesis of heteroleptic bis(diimine)carbonylchlororuthenium(II) complexes from photodecarbonylated precursors

The reactions of bidentate diimine ligands (L2) with binuclear [Ru(L1)(CO)Cl2]2 complexes [L1 not equal to L2 = 2,2'-bipyridine (bpy), 4,4'-dimethyl-2,2'-bipyridine (4,4'-Me2bpy), 5,5'-dimethyl-2,2'-bipyridine (5,5'-Me2bpy), 1,10-phenanthroline (phen), 4,7-dimethyl-1,10-phenanthroline (4,7-Me2phen), 5,6-dimethyl-1,10-phenanthroline (5,6-Me2phen), di(2-pyridyl)ketone (dpk), di(2-pyridyl)amine (dpa)] result in cleavage of the dichloride bridge and the formation of cationic [Ru(L1)(L2)(CO)Cl]+ complexes. In addition to spectroscopic characterization, the structures of the [Ru(bpy)(phen)(CO)Cl]+, [Ru(4,4'-Me2bpy)(5,6-Me2phen)(CO)Cl]+ (as two polymorphs), [Ru(4,4'-Me2bpy)(4,7-Me2phen)(CO)Cl]+, [Ru(bpy)(dpa)(CO)Cl]+, [Ru(5,5'-Me2bpy)(dpa)(CO)Cl]+, [Ru(bpy)(dpk)(CO)Cl]+, and [Ru(4,4'-Me2bpy)(dpk)(CO)Cl]+ cations were confirmed by single crystal X-ray diffraction studies. In each case, the structurally characterized complex had the carbonyl ligand trans to a nitrogen from the incoming diimine ligand, these complexes corresponding to the main isomers isolated from the reaction mixtures. The synthesis of [Ru(4,4'-Me2bpy)(5,6-Me2bpy)(CO)(NO3)]+ from [Ru(4,4'-Me2bpy)(5,6-Me2bpy)(CO)Cl]+ and AgNO3 demonstrates that exchange of the chloro ligand can be achieved.     

Synthesis and structural,electrochemical, and optical properties of Ru(II) complexes with azobis(2,2'-bipyridine)s

Two new ditopic ligands, 5,5"-azobis(2,2'-bipyridine) (5,5"-azo) and 5,5"-azoxybis(2,2'-bipyridine) (5,5"-azoxy), were prepared by the reduction of nitro precursors. Mononuclear and dinuclear Ru(II) complexes having one of these bridging ligands and 2,2'-bipyridine terminal ligands were also prepared, and their properties were compared with previously reported Ru(II) complexes having 4,4"-azobis(2,2'-bipyridine) (4,4"-azo). The X-ray crystal structure showed that 5,5"-azo adopts the trans conformation and a planar rodlike shape. The X-ray crystal structure of [(bpy)(2)Ru(5,5"-azo)Ru(bpy)(2)](PF(6))(4) (Ru(5,5"-azo)Ru) showed that the bridging ligand is in the trans conformation and nearly planar also in the complex and the metal-to-metal distance is 10.0 A. The azo or azoxy ligand in these complexes exhibits reduction processes at less negative potentials than the terminal bpy's due to the low-lying pi level. The electronic absorption spectra for the complexes having 5,5"-azo or 5,5"-azoxy exhibit an extended low-energy metal-to-ligand charge-transfer absorption. The ligands, 5,5"-azo and 5,5"-azoxy, and the mononuclear complex, [(bpy)(2)Ru(5,5"-azo)](2+), isomerize reversibly upon light irradiation. The low-energy MLCT state sensitizes the isomerization of the azo moiety in this complex. While [(bpy)(2)Ru(4,4"-azo)Ru(bpy)(2)](PF(6))(4) exhibits light switch properties, namely, significant electrochromism and a large luminescence enhancement, upon reduction, Ru(5,5"-azo)Ru does not show these properties. The radical anion formation upon reduction of these complexes has been confirmed by ESR spectroscopy.     

meso-[{Ru(phen)2}2(mu-HAT)]4+: a high-affinity DNA hairpin probe {HAT = 1,4,5,8,9,12-hexaazatriphenylene; phen = 1,10-phenanthroline}

