共查询到20条相似文献,搜索用时 531 毫秒
1.
Deubel DV 《Journal of the American Chemical Society》2006,128(5):1654-1663
The mechanism of the formation of dinuclear platinum(II) mu-hydroxo complexes from cisplatin hydrolysis products, their interconversion, decomposition, and reactions with biomolecules has been explored using a combined DFT/CDM approach. All activation barriers for the formation of [cis-{Pt(NH(3))(2)(X)}-(mu-OH)-cis-{Pt(NH(3))(2)(Y)}](n)()(+) (X, Y = Cl, OH(2), OH) via nucleophilic attack of a hydroxo complex on an aqua complex are lower than the activation barriers for cisplatin hydrolysis. Considering therapeutic Pt(II) concentrations in tumors, however, only the reaction between two molecules of cis-[Pt(NH(3))(2)(OH(2))(OH)](+) (E) yielding [cis-{Pt(NH(3))(2)(OH(2))}-(mu-OH)-cis-{Pt(NH(3))(2)(OH)}](2+) (5) remains kinetically superior to cisplatin hydrolysis. 5 is strongly stabilized by intramolecular hydrogen bonding between the terminal aqua and hydroxo ligands, resulting in an unusually high pK(a) of 5 and a low pK(a) of its conjugate acid. Unimolecular cyclization of 5 yields the dimers [cis-{Pt(NH(3))(2)}(mu-OH)](2)(2+) (7a with antiperiplanar OH groups and 7b with synperiplanar OH groups). The electronic structure of several diplatinum(II) complexes has been analyzed to clarify whether there are metal-metal interactions. The overall reactivity to guanine (Gua) and dimethyl sulfide (Met, representing the thioether functional group of methionine) increases in the order 5 < 7a approximately 7b < mononuclear complexes, whereas the kinetic selectivity to Gua relative to Met increases in the order 7a approximately 5 < 7b approximately monocationic mononuclear complexes < dicationic mononuclear complex. The results of this work (i) help assess whether dinuclear metabolites play a role in cisplatin chemotherapy, (ii) elucidate the toxicity and pharmacological inactivity of [cis-{Pt(NH(3))(2)}(mu-OH)](2)(2+), and (iii) suggest future investigations of dinuclear anticancer complexes that contain one mu-hydroxo ligand. 相似文献
2.
Choi S Vastag L Larrabee YC Personick ML Schaberg KB Fowler BJ Sandwick RK Rawji G 《Inorganic chemistry》2008,47(4):1352-1360
Guanosine derivatives with a nucleophilic group at the 5' position (G-5') are oxidized by the Pt (IV) complex Pt( d, l)(1,2-(NH 2) 2C 6H 10)Cl 4 ([Pt (IV)(dach)Cl 4]). The overall redox reaction is autocatalytic, consisting of the Pt (II)-catalyzed Pt (IV) substitution and two-electron transfer between Pt (IV) and the bound G-5'. In this paper, we extend the study to improve understanding of the redox reaction, particularly the substitution step. The [Pt (II)(NH 3) 2(CBDCA-O,O')] (CBDCA = cyclobutane-1,1-dicarboxylate) complex effectively accelerates the reactions of [Pt (IV)(dach)Cl 4] with 5'-dGMP and with cGMP, indicating that the Pt (II) complex does not need to be a Pt (IV) analogue to accelerate the substitution. Liquid chromatography/mass spectroscopy (LC/MS) analysis showed that the [Pt (IV)(dach)Cl 4]/[Pt (II)(NH 3) 2(CBDCA-O,O')]/cGMP reaction mixture contained two Pt (IV)cGMP adducts, [Pt (IV)(NH 3) 2(cGMP)(Cl)(CBDCA-O,O')] and [Pt (IV)(dach)(cGMP)Cl 3]. The LC/MS studies also indicated that the trans, cis-[Pt (IV)(dach)( (37)Cl) 2( (35)Cl) 2]/[Pt (II)(en)( (35)Cl) 2]/9-EtG mixture contained two Pt (IV)-9-EtG adducts, [Pt (IV)(en)(9-EtG)( (37)Cl)( (35)Cl) 2] and [Pt (IV)(dach)(9-EtG)( (37)Cl)( (35)Cl) 2]. These Pt (IV)G products are predicted by the Basolo-Pearson (BP) Pt (II)-catalyzed Pt (IV)-substitution scheme. The substitution can be envisioned as an oxidative addition reaction of the planar Pt (II) complex where the entering ligand G and the chloro ligand from the axial position of the Pt (IV) complex are added to Pt (II) in the axial positions. From the point of view of reactant Pt (IV), an axial chloro ligand is thought to be substituted by the entering ligand G. The Pt (IV) complexes without halo axial ligands such as trans, cis-[Pt(en)(OH) 2Cl 2], trans, cis-[Pt(en)(OCOCF 3) 2Cl 2], and cis, trans, cis-[Pt(NH 3)(C 6H 11NH 2)(OCOCH 3) 2Cl 2] ([Pt (IV)(a,cha)(OCOCH 3) 2Cl 2], satraplatin) did not react with 5'-dGMP. The bromo complex, [Pt (IV)(en)Br 4], showed a significantly faster substitution rate than the chloro complexes, [Pt (IV)(en)Cl 4] and [Pt (IV)(dach)Cl 4]. The results indicate that the axial halo ligands are essential for substitution and the Pt (IV) complexes with larger axial halo ligands have faster rates. When the Pt (IV) complexes with different carrier ligands were compared, the substitution rates increased in the order [Pt (IV)(dach)Cl 4] < [Pt (IV)(en)Cl 4] < [Pt (IV)(NH 3) 2Cl 4], which is in reverse order to the carrier ligand size. These axial and carrier ligand effects on the substitution rates are consistent with the BP mechanism. Larger axial halo ligands can form a better bridging ligand, which facilitates the electron-transfer process from the Pt (II) to Pt (IV) center. Smaller carrier ligands exert less steric hindrance for the bridge formation. 相似文献
3.
