Pseudouridines in rRNA helix 69 play a role in loop stacking interactions

The (1)H NMR spectra of RNAs representing E. coli 23S rRNA helix 69 with [1,3-(15)N]pseudouridine modification at specific sites reveal unique roles for pseudouridine in stabilizing base-stacking interactions in the hairpin loop region.     

Synthesis of 15N-enriched pseudouridine derivatives

[reaction: see text]. A procedure for the chemical synthesis of [3-15N]-labeled pseudouridine and a methylated derivative was developed. A suitably protected pseudouridine precursor was nitrated at N3 followed by treatment with 15NH4Cl to afford the 15N-labeled product in six steps with a 20% yield. This methodology will allow for the production of RNAs with [3-15N]pseudouridine and [3-15N-methyl]pseudouridine at specific locations.     

Synthesis and hybridization properties of 2'-O-methylated oligoribonucleotides incorporating 2'-O-naphthyluridines

2'-O-(1-Naphthyl)uridine and 2'-O-(2-naphthyl)uridine were synthesized by a microwave-mediated reaction of 2,2'-anhydrouridine with naphthols. Using the 3'-phosphoramidite building blocks, these 2'-O-aryluridine derivatives were incorporated into 2'-O-methylated oligoribonucleotides. Incorporation of five 2'-O-(2-naphthyl)uridines into a 2'-O-methylated RNA sense strand significantly increased the thermostability of the duplex with a 2'-O-methylated RNA antisense strand. Circular dichroism spectroscopy and molecular dynamic simulation of the duplexes formed between the modified RNAs and 2'-O-methyl RNAs suggested that there are π-π interactions between two neighboring naphthyl groups in a sequence of the five consecutively modified nucleosides.     

A general method for the synthesis of 2'-O-cyanoethylated oligoribonucleotides having promising hybridization affinity for DNA and RNA and enhanced nuclease resistance

[reaction: see text] An effective method for the synthesis of 2'-O-cyanoethylated oligoribonucleotides as a new class of 2'-O-modified RNAs was developed. The reaction of appropriately protected ribonucleoside derivatives with acrylonitrile in t-BuOH in the presence of Cs2CO3 gave 2'-O-cyanoethylated ribonucleoside derivatives in excellent yields, which were converted by a successive selective deprotection/protection strategy to 2'-O-cyanoethylated 5'-O-dimethoxytritylribonucleoside 3'-phosphoramidite derivatives in high yields. Fully 2'-O-cyanoethylated oligoribonucleotides, (Uce)12 and (GceAceCceUce)3, were successfully synthesized in the phosphoramidite approach by use of the phosphoramidite building blocks. It was also found that oligoribonucleotides having a 2'-O-cyanoethylated ribonucleoside (Uce, Cce, Ace, or Gce) could be obtained by the selective removal of the TBDMS group from fully protected oligoribonucleotide intermediates without loss of the cyanoethyl group by use of NEt3 x 3HF as a desilylating reagent. The detailed T(m) experiments revealed that oligoribonucleotides containing 2'-O-cyanoethylated ribonucleosides have higher hybridization affinity for both DNA and RNA than the corresponding unmodified and 2'-O-methylated oligoribonucleotides. In addition, introduction of a cyanoethyl group into the 2'-position of RNA resulted in significant increase of nuclease resistance toward snake venom and bovine spleen phosphodiesterases compared with that of the methyl group.     

Formation of a Ligand‐Assisted Complex of Two RNA Hairpin Loops

The hairpin structure is one of the most common secondary structures in RNA and holds a central position in the stream of RNA folding from a non‐structured RNA to structurally complex and functional ribonucleoproteins. Since the RNA secondary structure is strongly correlated to the function and can be modulated by the binding of small molecules, we have investigated the modulation of RNA folding by a ligand‐assisted formation of loop–loop complexes of two RNA hairpin loops. With a ligand (NCT6), designed based on the ligand binding to the G–G mismatches in double‐stranded DNA, we successfully demonstrated the formation of both inter‐ and intra‐molecular NCT6‐assisted complex of two RNA hairpin loops. NCT6 selectively bound to the two hairpin loops containing (CGG)₃ in the loop region. Native polyacrylamide gel electrophoresis analysis of two doubly‐labeled RNA hairpin loops clearly showed the formation of intermolecular NCT6‐assisted loop–loop complex. Förster resonance energy‐transfer studies of RNA constructs containing two hairpin loops, in which each hairpin was labeled with Alexa488 and Cy3 fluorophores, showed the conformational change of the RNA constructs upon binding of NCT6. These experimental data showed that NCT6 simultaneously bound to two hairpin RNAs at the loop region, and can induce the conformational change of the RNA molecule. These data strongly support that NCT6 functions as molecular glue for two hairpin RNAs.     