1H NMR spectroscopy and fluorescent intercalator displacement (FID) assays have been used to investigate the DNA-binding abilities of two series of dinuclear polypyridyl ruthenium(II) complexes of the form [{Ru(L)2}2(mu-BL)]4+ {L = 2,2'-bipyridine (bpy), 4,4'-dimethyl-2,2'-bipyridine (Me2bpy), 1,10-phenanthroline (phen), or 4,7-dimethyl-1,10-phenanthroline (Me2phen); BL = 2,2'-bipyrimidine (bpm) or 1,4,5,8,9,12-hexaazatriphenylene (HAT)}. Preliminary FID surveys of these metal complexes against a variety of different oligonucleotides revealed that those complexes based upon the HAT bridging ligand induced greater fluorescence decreases in dye-bound DNA than did their bpm-bridged counterparts, suggesting a higher binding affinity by the HAT-bridged species. Furthermore, the greatest fluorescence decreases were typically observed in an oligonucleotide featuring a six-base hairpin loop. The apparent binding affinity of the metal complexes was also found to be a function of the stereochemistry and identity of the terminal ligands of the complex. The meso (DeltaLambda) stereoisomer generally induced greater fluorescence decreases than did either enantiomer (DeltaDelta or LambdaLambda), phen-based terminal ligands performed better than bpy-based terminal ligands, and those terminal ligands with methyl substituents demonstrated stronger apparent binding than did their non-methylated analogues. NMR experiments on meso-[{Ru(phen)2}2(mu-HAT)]4+ and meso-[{Ru(Me2phen)2}2(mu-HAT)]4+ demonstrated that both complexes bound with high affinity to the six-base hairpin oligonucleotide at the stem-loop interface and provided evidence to support stronger binding by the methylated species. meso-[{Ru(phen)2}2(mu-HAT)]4+ was found to bind poorly to duplex DNA and smaller four-base hairpin loops in FID and NMR experiments, whereas FID data suggest that the methylated analogue binds relatively strongly to most oligonucleotide sequences (the four- and six-base hairpins in particular). These results demonstrate that binding affinity can come at the expense of selectivity, with meso-[{Ru(phen)2}2(mu-HAT)]4+ proving to be an efficient compromise between the two as a high-affinity DNA hairpin probe.     

Mono- and dinuclear ruthenium(II) 1,6,7,12-tetraazaperylene complexes

We report the synthesis of free 1,6,7,12-tetraazaperylene (tape). Tape was obtained from 1,1'-bis-2,7-naphthyridine by potassium promoted cyclization followed by oxidation with air. Mono- and dinuclear ruthenium(II) 1,6,7,12-tetraazaperylene complexes of the general formulas [Ru(L-L)(2)(tape)](PF(6))(2), [1](PF(6))(2)-[5](PF(6))(2), and [{Ru(L-L)(2)}(2)(μ-tape)](PF(6))(4), [6](PF(6))(4)-[10](PF(6))(4), with{L-L = phen, bpy, dmbpy (4,4'-dimethyl-2,2'-bipyridine), dtbbpy (4,4'-ditertbutyl-2,2'-bipyridine) and tmbpy (4,4'5,5'-tetramethyl-2,2'-bipyridine)}, respectively, were synthesized. The X-ray structures of tape·2CHCl(3) and the mononuclear complexes [Ru(bpy)(2)(tape)](PF(6))(2)·0.5CH(3)CN·0.5toluene, [Ru(dmbpy)(2)(tape)](PF(6))(2)·2toluene and [Ru(dtbbpy)(2)(tape)](PF(6))(2)·3acetone·0.5H(2)O were solved. The UV-vis absorption spectra and the electrochemical behavior of the ruthenium(ii) tape complexes were explored and compared with the data of the analogous dibenzoeilatin (dbneil), 2,2'-bipyrimidine (bpym) and tetrapyrido[3,2-a:2',3'-c:3',2'-h:2',3'-j]phenazin (tpphz) species.     

Chiral-at-metal ruthenium complex as a metalloligand for asymmetric catalysis

The mononuclear [Ru(bpy)(2)(bpym)][PF(6)](2) complex (bpy = 2,2'-bipyridine; bpym = 2,2'-bipyrimidine) has been prepared in its enantiopure Lambda form. Because of the chelating property of the bipyrimidine moiety, it is possible to use this chiral-at-metal complex as a chiral inorganic ligand for a second metal cation acting as a catalytic center. Here we report the synthesis and the structural characterization of a novel dinuclear Lambda-[(bpy)(2)Ru(bpym)RuCl(p-cymene)](3+) compound (1). The asymmetric-inducing properties of the enantiopure chiral-at-metal metalloligand have been probed during asymmetric transfer hydrogenation to ketones catalyzed by 1. This provides one of the very few illustrations of the potential of this original class of chiral inorganic ligands.     