Holmes RJ O'Hair RA McFadyen WD 《Rapid communications in mass spectrometry : RCM》2000,14(24):2385-2392
The competition between pyridine ligand loss in square planar Pt(II) complexes has been examined using the doubly and singly charged ions of complexes consisting of platinum(ethylenediamine) coordinated to two different substituted pyridines. Collision induced dissociation (CID) of [Pt(en)Py(1)Py(2)](2+) (where Py(1) = one of ten different substituted pyridines and Py(2) = pyridine) results in loss of the protonated pyridines to yield the singly charged platinum ions [Pt(en)Py(1)-H](+) and [Pt(en)Py(2)-H](+). In contrast, fragmentation of [Pt(en)Py(1)Py(2)-H](+) results in neutral pyridine loss to yield the ions [Pt(en)Py(1)-H](+) and [Pt(en)Py(2)-H](+). In the latter case, the correlation between relative losses of each pyridine compared to their gas-phase proton affinities is poor. A novel chloride ion abstraction reaction occurs for the fragmentation of [Pt(en)Py(1)Py(2)](2+) when Py(1) = o-C(5)H(4)CIN and Py(2) = C(5)H(5)N, to yield the [Pt(en)(Cl)Py(2)](+) and [o-C(5)H(4)N](+) pair of ions. In order to model this process the competition between nitrogen and chlorine binding in [Pt(NH(3))(3)(o-NC(5)H(4)Cl)](2+) has been examined using density functional theory (DFT) calculations at the B3LYP/LANL2DZ level of theory. Both adducts are minima with the N adduct being more stable than the Cl adduct by 22.7 kcal mol(-1). Furthermore, the Cl adduct exhibits a significant stretching of the C-Cl bond (to 1.935 A), consistent with the observed chloride ion abstraction reaction, which is endothermic by 9.0 kcal mol(-1) (relative to the N adduct). 相似文献
4.
The ability of cis-[Pt(NH(3))(2)(L)](2+/+), a molecular fragment of the anticancer drug cisplatin, to bind to purines and CO by pi-back-donation from Pt to the ligand was examined computationally. Optimized geometries and computed vibrational frequencies suggest that cis-[Pt(NH(3))(2)(L)](2+/+) (L = Cl, H(2)O, NH(3)) is a poor pi-donor and that pi-back-donation does not play an important role for Pt(II)-ligand interactions in general. 相似文献
5.
Kampf G Sanz Miguel PJ Morell Cerdà M Willermann M Schneider A Lippert B 《Chemistry (Weinheim an der Bergstrasse, Germany)》2008,14(23):6882-6891
The reaction of a potential mono(nucleobase) model adduct of cisplatin, cis-[Pt(NH(3))(2)(1-MeC-N3)(H(2)O)](2+) (6; 1-MeC: 1-methylcytosine), with the electrophile [Pd(en)(H(2)O)(2)](2+) (en: ethylenediamine) at pH approximately 6 yields a kinetic product X which is likely to be a dinuclear Pt,Pd complex containing 1-MeC(-)-N3,N4 and OH bridges, namely cis-[Pt(NH(3))(2)(1-MeC(-)-N3,N4)(OH)Pd(en)](2+). Upon addition of excess Ag(+) ions, conversion takes place to form a thermodynamic product, which, according to (1)H NMR spectroscopy and X-ray crystallography, is dominated by a mu-NH(2) bridge between the Pt(II) and Pd(II) centers. X-ray crystallography reveals that the compound crystallizes out of solution as a dodecanuclear complex containing four Pt(II), four Pd(II), and four Ag(+) entities: [{Pt(2)(1-MeC(-)-N3,N4)(2)(NH(3))(2)(NH(2))(2)(OH)Pd(2)(en)(2)Ag}(2){Ag(H(2)O)}(2)](NO(3))(10) 6 H(2)O (10) is composed of a roughly planar array of the 12 metal ions, in which the metal ions are interconnected by mu-NH(2) groups (between Pt and Pd centers), mu-OH groups (between pairs of Pt atoms), and metal-metal donor bonds (Pt-->Ag, Pd-->Ag). The four 1-methylcytosinato ligands, which are stacked pairwise, as well as the four NH(3) ligands and parts of the en rings, are approximately perpendicular to the metal plane. Two of the four Ag ions (Ag2, Ag2') of 10 are labile in solution and show the expected behavior of Ag(+) ions in water, that is, they are readily precipitated as AgCl by Cl(-) ions. The resulting pentanuclear complex [Pt(2)Pd(2)Ag(1-MeC(-))(2)(NH(2))(2)(OH)(NH(3))(2)(en)(2)](NO(3))(4)7 H(2)O (11) largely maintains the structural features of one half of 10. The other two Ag(+) ions (Ag1, Ag1') of 10 are remarkably unreactive toward excess NaCl. In fact, the pentanuclear complex [Pt(2)Pd(2)AgCl(1-MeC(-))(2)(NH(2))(2)(OH)(NH(3))(2)(en)(2)](NO(3))(3)4.5 H(2)O (12), obtained from 10 with excess NaCl, displays a Cl(-) anion bound to the Ag center (2.459(3) A) and is thus a rare case of a crystallized "AgCl molecule". 相似文献
6.