Characterization of G‐Quadruplex/Hairpin Transitions of RNAs by 19F NMR Spectroscopy

2′‐O‐[(4‐Trifluoromethyl‐triazol‐1‐yl)methyl] reporter groups have been incorporated into guanosine‐rich RNA models (including a known bistable Qd/Hp RNA and two G‐rich regions of mRNA of human prion protein, PrP) and applied for the ¹⁹F NMR spectroscopic characterization of plausible G‐quadruplex/hairpin (Qd/Hp) transitions in these RNA structures. For the synthesis of the CF₃‐labeled RNAs, phosphoramidite building blocks of 2′‐O‐[(4‐CF₃‐triazol‐1‐yl)methyl] nucleosides (cytidine, adenosine, and guanosine) were prepared and used as an integral part of the standard solid‐phase RNA synthesis. The obtained ¹⁹F NMR spectra supported the usual characterization data (obtained by UV‐ and CD‐melting profiles and by ¹H NMR spectra of the imino regions) and additionally gave more detailed information on the Qd/Hp transitions. The molar fractions of the secondary structural species (Qd, Hp) upon thermal denaturation and under varying ionic conditions could be determined from the intensities and shifts of the ¹⁹F NMR signals. For a well‐behaved Qd/Hp transition, thermodynamic parameters could be extracted.     

Acid/azole complexes as highly effective promoters in the synthesis of DNA and RNA oligomers via the phosphoramidite method

The utility of various kinds of acid salts of azole derivatives as promoters for the condensation of a nucleoside phosphoramidite and a nucleoside is investigated. Among the salts, N-(phenyl)imidazolium triflate, N-(p-acetylphenyl)imidazolium triflate, N-(methyl)benzimidazolium triflate, benzimidazolium triflate, and N-(phenyl)imidazolium perchlorate have shown extremely high reactivity in a liquid phase. These reagents serve as powerful activators of deoxyribonucleoside 3'-(allyl N,N-diisopropylphosphoramidite)s or 3'-(2-cyanoethyl N,N-diisopropylphosphoramidite)s employed in the preparation of deoxyribonucleotides, and 3'-O-(tert-butyldimethylsilyl)ribonucleoside 2'-(N,N-diisopropylphosphoramidite)s or 2'-O-(tert-butyldimethylsilyl)ribonucleoside 3'-(N,N-diisopropylphosphoramidite)s used for the formation of 2'-5' and 3'-5' internucleotide linkages between ribonucleosides, respectively. The azolium salt has allowed smooth and high-yield condensation of the nucleoside phosphoramidite and a 5'-O-free nucleoside, in which equimolar amounts of the reactants and the promoter are employed in the presence of powdery molecular sieves 3A in acetonitrile. It has been shown that some azolium salts serve as excellent promoters in the solid-phase synthesis of oligodeoxyribonucleotides and oligoribonucleotides. For example, benzimidazolium triflate and N-(phenyl)imidazolium triflate can be used as effective promoters in the synthesis of an oligodeoxyribonucleotide, (5')CGACACCCAATTCTGAAAAT(3') (20mer), via a method using O-allyl/N-allyloxycarbonyl-protected deoxyribonucleoside 3'-phosphoramidites or O-(2-cyanoethyl)/N-phenoxyacetyl-protected deoxyribonucleotide 3'-phosphoramidite as building blocks, respectively, on high-cross-linked polystyrene resins. Further, N-(phenyl)imidazolium triflate is useful for the solid-phase synthesis of oligoribonucleotides, such as (5')AGCUACGUGACUACUACUUU(3') (20mer), according to an allyl/allyloxycarbonyl-protected strategy. The utility of the azolium promoter has been also demonstrated in the liquid-phase synthesis of some biologically important substances, such as cytidine-5'-monophosphono-N-acetylneuraminic acid (CMP-Neu5Ac) and adenylyl(2'-5')adenylyl(2'-5')adenosine (2-5A core).     

Synthesis of 2'-O-[2-[(N,N-dimethylamino)oxy]ethyl] modified nucleosides and oligonucleotides.