Orientation tuning of a polypyridyl Ru(II) complex immobilized on a clay surface toward chiral discrimination

The present work reports an attempt to elucidate a stereoselective energy-transfer system by immobilizing a chiral metal complex on a clay surface. The metal complex used was [Ru(bpy)2L(i)]2+ with L1 = bpy (2,2'-bipyridine), L2 = 4,4'-diundecyl-2,2'-bipyridine, and L3 = 5,5'-diundecyl-2,2'-bipyridine. The adsorption structure of [Ru(bpy)2L(i)]2+ was studied by means of electric dichroism measurements on an aqueous dispersion of a colloidal clay. It was found that the molecular orientation of the adsorbed Ru(II) complex was affected remarkably by the positions of the alkyl chains on the bpy ligand; that is, the angle of the 3-fold or pseudo-3-fold symmetry axis of the Ru(II) complex with respect to the surface normal was obtained to be 24 degrees, 30 degrees, and 52 degrees for i = 1, 2, and 3, respectively. The efficiency of the energy-transfer was determined by photoluminescence quenching measurements between the adsorbed Ru(II) complex and [Ru(acac)3] (acac = acetylacetonate) in solution. As a result, stereoselectivity appeared most for the case of [Ru(bpy)2L3]2+ in which its two helically twisted bpy ligands were projected in an outward direction.     

New members of the [Ru(diimine)(CN)(4)](2-) family: structural, electrochemical and photophysical properties

A series of complexes of the type K(2)[Ru(NN)(CN)(4)] has been prepared, in which NN is a diimine ligand, and were investigated for both their structural and photophysical properties. The ligands used (and the abbreviations for the resulting complexes) are 3-(2-pyridyl)pyrazole (Ru-pypz), 2,2'-bipyrimidine (Ru-bpym), 5,5'-dimethyl-2,2'-bipyridine (Ru-dmb), 1-ethyl-2-(2-pyridyl)benzimidazole (Ru-pbe), bidentate 2,2':6',2'-terpyridine (Ru-tpy). The known complexes with = 2,2'-bipyridine (Ru-bpy) and 1,10-phenathroline (Ru-phen) were also included in this work. A series of crystallographic studies showed that the [Ru(NN)(CN)(4)](2-) complex anions form a range of elaborate coordination networks when crystallised with either K(+) or Ln(3+) cations. The K(+) salts are characterised by a combination of near-linear Ru-CN-K bridges, with the cyanides coordinating to K(+) in the usual 'end-on' mode, and unusual side-on pi-type coordination of cyanide ligands to K(+) ions. With Ln(3+) cations in contrast only Ru-CN-Ln near-linear bridges occurred, affording 1-dimensional helical or diamondoid chains, and 2-dimensional sheets constituted from linked metallamacrocyclic rings. All of the K(2)[Ru(CN)(4)] complexes show a reversible Ru(II)/Ru(III) couple (ca.+0.9 V vs. Ag/AgCl in water), the exception being Ru-tpy whose oxidation is completely irreversible. Luminescence studies in water showed the presence of (3)MLCT-based emission in all cases apart from Ru-bpym with lifetimes of tens/hundreds of nanoseconds. Time-resolved infrared studies showed that in the (3)MLCT excited state the principal C-N stretching vibration shifts to positive energy by ca. 50 cm(-1) as a consequence of the transient oxidation of the metal centre to Ru(III) and the reduction in back-bonding to the cyanide ligands; measurement of transient decay rates allowed measurements of (3)MLCT lifetimes for those complexes which could not be characterised by luminescence spectroscopy. A few complexes were also examined in different solvents (MeCN, dmf) and showed much weaker emission and shorter excited-state lifetimes in these solvents compared to water.     