The formation of adducts between cis-[Pt(NH(3))(2)Cl(2)], Zn(II), and Mn(II) and double-stranded oligodeoxynucleotides was studied by 1D and 2D (1)H, (31)P, and (15)N NMR spectroscopy. For labile adducts involving Zn(II) and Mn(II), both (1)H chemical shifts (Zn(II)) and (1)H line-broadening effects (Mn(II)) showed that in the hexamer [d(GGCGCC)](2) I, the terminal G(1)-N7 is the exclusive binding site, while for the dodecamer [d(GGTACCGGTACC)](2) II, which contains both a terminal and internal GG pair, the preference for metal binding is the internal guanine G(7). Zn(II) binding to II was confirmed by natural-abundance 2D [(1)H,(15)N] HMBC NMR spectroscopy, which unambiguously showed that G(7)-N7 is the preferred binding site. The long duplex [d(GGTATATATACCGGTATATATACC)](2) III was expected to have a more pronounced accumulation of electrostatic potential towards the central part of the sequence (vs the terminal part) than does II. However, the Zn(II) titration of III showed no increase in coordination with the internal Gs (vs the terminal Gs), compared with what was observed for II. The reaction between the nonlabile metal complex cis-[PtCl(2)((15)NH(3))(2)] (cisplatin) and II showed a slight preference for the internal GG pair over the terminal GG pair. However, when the diaqua form of cisplatin cis-[Pt((15)NH(3))(2)(H(2)O)(2)] was reacted with II a more pronounced binding preference for the internal GG pair was observed. 相似文献
7.
Soldatović T Jovanović S Bugarčić ŽD van Eldik R 《Dalton transactions (Cambridge, England : 2003)》2012,41(3):876-884
The novel dinuclear Pt(II) complexes [{trans-Pt(NH(3))(2)Cl}(2)(μ-pyrazine)](ClO(4))(2) (Pt1), [{trans-Pt(NH(3))(2)Cl}(2)(μ-4,4'-bipyridyl)](ClO(4))(2)·DMF (Pt2), and [{trans-Pt(NH(3))(2)Cl}(2)(μ-1,2-bis(4-pyridyl)ethane)](ClO(4))(2) (Pt3), were synthesized. Acid-base titrations, and temperature and concentration dependent kinetic measurements of the reactions with biologically relevant ligands such as thiourea (Tu), glutathione (GSH) and guanosine-5'-monophosphate (5'-GMP) were studied at pH 2.5 and 7.2. The reactions were followed under pseudo-first-order conditions by stopped-flow and UV-vis spectrophotometry. (1)H NMR spectroscopy was used to follow the substitution of chloride in the complex [{trans-Pt(NH(3))(2)Cl}(2)(μ-4,4'-bipyridyl)](ClO(4))(2)·DMF by guanosine-5'-monophosphate (5'-GMP) under second-order conditions. The results indicate that the bridging ligand has an influence on the reactivity of the complexes towards nucleophiles. The order of reactivity of the investigated complexes is Pt1 > Pt2 > Pt3. 相似文献
8.
Deubel DV 《Journal of the American Chemical Society》2004,126(19):5999-6004
The kinetic competition of sulfur and nitrogen nucleophiles L in the substitution reactions of cisplatin derivatives, cis-[Pt(II)(NH(3))(2)(X)(OH(2))](n)(+) + L --> cis-[Pt(II)(NH(3))(2)(X)(L)](m)(+) + H(2)O (X = Cl(-), H(2)O), has been studied using density functional theory and continuum dielectric calculations. The calculations reveal an intrinsic kinetic preference of platinum(II) for nitrogen over sulfur ligands. However, biologically relevant substituents can mask this preference for nitrogen nucleophiles. Investigation of the activation free energies of the substitution reactions in dependence of the dielectric constant epsilon demonstrates the microenvironment to be crucial in the binding of cisplatin to its intracellular targets. The fused aromatic heterocycle of guanine stabilizes the transition state for platination at a smaller epsilon more efficiently than do the functional groups of amino acid residues. The results of this work suggest a relatively facile platination of guanine-N7 sites of DNA in regions of low epsilon, particularly in the proximity of histone cores. 相似文献
9.