A versatile synthetic route has been developed for the synthesis of 2'-O-[2-[(N,N-dimethylamino)oxy]ethyl] (abbreviated as 2'-O-DMAOE) modified purine and pyrimidine nucleosides and their corresponding nucleoside phosphoramidites and solid supports. To synthesize 2'-O-DMAOE purine nucleosides, the key intermediate B (Scheme 1) was obtained from the 2'-O-allyl purine nucleosides (13a and 15) via oxidative cleavage of the carbon-carbon bond to the corresponding aldehydes followed by reduction. To synthesize pyrimidine nucleosides, opening the 2,2'-anhydro-5-methyluridine 5 with the borate ester of ethylene glycol gave the key intermediate B. The 2'-O-(2-hydroxyethyl) nucleosides were converted, in excellent yield, by a regioselective Mitsunobu reaction, to the corresponding 2'-O-[2-[(1,3-dihydro-1,3-dioxo-2H-isoindol-2-yl)oxy]ethyl] nucleosides (18, 19, and 20). These compounds were subsequently deprotected and converted into the 2'-O-[2-[(methyleneamino)oxy]ethyl] derivatives (22, 23, and 24). Reduction and a second reductive amination with formaldehyde yielded the corresponding 2'-O-[2-[(N,N-dimethylamino)oxy]ethyl] nucleosides (25, 26, and 27). These nucleosides were converted to their 3'-O-phosphoramidites and controlled-pore glass solid supports in excellent overall yield. Using these monomers, modified oligonucleotides containing pyrimidine and purine bases were synthesized with phosphodiester, phosphorothioate, and both linkages (phosphorothioate and phosphodiester) present in the same oligonucleotide as a chimera in high yields. The oligonucleotides were characterized by HPLC, capillary gel electrophoresis, and ESMS. The effect of this modification on the affinity of the oligonucleotides for complementary RNA and on nuclease stability was evaluated. The 2'-O-DMAOE modification enhanced the binding affinity of the oligonucleotides for the complementary RNA (and not for DNA). The modified oligonucleotides that possessed the phosphodiester backbone demonstrated excellent resistance to nuclease with t(1/2) > 24 h.     

Probing RNA hairpins with cobalt(III)hexammine and electrospray ionization mass spectrometry

In this work, electrospray ionization mass spectrometry (ESI MS) was employed to study the interactions of cobalt(III) hexammine, Co(NH3)6(3+), with five RNA hairpins representing the 790 loop of 16S ribosomal RNA and 1920 loop of 23S ribosomal RNA. The RNAs varied in mismatch identity (G.U versus A.C) and level of base modification (pseudouridine versus uridine). Co(NH3)6(3+) binding was observed with the four RNA hairpins that contained a G.U wobble pair in the stem region. ESI MS revealed 1:1 and 1:2 complex formation with all RNAs. Weaker binding was observed with the fifth RNA hairpin that contained an A.C wobble pair in the stem region. The effects of pH on Co(NH3)6(3+) binding were also examined.     

Probing conformational states of modified helix 69 in 50S ribosomes

The movement of the small ribosomal subunit (30S) relative to the large ribosomal subunit (50S) during translation is widely known, but many molecular details and roles of rRNA and proteins in this process are still undefined, especially in solution models. The functional relationship of modified nucleotides to ribosome activity is one such enigma. To better understand ribosome dynamics and the influence of modified nucleotides on such processes, the focus of this work was helix 69 of 23S rRNA, which contains three pseudouridine residues in its loop region. Ribosome probing experiments with dimethylsulfate revealed that specific base accessibilities and individual nucleotide conformations in helix 69 are influenced differently by pH, temperature, magnesium, and the presence of pseudouridine modifications.     

Chemo‐Enzymatic Synthesis of Position‐Specifically Modified RNA for Biophysical Studies including Light Control and NMR Spectroscopy

The investigation of non‐coding RNAs requires RNAs containing modifications at every possible position within the oligonucleotide. Here, we present the chemo‐enzymatic RNA synthesis containing photoactivatable or ¹³C,¹⁵N‐labelled nucleosides. All four ribonucleotides containing ortho‐nitrophenylethyl (NPE) photocages, photoswitchable azobenzene C‐nucleotides and ¹³C,¹⁵N‐labelled nucleotides were incorporated position‐specifically in high yields. We applied this approach for the synthesis of light‐inducible 2′dG‐sensing riboswitch variants and detected ligand‐induced structural reorganization upon irradiation by NMR spectroscopy. This chemo‐enzymatic method opens the possibility to incorporate a wide range of modifications at any desired position of RNAs of any lengths beyond the limits of solid‐phase synthesis.     

Synthesis and biophysical characterization of tRNA(Lys,3) anticodon stem-loop RNAs containing the mcm(5)s(2)U nucleoside

[reaction: see text] Phosphoramidite reagents of the naturally occurring modified nucleosides mcm(5)s(2)U and mcm(5)U were synthesized and along with pseudouridine were incorporated into 17-nucleotide lysine tRNA anticodon stem-loop domains. Standard RNA phosphoramidite coupling chemistry allowed us to systematically investigate the thermodynamic effects of nucleoside modification and to correlate thermodynamic trends with qualitative structure effects seen by NMR spectroscopy.     