Tuning and switching MLCT phosphorescence of [Ru(bpy)3]2+ complexes with triarylboranes and anions

Four new Ru(II) complexes, [Ru(bpy)(2)(4,4'-BP2bpy)][PF(6)](2) (1), [Ru(t-Bu-bpy)(2)(4,4'-BP2bpy)][PF(6)](2) (2), [Ru(bpy)(2)(5,5'-BP2bpy)][PF(6)](2) (3), and [Ru(t-Bu-bpy)(2)(5,5'-BP2bpy)][PF(6)](2) (4) have been synthesized (where 4,4'-BP2bpy = 4,4'-bis(BMes(2)phenyl)-2,2'-bpy; 5,5'-BP2bpy = 5,5'-bis(BMes(2)phenyl)-2,2'-bpy (4,4'-BP2bpy); and t-Bu-bpy = 4,4'-bis(t-butyl)-2,2'-bipyridine). These new complexes have been fully characterized. The crystal structures of 3 and 4 were determined by single-crystal X-ray diffraction analyses. All four complexes display distinct metal-to-ligand charge transfer (MLCT) phosphorescence that has a similar quantum efficiency as that of [Ru(bpy)(3)][PF(6)](2) under air, but is at a much lower energy. The MLCT phosphorescence of these complexes has been found to be highly sensitive toward anions such as fluoride and cyanide, which switch the MLCT band to higher energy when added. The triarylboron groups in these compounds not only introduce this color switching mechanism, but also play a key role in the phosphorescence color of the complexes.     

Synthesis, characterization, photophysical, and computational studies of rhenium(I) tricarbonyl complexes containing the derivatives of bipyrazine

The chloro and pyridinate derivatives of rhenium(I) tricarbonyl complexes containing the diimine ligands 2,2'-bipyrazine (bpz) and 5,5'-dimethyl-2,2'-bipyrazine (Me2bpz) are reported. Absorption maxima occur in the visible and ultraviolet regions of the spectrum; emission is structureless at room temperature and at 77 K; the infrared spectrum consists of three carbonyl stretches; electrochemically, a reversible reduction, an irreversible reduction, and an irreversible oxidation take place. Some ring protons are shielded and others deshielded in the presence of the methyl substituents attached to the bpz ring. DFT and TDDFT calculations provide insight into interpreting electronic and vibrational properties of the complexes. When compared to similar rhenium(I) tricarbonyl complexes of 2,2'-bipyridine (bpy) and 2,2'-bipyrimidine (bpm), the Me2bpz complexes are comparable to bpm derivatives and their properties are intermediate between those of bpy and bpz complexes.     

Metallomacrocycles with a Difference: Macrocyclic Complexes with Exocyclic Ruthenium(II)‐Containing Domains

The templated synthesis of organic macrocycles containing rings of up to 96 atoms and three 2,2′‐bipyridine (bpy) units is described. Starting with the bpy‐centred ligands 5,5′‐bis[3‐(1,4‐dioxahept‐6‐enylphenyl)]‐2,2′‐bipyridine and 5,5′‐bis[3‐(1,4,7‐trioxadec‐9‐enylphenyl)]‐2,2′‐bipyridine, we have applied Grubbs’ methodology to couple the terminal alkene units of the coordinated ligands in [FeL₃]²⁺ complexes. Hydrogenation and demetallation of the iron(II)‐containing macrocyclic complexes results in the isolation of large organic macrocycles. The latter bind {Ru(bpy)₂} units to give macrocyclic complexes with exocyclic ruthenium(II)‐containing domains. The complex [Ru(bpy)₂(L)]²⁺ (isolated as the hexafluorophosphate salt), in which L=5,5′‐bis[3‐(1,4,7,10‐tetraoxatridec‐12‐enylphenyl)]‐2,2′‐bipyridine, undergoes intramolecular ring‐closing metathesis to yield a macrocycle which retains the exocyclic {Ru(bpy)₂} unit. The poly(ethyleneoxy) domains in the latter macrocycle readily scavenge sodium ions, as proven by single‐crystal X‐ray diffraction and atomic absorption spectroscopy data for the bulk sample. In addition to the new compounds, a series of model complexes have been fully characterized, and representative single‐crystal X‐ray structural data are presented for iron(II) and ruthenium(II) acyclic and macrocyclic species.     