The reaction of 9,10-phenanthrenequinone (PQ) with [M(II)(H)(CO)(X)(PPh(3))(3)] in boiling toluene leads to the homolytic cleavage of the M(II)-H bond, affording the paramagnetic trans-[M(PQ)(PPh(3))(2)(CO)X] (M = Ru, X = Cl, 1; M = Os, X = Br, 3) and cis-[M(PQ)(PPh(3))(2)(CO)X] (M = Ru, X = Cl, 2; M = Os, X = Br, 4) complexes. Single-crystal X-ray structure determinations of 1, 2·toluene, and 4·CH(2)Cl(2), EPR spectra, and density functional theory (DFT) calculations have substantiated that 1-4 are 9,10-phenanthrenesemiquinone radical (PQ(?-)) complexes of ruthenium(II) and osmium(II) and are defined as trans-[Ru(II)(PQ(?-))(PPh(3))(2)(CO)Cl] (1), cis-[Ru(II)(PQ(?-))(PPh(3))(2)(CO)Cl] (2), trans-[Os(II)(PQ(?-))(PPh(3))(2)(CO) Br] (3), and cis-[Os(II)(PQ(?-))(PPh(3))(2)(CO)Br] (4). Two comparatively longer C-O [average lengths: 1, 1.291(3) ?; 2·toluene, 1.281(5) ?; 4·CH(2)Cl(2), 1.300(8) ?] and shorter C-C lengths [1, 1.418(5) ?; 2·toluene, 1.439(6) ?; 4·CH(2)Cl(2), 1.434(9) ?] of the OO chelates are consistent with the presence of a reduced PQ(?-) ligand in 1-4. A minor contribution of the alternate resonance form, trans- or cis-[M(I)(PQ)(PPh(3))(2)(CO)X], of 1-4 has been predicted by the anisotropic X- and Q-band electron paramagnetic resonance spectra of the frozen glasses of the complexes at 25 K and unrestricted DFT calculations on 1, trans-[Ru(PQ)(PMe(3))(2)(CO)Cl] (5), cis-[Ru(PQ)(PMe(3))(2)(CO)Cl] (6), and cis-[Os(PQ)(PMe(3))(2)(CO)Br] (7). However, no thermodynamic equilibria between [M(II)(PQ(?-))(PPh(3))(2)(CO)X] and [M(I)(PQ)(PPh(3))(2)(CO)X] tautomers have been detected. 1-4 undergo one-electron oxidation at -0.06, -0.05, 0.03, and -0.03 V versus a ferrocenium/ferrocene, Fc(+)/Fc, couple because of the formation of PQ complexes as trans-[Ru(II)(PQ)(PPh(3))(2)(CO)Cl](+) (1(+)), cis-[Ru(II)(PQ)(PPh(3))(2)(CO)Cl](+) (2(+)), trans-[Os(II)(PQ)(PPh(3))(2)(CO)Br](+) (3(+)), and cis-[Os(II)(PQ)(PPh(3))(2)(CO)Br](+) (4(+)). The trans isomers 1 and 3 also undergo one-electron reduction at -1.11 and -0.96 V, forming PQ(2-) complexes trans-[Ru(II)(PQ(2-))(PPh(3))(2)(CO)Cl](-) (1(-)) and trans-[Os(II)(PQ(2-))(PPh(3))(2)(CO)Br](-) (3(-)). Oxidation of 1 by I(2) affords diamagnetic 1(+)I(3)(-) in low yields. Bond parameters of 1(+)I(3)(-) [C-O, 1.256(3) and 1.258(3) ?; C-C, 1.482(3) ?] are consistent with ligand oxidation, yielding a coordinated PQ ligand. Origins of UV-vis/near-IR absorption features of 1-4 and the electrogenerated species have been investigated by spectroelectrochemical measurements and time-dependent DFT calculations on 5, 6, 5(+), and 5(-). 相似文献
10.
Chifotides HT Koomen JM Kang M Tichy SE Dunbar KR Russell DH 《Inorganic chemistry》2004,43(20):6177-6187
The adducts formed between the antitumor active compounds [Rh(2)(O(2)CCH(3))(2)(CH(3)CN)(6)](BF(4))(2), Rh(2)(O(2)CCH(3))(4), and Rh(2)(O(2)CCF(3))(4) with DNA oligonucleotides have been assessed by matrix-assisted laser desorption ionization (MALDI) and nanoelectrospray (nanoESI) coupled to time-of-flight mass spectrometry (TOF MS). A series of MALDI studies performed on dipurine (AA, AG, GA, and GG)-containing single-stranded oligonucleotides of different lengths (tetra- to dodecamers) led to the establishment of the relative reactivity cis-[Pt(NH(3))(2)(OH(2))(2)](2+) (activated cisplatin) approximately Rh(2)(O(2)CCF(3))(4) > cis-[Pt(NH(3))(2)Cl(2)] (cisplatin) > [Rh(2)(O(2)CCH(3))(2)(CH(3)CN)(6)](BF(4))(2) > Rh(2)(O(2)CCH(3))(4) approximately Pt(C(6)H(6)O(4))(NH(3))(2) (carboplatin). The relative reactivity of the complexes is associated with the lability of the leaving groups. The general trend is that an increase in the length of the oligonucleotide leads to enhanced reactivity for Rh(2)(O(2)CCH(3))(2)(CH(3)CN)(6)](BF(4))(2) and Rh(2)(O(2)CCH(3))(4) (except for the case of [Rh(2)(O(2)CCH(3))(2)(CH(3)CN)(6)](2+), which reacts faster with the GG octamers than with the dodecamers), whereas the reactivity of Rh(2)(O(2)CCF(3))(4) is independent of the oligonucleotide length. When monitored by ESI, the dodecamers containing GG react faster than the respectiveAA oligonucleotides in reactions with Rh(2)(O(2)CCF(3))(4) and Rh(2)(O(2)CCH(3))(2)(CH(3)CN)(6)](BF(4))(2), whereas AA oligonucleotides react faster with Rh(2)(O(2)CCH(3))(4). The mixed (AG, GA) purine sequences exhibit comparable rates of reactivity with the homopurine (AA, GG) dodecamers in reactions with Rh(2)(O(2)CCH(3))(4). The observation of initial dirhodium-DNA adducts with weak axial (ax) interactions, followed by rearrangement to more stable equatorial (eq) adducts, was achieved by electrospray ionization; the Rh-Rh bond as well as coordinated acetate or acetonitrile ligands remain intact in these dirhodium-DNA adducts. MALDI in-source decay (ISD), collision-induced dissociation (CID) MS-MS, and enzymatic digestion studies followed by MALDI and ESI MS reveal that, in the dirhodium compounds studied, the purine sites of the DNA oligonucleotides interact with the dirhodium core. Ultimately, both MALDI and ESI MS proved to be complementary, valuable tools for probing the identity and stability of dinuclear metal-DNA adducts. 相似文献
11.