Versatile strategy for oligonucleotide derivatization. Introduction of lanthanide(III) chelates to oligonucleotides

[reaction: see text] Novel nucleosidic phosphoramidite blocks were synthesized by a Mitsunobu reaction between 2'-deoxy-5'-O-(4,4'-dimethoxytrityl)uridine and a primary alcohol containing a conjugate group in its structure (a protected functional group, an organic dye, or a precursor of a lanthanide(III) chelate) followed by phosphitylation. They were used in machine-assisted DNA synthesis in the standard manner. A slightly modified deprotection procedure was used for the preparation of oligonucleotide conjugates tethered to lanthanide(III) chelates. For the latter application one non-nucleosidic block was also synthesized.     

Synthesis of a protected ribonucleoside phosphoramidite-linked spin label via an alkynyl chain at the 5′ position of uridine

New, spin-labeled nucleosides, and an efficient synthetic route for a modified uridine amidite, were developed. The spin-labeled part was the 2,2,6,6-tetramethylpiperidine-1-oxyl (TEMPO) group, which was linked via an alkynyl chain at the 5 position of uridine. Three typical protecting groups, the t-butyldimethylsilyl (TBDMS) group at 2′, the dimethoxytrityl (DMTr) group at 5′, and the phosphoramidite group at 3′, were introduced to produce an automated nucleic acid synthesizer. The TEMPO group at the 5 position in the uridine structure affected introduction of bulky protecting groups, such as the DMTr group at the 5′ position and the TBDMS group at the 2′ position. The electron paramagnetic resonance (EPR) data revealed a nitroxyl radical in the structure of synthetic nucleoside compounds; however, RNA produced by automated synthesis using a TEMPO-linked uridine phosphoramidite building block was EPR silent.     

Streamlined process for the chemical synthesis of RNA using 2'-O-thionocarbamate-protected nucleoside phosphoramidites in the solid phase

An improved method for the chemical synthesis of RNA was developed utilizing a streamlined method for the preparation of phosphoramidite monomers and a single-step deprotection of the resulting oligoribonucleotide product using 1,2-diamines under anhydrous conditions. The process is compatible with most standard heterobase protection and employs a 2'-O-(1,1-dioxo-1λ(6)-thiomorpholine-4-carbothioate) as a unique 2'-hydroxyl protective group. Using this approach, it was demonstrated that the chemical synthesis of RNA can be as simple and robust as the chemical synthesis of DNA.     

Restricting the conformational heterogeneity of RNA by specific incorporation of 8-bromoguanosine

In an effort to reduce the conformational heterogeneity of RNA, the modified nucleobase 8-bromoguanosine (8BrG) was introduced into oligonucleotides having the hairpin tetraloop motif YNMG (Y = U or C and M = C or A). Purine nucleobases with bromine at position eight are known to preferentially adopt the syn conformation as nucleosides. The hairpin tetraloop motif YNMG was chosen as a model system because it has a syn guanosine at position four of the loop that is essential for thermodynamic stability. Thermodynamic and structural characterization of modified oligonucleotides with the hairpin sequences UUCG, CGCG, and CGAG by UV-melting and NMR spectroscopy revealed that 8BrG substitution has a small effect upon the hairpin conformation, while the duplex conformation is strongly destabilized (DeltaDeltaG degrees 37 approximately +4.7 kcal mol-1), thus inhibiting dimerization. These results support a model in which 8BrG substitution shifts the hairpin-duplex equilibrium constant toward the hairpin conformation by destabilizing the duplex. This methodology should be useful for limiting conformational heterogeneity in large RNAs, with potential applications in structural biology and enzymology.     

Assessment of 4-nitrogenated benzyloxymethyl groups for 2'-hydroxyl protection in solid-phase RNA synthesis

The search for a 2'-OH protecting group that would impart ribonucleoside phosphoramidites with coupling kinetics and coupling efficiencies comparable to those of deoxyribonucleoside phosphoramidites led to an assessment of 2'-O-(4-nitrogenated benzyloxy)methyl groups through solid-phase RNA synthesis using phosphoramidites 2a-d, 12a, and 14a. These phosphoramidites exhibited rapid and efficient coupling properties. Particularly noteworthy is the cleavage of the 2'-O-[4-(N-methylamino)benzyloxy]methyl groups in 0.1 M AcOH, which led to U19dT within 15 min at 90 degrees C. [reaction: see text]