Inert benzothiazole functionalised ruthenium(II) complexes; potential DNA hairpin binding agents

The two enantiomers of [Ru(bpy)2(bbtb)]2+{bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the Lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+{Me(2)bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association with hairpin oligonucleotides, again with the Lambda enantiomer binding more strongly. A (1)H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.     

Tuning of luminescence spectra of neutral ruthenium(II) complexes by crystal waters

Neutral ruthenium(II) complexes [RuLL'(CN)2] (L, L' = bpy, dmb, dbb; bpy = 2,2'-bipyridine, dmb = 4,4'-dimethyl-2,2'-bipyridine, dbb = 4,4'-tert-butyl-2,2'-bipyridine) were prepared, and the luminescence characteristics of the complexes in the solid state were measured. The luminescence was tuned by crystal waters included in the crystals; for example, [Ru(dbb)2(CN)2] x 2H2O, [Ru(dbb)2(CN)2] x H2O, and [Ru(dbb)2(CN)2] emit luminescence at 640, 685, and 740 nm, respectively.     

Palladium(II) and platinum(II) organometallic complexes with the model nucleobase anions of thymine, uracil, and cytosine: antitumor activity and interactions with DNA of the platinum compounds

Pd(II) and Pt(II) complexes with the anions of the model nucleobases 1-methylthymine (1-MethyH), 1-methyluracil (1-MeuraH), and 1-methylcytosine (1-MecytH) of the types [Pd(dmba)(mu-L)]2 [dmba = N,C-chelating 2-((dimethylamino)methyl)phenyl; L = 1-Methy, 1-Meura or 1-Mecyt] and [M(dmba)(L)(L')] [L = 1-Methy or 1-Meura; L' = PPh(3) (M = Pd or Pt), DMSO (M = Pt)] have been obtained. Palladium complexes of the types [Pd(C6F5)(N-N)(L)] [L = 1-Methy or 1-Meura; N-N = N,N,N',N'-tetramethylethylenediamine (tmeda), 2,2'-bipyridine (bpy), or 4,4'-dimethyl-2,2'-bipyridine (Me2bpy)] and [NBu4][Pd(C6F5)(1-Methy)2(H2O)] have also been prepared. The crystal structures of [Pd(dmba)(mu-1-Methy)]2, [Pd(dmba)(mu-1-Mecyt)]2.2CHCl3, [Pd(dmba)(1-Methy)(PPh3)].3CHCl3, [Pt(dmba)(1-Methy)(PPh3)], [Pd(tmeda)(C6F5)(1-Methy)], and [NBu4][Pd(C6F5)(1-Methy)2(H2O)].H2O have been established by X-ray diffraction. The DNA adduct formation of the new platinum complexes synthesized was followed by circular dichroism and electrophoretic mobility. Atomic force microscopy images of the modifications caused by the platinum complexes on plasmid DNA pBR322 were also obtained. Values of IC50 were also calculated for the new platinum complexes against the tumor cell line HL-60. All the new platinum complexes were more active than cisplatin (up to 20-fold in some cases).     

Syntheses, characterization, and photo-hydrogen-evolving properties of tris(2,2'-bipyridine)ruthenium(II) derivatives tethered to a cis-Pt(II)Cl2 unit: insights into the structure-activity relationship