The synthesis, characterization, and cytotoxicity of eight new platinum(IV) complexes having the general formula cis,cis,trans-[Pt(NH(3))(2)Cl(2)(O(2)CNHR)(2)] are reported, where R = tert-butyl (4), cyclopentyl (5), cyclohexyl (6), phenyl (7), p-tolyl (8), p-anisole (9), 4-fluorophenyl (10), or 1-naphthyl (11). These compounds were synthesized by reacting organic isocyanates with the platinum(IV) complex cis,cis,trans-[Pt(NH(3))(2)Cl(2)(OH)(2)]. The electrochemistry of the compounds was investigated by cyclic voltammetry. The aryl carbamate complexes 7-11 exhibit reduction peak potentials near -720 mV vs Ag/AgCl, whereas the alkyl carbamate complexes display reduction peak potentials between -820 and -850 mV vs Ag/AgCl. The cyclic voltammograms of cis,cis,trans-[Pt(NH(3))(2)Cl(2)(O(2)CCH(3))(2)] (1), cis,cis,trans-[Pt(NH(3))(2)Cl(2)(O(2)CCF(3))(2)] (2), and cis-[Pt(NH(3))(2)Cl(4)] (3) were measured for comparison. Density functional theory studies were undertaken to investigate the electronic structures of 1-11 and to determine their adiabatic electron affinities. A linear correlation (R(2) = 0.887) between computed adiabatic electron affinities and measured reduction peak potentials was discovered. The biological activity of 4-11 and, for comparison, cisplatin was evaluated in human lung cancer A549 and normal MRC-5 cells by the MTT assay. The compounds exhibit comparable or slightly better activity than cisplatin against the A549 cells. In MRC-5 cells, all are equally or slightly less cytotoxic than cisplatin, except for 4 and 5, which are more toxic. 相似文献
12.
Oxidation of the acetate-bridged half-lantern platinum(II) complex cis-[Pt(II)(NH(3))(2)(μ-OAc)(2)Pt(II)(NH(3))(2)](NO(3))(2), [1](NO(3))(2), with iodobenzene dichloride or bromine generates the halide-capped platinum(III) species cis-[XPt(III)(NH(3))(2)(μ-OAc)(2)Pt(III)(NH(3))(2)X](NO(3))(2), where X is Cl in [2](NO(3))(2) or Br in [3](NO(3))(2), respectively. These three complexes, characterized structurally by X-ray crystallography, feature short (≈2.6 ?) Pt-Pt separations, consistent with formation of a formal metal-metal bond upon oxidation. Elongated axial Pt-X distances occur, reflecting the strong trans influence of the metal-metal bond. The three structures are compared to those of other known dinuclear platinum complexes. A combination of (1)H, (13)C, (14)N, and (195)Pt NMR spectroscopy was used to characterize [1](2+)-[3](2+) in solution. All resonances shift downfield upon oxidation of [1](2+) to [2](2+) and [3](2+). For the platinum(III) complexes, the (14)N and (195)Pt resonances exhibit decreased line widths by comparison to those of [1](2+). Density functional theory calculations suggest that the decrease in the (14)N line width arises from a diminished electric field gradient at the (14)N nuclei in the higher valent compounds. The oxidation of [1](NO(3))(2) with the alternative oxidizing agent bis(trifluoroacetoxy)iodobenzene affords the novel tetranuclear complex cis-[(O(2)CCF(3))Pt(III)(NH(3))(2)(μ-OAc)(2)Pt(III)(NH(3))(μ-NH(2))](2)(NO(3))(4), [4](NO(3))(4), also characterized structurally by X-ray crystallography. In solution, this complex exists as a mixture of species, the identities of which are proposed. 相似文献
13.