The photo-hydrogen-evolving activity (activity to enhance the photochemical EDTA-reduction of water into molecular hydrogen) was evaluated for three different Ru(II)Pt(II) dimers with a general formula of [(bpy)2Ru(micro-bridge)PtCl2]2+(bpy = 2,2'-bipyridine; bridge = 4,4'-bis(N-(3-aminopropyl)carbamoyl)-2,2'-bipyridine (L1), 2,3-bis(2-pyridyl)pyrazine (L2), and 4,4'-bis(N-(4-pyridyl)methylcarbamoyl)-2,2'-bipyridine (L3); EDTA = ethylenediaminetetraacetic acid disodium salt). A new Ru(II)Pt(II) complex, [(bpy)2Ru(micro-L3)PtCl2]2+, was synthesized and characterized. It was confirmed that all three compounds are ineffective towards photochemical H2 production. In each case, an acetate-buffer solution (pH = 5) containing the Ru(II)Pt(II) dimer and EDTA was photolysed using a 350-W Xe lamp under an Ar atmosphere, during which the amount of H2 evolved was analysed by gas chromatography. Additional photolysis experiments were carried out by adding [Ru(bpy)3]2+ and methylviologen (N,N'-dimethyl-4,4'-bipyridinium) to the photolysis solutions described above to test the H2-evolving activity of the Pt(II) unit involved in these Ru(II)Pt(II) dimers. As a result, the Pt(II) units involved in the L1 and L2 compounds were found to be active as an H2-evolving catalyst, while that of the L3 compound was found to show no activity at all. The extent of intramolecular electron-transfer quenching from the 3MLCT excited state of the [Ru(bpy)3]2+ derivative to the tethering Pt(II) catalyst centre was investigated by comparison of the luminescence spectra of these compounds, together with the related compounds. The results showed that the quenching of the 3MLCT luminescence is not at all enhanced in either the L1 or the L3 compounds. On the other hand, the L2 compound is strongly quenched as previously reported. In addition to the above studies, the H2-evolving activity of some Pt(II) monomers, cis-PtCl2(NH3)2, PtCl2(en)(en = ethylenediamine), cis-PtCl2(4-methylpyridine)2, PtCl2(2,2'-bipyrimidine), PtCl2(4,4'-dicarboxy-2,2'-bipyridine), and [PtCl(terpy)]+(terpy = 2,2':6',2'-terpyridine), were similarly investigated in the presence of EDTA, [Ru(bpy)3]2+ and methylviologen, since they were regarded as structural analogues of the Pt(II) units involved in the L1-L3 compounds. The compounds having a cis-Pt(II)Cl2 unit were generally found to show high H2-evolving activity. This was interpreted in terms of the ligation of negatively charged chloride anions leading to the destabilization of the Pt(II) dz2 orbital responsible for the hydrogenic activation. Importantly, cis-PtCl2(4-methylpyridine)2 exhibited relatively high activity as an H2-evolving catalyst, suggesting the importance of the flexible rotation of the pyridyl ligands for efficient hydrogenic activation at the axial site of the Pt(II) ion. The DFT calculations also showed the validity of the structure-activity relationship discussed above for the L3 compound.     

Electrochemical and luminescent properties of new mononuclear ruthenium(II) and binuclear iridium(III)-ruthenium(II) terpyridine complexes.

Hexafluorophosphate salts of mononuclear complexes [Ru(II)Cl(L)(terpy)]+ (L = dmbpy (1); dpbpy (2), sambpy (3), and dpp (7), and binuclear complexes [Ru(II)2Cl2(dpp)(terpy)2]2+ (8) and [Ir(III)Ru(II)Cl2(dpp)(terpy)2]3+ (9) were prepared and characterized. Abbreviations of the ligands are bpy = 2,2'-bipyridine, dmbpy = 4,4'-dimethyl-2,2'-bipyridine, dpbpy = 4,4'-diphenyl-2,2'-bipyridine, dpp = 2,3-bis(2-pyridyl)pyrazine, sambpy = 4,4'-bis((S)-(+)-alpha-1-phenylethylamido)-2,2'-bipyridine, and terpy = 2,2':6',2'-terpyridine. The absorption spectra of 8 and 9 are dominated by ligand-centered bands in the UV region and by metal-to-ligand charge-transfer bands in the visible region. The details of their spectroscopic and electrochemical properties were investigated. In both binuclear complexes, it has been found that the HOMO is based on the Ru metal, and LUMO is dpp-based. [Ir(III)Ru(II)Cl2(dpp)(terpy)2]3+, indicating intense emission at room temperature, and a lifetime of 154 ns. The long lifetime of this bimetallic chromophore makes it a useful component in the design of supramolecular complexes.     

Coupling of metal-based light-harvesting antennas and electron-donor subunits: trinuclear ruthenium(II) complexes containing tetrathiafulvalene-substituted polypyridine ligands