Nieto D González-Vadillo AM Bruña S Pastor CJ Ríos-Luci C León LG Padrón JM Navarro-Ranninger C Cuadrado I 《Dalton transactions (Cambridge, England : 2003)》2012,41(2):432-441
A new family of heterometallic compounds 3-6 containing ferrocenyl and platinum(II) centers has been synthesized by reaction of 1-β-aminoethylferrocene (1) and 1,1'-bis(β-aminoethyl)ferrocene (2) with Pt(II) precursors. Using K(2)[PtCl(4)] as the Pt(II) source, the cis-square-planar neutral compounds [Fe{η(5)-C(5)H(4)(CH(2))(2)NH(2)}(2)PtCl(2)] (3) and [{Fe(η(5)-C(5)H(4)(CH(2))(2)NH(2))(η(5)-C(5)H(5))}(2)PtCl(2)] (5) were obtained. Reaction of cis-[PtCl(2)(dmso)(2)] with 1 and 2 resulted in the displacement of dmso and chloride ligands from the platinum coordination sphere, affording the cationic and neutral compounds [Fe{η(5)-C(5)H(4)(CH(2))(2)NH(2)}(2)Pt(dmso)Cl]Cl (4) and [Fe(η(5)-C(5)H(4)(CH(2))(2)NH(2))(η(5)-C(5)H(5))Pt(dmso)Cl(2)] (6). Compounds 3-6 were thoroughly characterized using multinuclear ((1)H, (13)C, (195)Pt) NMR, IR spectroscopy, ESI mass spectrometry and elemental analysis. Single-crystal X-ray analysis of heterometallic 6 confirmed the cis geometry of the molecule and revealed that the platinum atom is held in a perfect square-planar geometry. The electrochemical behaviour of the heterometallic compounds 3-6, which has been examined by cyclic (CV) and square wave (SWV) voltammetries in dichloromethane and dmso solution, is characterized by the reversible one-electron oxidation of the ferrocene moieties. The results of the biological activity studies revealed that the organometallic complex 5 is active against all cell lines with GI(50) values in the range 1.7-2.3 μM. When compared to the standard anticancer drug cisplatin, heterotrimetallic 5, possessing two aminoethylferrocenyl units coordinated to the Pt(II) center, showed a greater activity profile in the colon cancer cell line. Cell cycle studies revealed that the new mixed compound exhibits a mechanism of action different to cisplatin. 相似文献
14.
New ketonylplatinum(III) dinuclear complexes [Pt(2)((CH(3))(3)CCONH)(2)(NH(3))(4)(CH(2)COPh)](NO(3))(3) (4), [Pt(2)((CH(3))(3)CCONH)(2)(NH(3))(4)(CH(CH(3))COC(2)H(5))](NO(3))(3) (5), and [Pt(2)((CH(3))(3)CCONH)(2)(NH(3))(4)(CH(2)COCH(2)COCH(3))](NO(3))(3) (6) were prepared by treatment of platinum blue complex [Pt(4)(NH(3))(8)((CH(3))(3)CCONH)(4)](NO(3))(5) (2) with acetophenone, 3-pentanone, and acetylacetone, respectively, in the presence of concentrated HNO(3). The structures of complexes 4 and 6 have been confirmed by X-ray diffraction analysis, which revealed that the C-H bonds of the methyl groups in acetophenone and acetylacetone have been cleaved and Pt(III)-C bonds are formed. Formation of diketonylplatinum(III) complex 6 provides a novel example of the C-H bond activation not at the central alpha-C-H but at the terminal methyl of acetylacetone. Reaction with butanone having unsymmetrical alpha-H atoms led to two types of ketonylplatinum(III) complexes [Pt(2)((CH(3))(3)CCONH)(2)(NH(3))(4)(CH(CH(3))COCH(3))](NO(3))(3) (7a) and [Pt(2)((CH(3))(3)CCONH)(2)(NH(3))(4)(CH(2)COCH(2)CH(3))](NO(3))(3) (7b) at a molar ratio of 1.7 to 1 corresponding to the C-H bond activation of methylene and methyl groups, respectively. Use of 3-methyl-2-butanone instead of butanone gave complex [Pt(2)((CH(3))(3)CCONH)(2)(NH(3))(4)(CH(2)COCH(CH(3))(2))](NO(3))(3) (8) as a sole product via C-H bond activation in the alpha-methyl group. The reactivity of the ketonylplatinum(III) dinuclear complexes toward nucleophiles, such as H(2)O and HNEt(2), was examined. The alpha-hydroxyl- and alpha-amino-substituted ketones were generated in the reactions of [Pt(2)((CH(3))(3)CCONH)(2)(NH(3))(4)(CH(2)COCH(3))](NO(3))(3) (1), 5, and a mixture of 7a and 7b with water and amine, which indicates that the carbon atom in the ketonyl group bound to the Pt(III) atom can receive a nucleophilic attack. The high electrophilicity of the ketonylplatinum(III) complexes can be accounted for by the high electron-withdrawing ability of the platinum(III) atom. A competition between the radical and electrophilic displacement pathways was observed directly in the C-H bond activation reaction with butanone giving complexes 7a and 7b. Addition of a radical trapping agent suppressed the radical pathway and gave complex 7b as the predominant product. On the contrary, 7a was formed as the main product when the reaction solution was irradiated by mercury lamp light. These results together with other mechanistic studies demonstrate that complex 7a was produced via a radical process, whereas complex 7b is produced via electrophilic displacement of a proton by the Pt(III) atom. The competitive processes were further observed in the reactions of platinum blue complex 2 with a mixture of acetone and 3-pentanone in the presence of HNO(3). The relative molar ratio of acetonyl complex 1 to pentanoyl complex 5 was 3 to 1 under room light, whereas formation of complex 5 was almost suppressed when the reaction was carried out in the dark with the addition of a radical trapping agent. 相似文献
15.