Three new tetrathiafulvalene-substituted 2,2'-bipyridine ligands, cis-bpy-TTF(1), trans-bpy-TTF(1), and cis-bpy-TTF(2) have been prepared and characterized. X-ray analysis of trans-bpy-TTF(1) is also reported. Such ligands have been used to prepare two new trinuclear Ru(II) complexes, namely, [[(bpy)(2)Ru(micro-2,3-dpp)](2)Ru(bpy-TTF(1))](PF(6))(6) (9; bpy=2,2'-bipyridine; 2,3-dpp=2,3-bis(2'-pyridyl)pyrazine) and [[(bpy)(2)Ru(micro-2,3-dpp)](2)Ru(bpy-TTF(2))](PF(6))(6) (10). These compounds can be viewed as coupled antennas and charge-separation systems, in which the multichromophoric trinuclear metal subunits act as light-harvesting antennas and the tetrathiafulvalene electron donors can induce charge separation. The absorption spectra, redox behavior, and luminescence properties (both at room temperature in acetonitrile and at 77 K in a rigid matrix of butyronitrile) of the trinuclear metal complexes have been studied. For the sake of completeness, the mononuclear compounds [(bpy)(2)Ru(bpy-TTF(1))](PF(6))(2) (7) and [(bpy)(2)Ru(bpy-TTF(2))](PF(6))(2) (8) were also synthesized and studied. The properties of the tetrathiafulvalene-containing species were compared to those of the model compounds [Ru(bpy)(2)(4,4'-Mebpy)](2+) (4,4'-Mebpy=4,4'-dimethyl-2,2'-bipyridine) and [[(bpy)(2)Ru(micro-2,3-dpp)](2)Ru(bpy)](6+). The absorption spectra and redox behavior of all the new metal compounds can be interpreted by a multicomponent approach, in which specific absorption features and redox processes can be assigned to specific subunits of the structures. The luminescence properties of the complexes in rigid matrices at 77 K are very similar to those of the corresponding model compounds without TTF moieties, whereas the new species are nonluminescent, or exhibit very weak emissions relative to those of the model compounds in fluid solution at room temperature. Time-resolved transient absorption spectroscopy confirmed that the potentially luminescent MLCT states of 7-10 are significantly shorter lived than the corresponding states of the model species. Photoinduced electron-transfer processes from the TTF moieties to the (excited) MLCT chromophore(s) are held responsible for the quenching processes.     

Architecture of supramolecular metal complexes for photocatalytic CO2 reduction: ruthenium-rhenium bi- and tetranuclear complexes

We study the electrochemical, spectroscopic, and photocatalytic properties of a series of Ru(II)-Re(I) binuclear complexes linked by bridging ligands 1,3-bis(4'-methyl-[2,2']bipyridinyl-4-yl)propan-2-ol (bpyC3bpy) and 4-methyl-4'-[1,10]phenanthroline-[5,6-d]imidazol-2-yl)bipyridine (mfibpy) and a tetranuclear complex in which three [Re(CO)3Cl] moieties are coordinated to the central Ru using the bpyC3bpy ligands. In the bpyC3bpy binuclear complexes, 4,4'-dimethyl-2,2'-bipyridine (dmb) and 4,4'-bis(trifluoromethyl)-2,2'-bipyridine ({CF3}2bpy), as well as 2,2'-bipyridine (bpy), were used as peripheral ligands on the Ru moiety. Greatly improved photocatalytic activities were obtained only in the cases of [Ru{bpyC3bpyRe(CO)3Cl}3]2+ (RuRe3) and the binuclear complex [(dmb)2Ru(bpyC3bpy)Re(CO)3Cl]2+ (d2Ru-Re), while photocatalytic responses were extended further into the visible region. The excited state of ruthenium in all Ru-Re complexes was efficiently quenched by 1-benzyl-1,4-dihydronicotinamide (BNAH). Following reductive quenching in the case of d2Ru-Re, generation of the one-electron-reduced (OER) species, for which the added electron resides on the Ru-bound bpy end of the bridging ligand bpyC3bpy, was confirmed by transient absorption spectroscopy. The reduced Re moiety was produced via a relatively slow intramolecular electron transfer, from the reduced Ru-bound bpy to the Re site, occurring at an exchange rate (DeltaG approximately 0). Electron transfer need not be rapid, since the rate-determining process is reduction of CO2 with the OER species of the Re site. Comparison of these results with those for other bimetallic systems gives us more general architectural pointers for constructing supramolecular photocatalysts for CO2 reduction.     