Ochiai M Lin YS Yamada J Misawa H Arai S Matsumoto K 《Journal of the American Chemical Society》2004,126(8):2536-2545
Reaction of the platinum(III) dimeric complex [Pt(2)(NH(3))(4)((CH(3))(3)CCONH)(2)(NO(3))(2)](NO(3))(2) (1), prepared in situ by the oxidation of the platinum blue complex [Pt(4)(NH(3))(8)((CH(3))(3)CCONH)(4)](NO(3))(5) (2) with Na(2)S(2)O(8), with terminal alkynes CH[triple bond]CR (R = (CH(2))(n)CH(3) (n = 2-5), (CH(2))(n)CH(2)OH (n = 0-2), CH(2)OCH(3), and Ph), in water gave a series of ketonyl-Pt(III) dinuclear complexes [Pt(2)(NH(3))(4)((CH(3))(3)CCONH)(2)(CH(2)COR)](NO(3))(3) (3, R = (CH(2))(2)CH(3); 4, R = (CH(2))(3)CH(3); 5, R = (CH(2))(4)CH(3); 6, R = (CH(2))(5)CH(3); 7, R = CH(2)OH; 8, R = CH(2)CH(2)OH; 9, R = (CH(2))(2)CH(2)OH; 10, R = CH(2)OCH(3); 11, R = Ph). Internal alkyne 2-butyne reacted with 1 to form the complex [Pt(2)(NH(3))(4)((CH(3))(3)CCONH)(2)(CH(CH(3))COCH(3))](NO(3))(3) (12). These reactions show that Pt(III) reacts with alkynes to give various ketonyl complexes. Coordination of the triple bond to the Pt(III) atom at the axial position, followed by nucleophilic attack of water and hydrogen shift from the enol to keto form, would be the mechanism. The structures of complexes 3.H(2)O, 7.0.5C(3)H(4)O, 9, 10, and 12 have been confirmed by X-ray diffraction analysis. A competitive reaction between equimolar 1-pentyne and 1-pentene toward 1 produced complex 3 and [Pt(2)(NH(3))(4)((CH(3))(3)CCONH)(2)(CH(2)CH(OH)CH(2)CH(2)CH(3))](NO(3))(3) (14) at a molar ratio of 9:1, suggesting that alkyne is more reactive than alkene. The ketonyl-Pt(III) dinuclear complexes are susceptible to nucleophiles, such as amines, and the reactions with secondary and tertiary amines give the corresponding alpha-amino-substituted ketones and the reduced Pt(II) complex quantitatively. In the reactions with primary amines, the once formed alpha-amino-substituted ketones were further converted to the iminoketones and diimines. The nucleophilic attack at the ketonyl group of the Pt(III) complexes provides a convenient means for the preparation of alpha-aminoketones, alpha-iminoketones, and diimines from the corresponding alkynes and amines. 相似文献
16.
Petrović B Bugarčić Ž Dees A Ivanović-Burmazović I Heinemann FW Puchta R Steinmann SN Corminboeuf C van Eldik R 《Inorganic chemistry》2012,51(3):1516-1529
The kinetics and mechanism of substitution reactions of novel monofunctional [Pt(tpdm)Cl](+) and [Pd(tpdm)Cl](+) complexes (where tpdm = tripyridinedimethane) and their aqua analogues with thiourea (tu), L-methionine (L-met), glutathione (GSH), and guanosine-5'-monophosphate (5'-GMP) were studied in 0.1 M NaClO(4) at pH = 2.5 (in the presence of 10 mM NaCl for reactions of the chlorido complexes). The reactivity of the investigated nucleophiles follows the order tu > l-met > GSH > 5'-GMP. The reported rate constants showed the higher reactivity of the Pd(II) complexes as well as the higher reactivity of the aqua complex than the corresponding chlorido complex. The negative values reported for the activation entropy as well as the activation volume confirmed an associative substitution mode. In addition, the molecular and crystal structure of [Pt(tpdm)Cl]Cl was determined by X-ray crystallography. The compound crystallizes in a monoclinic space group C2/c with two independent molecules of the complex and unit cell dimensions of a = 38.303(2) ?, b = 9.2555(5) ?, c = 27.586(2) ?, β = 133.573(1)°, and V = 7058.3(8) ?(3). The cationic complex [Pt(tpdm)Cl](+) exhibits square-planar coordination around the Pt(II) center. The lability of the [Pt(tpdm)Cl](+) complex is orders of magnitude lower than that of [Pt(terpyridine)Cl](+). Quantum chemical calculations were performed on the [Pt(tpdm)Cl](+) and [Pt(terpyridine)Cl](+) complexes and their reactions with thiourea. Theoretical computations for the corresponding Ni(II) complexes clearly demonstrated that π-back-bonding properties of the terpyridine chelate can account for acceleration of the nucleophilic substitution process as compared to the tpdm chelate, where introduction of two methylene groups prevents such an effective π-back bonding. 相似文献
17.