Syntheses and crystal structures of dinuclear complexes containing d-block and f-block luminophores. Sensitization of NIR luminescence from Yb(III), Nd(III), and Er(III) centers by energy transfer from Re(I)- and Pt(II)-bipyrimidine metal centers

Mononuclear complexes [Re(bpym)(CO)(3)Cl] and [Pt(bpym)(CC-C(6)H(4)CF(3))(2)] (bpym = 2,2'-bipyrimidine), in which one of the bipyrimidine sites is vacant, have been used as "complex ligands" to prepare heterodinuclear d-f complexes in which a lanthanide tris(1,3-diketonate) unit is attached to the secondary bipyrimidine site to evaluate the ability of d-block chromophores to act as antennae for causing sensitized near-infrared (NIR) luminescence from adjacent lanthanide(III) centers. The two sets of complexes so prepared are [Re(CO)(3)Cl(mu-bpym)Ln(fod)(3)] (abbreviated as Re-Ln; where Ln = Yb, Nd, Er) and [(F(3)C-C(6)H(4)-CC)(2)Pt(mu-bpym)Ln(hfac)(3)] (abbreviated as Pt-Ln; where Ln = Nd, Gd). Members of both series have been structurally characterized; the metal-metal separation across the bipyrimidine bridge is approximately 6.3 A in each case. In these complexes, the (3)MLCT (MLCT = metal to ligand charge-transfer) luminescences of the mononuclear [Re(bpym)(CO)(3)Cl] and [Pt(bpym)(CC-C(6)H(4)CF(3))(2)] complexes are quenched by energy transfer to those lanthanides (Ln = Yb, Nd, Er) that have low-lying f-f states capable of NIR luminescence; as a result, sensitized NIR luminescence is seen from the lanthanide center following excitation of the d-block unit. In the solid state, quenching of the luminescence from the d-block chromophore is complete, indicating efficient d --> f energy transfer, as a result of the short metal-metal separation across the bipyrimidine bridge. In a CH(2)Cl(2) solution, partial dissociation of the dinuclear complexes into the mononuclear units occurs, with the result that some (3)MLCT luminescence is observed from mononuclear [Re(bpym)(CO)(3)Cl] or [Pt(bpym)(CC-C(6)H(4)CF(3))(2)] present in the equilibrium mixture. Solution UV-vis and luminescence titrations, carried out by the addition of portions of Ln(fod)(3)(H(2)O)(2) or Ln(hfac)(3)(H(2)O)(2) to the d-block complex ligands, indicate that binding of the lanthanide tris(1,3-diketonate) unit at the secondary bipyrimidine site to give the d-f dinuclear complexes occurs with an association constant of ca. 10(5) M(-)(1).     

Rhenium(IV) compounds inducing apoptosis in cancer cells

The anticancer properties of a series of mononuclear Re(IV) compounds of formula ReCl(4)L (where L is bpy = 2,2'-bipyridine; bpym = 2,2'-bipyrimidine; dmbpy = 4,4'-dimethyl-2,2'-bipyridine; phen = 1,10-phenanthroline) were investigated for the first time. All compounds displayed potent in vitro antiproliferative activity against selected cancer cells.     

Mechanistic investigation of CO2 hydrogenation by Ru(II) and Ir(III) aqua complexes under acidic conditions: two catalytic systems differing in the nature of the rate determining step

Ruthenium aqua complexes [(eta(6)-C(6)Me(6))Ru(II)(L)(OH(2))](2+) {L = bpy (1) and 4,4'-OMe-bpy (2), bpy = 2,2'-bipyridine, 4,4'-OMe-bpy = 4,4'-dimethoxy-2,2'-bipyridine} and iridium aqua complexes [Cp*Ir(III)(L)(OH(2))](2+) {Cp* = eta(5)-C(5)Me(5), L = bpy (5) and 4,4'-OMe-bpy (6)} act as catalysts for hydrogenation of CO(2) into HCOOH at pH 3.0 in H(2)O. The active hydride catalysts cannot be observed in the hydrogenation of CO(2) with the ruthenium complexes, whereas the active hydride catalysts, [Cp*Ir(III)(L)(H)](+) {L = bpy (7) and 4,4'-OMe-bpy (8)}, have successfully been isolated after the hydrogenation of CO(2) with the iridium complexes. The key to the success of the isolation of the active hydride catalysts is the change in the rate-determining step in the catalytic hydrogenation of CO(2) from the formation of the active hydride catalysts, [(eta(6)-C(6)Me(6))Ru(II)(L)(H)](+), to the reactions of [Cp*Ir(III)(L)(H)](+) with CO(2), as indicated by the kinetic studies.