One electron paramagnetic parent osazone complex of rhodium of type trans-Rh(L(NHPh)H(2))(PPh(3))(2)Cl(2) (1), defined as an osazone anion radical complex of rhodium(III), trans-Rh(III)(L(NHPh)H(2)(?-))(PPh(3))(2)Cl(2), 1((t-RhL?)), with a minor contribution (~2%) of rhodium(II) electromer, trans-Rh(II)(L(NHPh)H(2))(PPh(3))(2)Cl(2), 1((t-Rh?L)), and their nonradical congener, trans-[Rh(III)(L(NHPh)H(2))(PPh(3))(2)Cl(2)]I(3) ([t-1](+)I(3)(-)), have been isolated and are substantiated by spectra, bond parameters, and DFT calculations on equivalent soft complexes [Rh(L(NHPh)H(2))(PMe(3))(2)Cl(2)] (3) and [Rh(L(NHPh)H(2))(PMe(3))(2)Cl(2)](+) (3(+)). 1 is not stable in solution and decomposes to [t-1](+) and a new rhodium(I) osazone complex, [Rh(I)(L(NHPh)H(2))(PPh(3))Cl] (2). 1 absorbs strongly at 351 nm due to MLCT and LLCT, while [t-1](+) and 2 absorb moderately in the range of 300-450 nm, respectively, due to LMCT and MLCT elucidated by TD-DFT calculations on 3((t-RhL?)), [t-3](+), and Rh(I)(L(NHPh)H(2))(PMe(3))Cl (4). EPR spectra of solids at 295 and 77 K, and dichloromethane-toluene frozen glass at 77 K of 1 are similar with g = 1.991, while g = 2.002 for the solid at 25 K. The EPR signal of 1 in dichloromethane solution is weaker (g = 1.992). In cyclic voltammetry, 1 displays two irreversible one electron transfer waves at +0.13 and -1.22 V, with respect to Fc(+)/Fc coupling, due to oxidation of 1((t-RhL?)) to [t-1](+) at the anode and reduction of rhodium(III) to rhodium(II), i.e., [t-1](+) to electromeric 1((t-Rh?L)) at the cathode. 相似文献
18.
The oxidative addition of the salt [{SC(NMe(2))(2)}(2)]Cl(2).2H(2)O (1), the disulfide-like dimerized form of 1,1,3,3-tetramethylthiourea (tmtu), to Pt(II) chloro am(m)ine compounds is described. Oxidation of the [PtCl(3)(NH(3))](-) anion with 1 in methanol yields cis-[PtCl(4)(NH(3))L] (2; L = tmtu) as the result of the trans addition of one tmtu and one chloro ligand. The same mode of oxidation is found in reactions of 1 with [PtCl(dien)](+) (dien = diethylenetriamine) and trans-[PtCl(2)(NH(3))(2)]. In these cases, however, the oxidation is followed by (light-independent) cis,trans isomerizations, giving trans,mer-[PtCl(2)(dien)L]Cl(2) (4) and fac-[PtCl(3)(NH(3))(2)L]Cl.0.5MeOH (6), respectively. The single-crystal X-ray structures of 2 and trans,mer-[PtCl(2)(dien)L](BF(4))(2) (4a) have been determined. 2: monoclinic, space group P2(1)/n, a = 6.280(1) ?, b = 13.221(3) ?, c = 16.575(2) ?, beta = 96.45(1) degrees, Z = 4. 4a: monoclinic, space group C2/m, a = 21.093(5) ?, b = 8.9411(9) ?, c = 14.208(2) ?, beta = 124.65(2) degrees, Z = 4. The tmtu ligands are S-bound. In 2 a pronounced trans influence of the S-donor ligand on the Pt-Cl bond (2.370(1) ?) trans to sulfur is observed. The unusual acidity of the Pt(IV) complexes exhibiting tmtu coordination trans to chloride is attributed to hydrolysis of the labilized Pt-Cl(trans) bond, which is supported by ion sensitive electrode measurements. An upfield shift of the (195)Pt resonances is found on changing the ligand combination from NCl(4)S (2) to N(3)Cl(2)S (4). This order correlates with the trans influences of the ligands: tmtu > am(m)ine > chloride. The cytotoxicity of 2 and 6 in L1210 cell lines is reported and discussed in terms of a possible mechanism of action of the compounds invivo. It is suggested that tmtu may act as a lipophilic carrier ligand and therefore enhance the cellular uptake of the new potential Pt(IV) drugs. 相似文献
19.
Among the many mechanisms for the oxidation of guanine derivatives (G) assisted by transition metals, Ru(III) and Pt(IV) metal ions share basically the same principle. Both Ru(III)- and Pt(IV)-bound G have highly positively polarized C8-H's that are susceptible to deprotonation by OH(-), and both undergo two-electron redox reactions. The main difference is that, unlike Pt(IV), Ru(III) is thought to require O(2) to undergo such a reaction. In this study, however, we report that [Ru(III)(NH(3))(5)(dGuo)] (dGuo = deoxyguanosine) yields cyclic-5'-O-C8-dGuo (a two-electron G oxidized product, cyclic-dGuo) without O(2). In the presence of O(2), 8-oxo-dGuo and cyclic-dGuo were observed. Both [Ru(II)(NH(3))(5)(dGuo)] and cyclic-dGuo were produced from [Ru(III)(NH(3))(5)(dGuo)] accelerated by [OH(-)]. We propose that [Ru(III)(NH(3))(5)(dGuo)] disproportionates to [Ru(II)(NH(3))(5)(dGuo)] and [Ru(IV)(NH(3))(4)(NH(2)(-))(dGuo)], followed by a 5'-OH attack on C8 in [Ru(IV)(NH(3))(4)(NH(2)(-))(dGuo)] to initiate an intramolecular two-electron transfer from dGuo to Ru(IV), generating cyclic-dGuo and Ru(II) without involving O(2). 相似文献
20.
Fernández D García-Seijo MI Kégl T Petocz G Kollár L García-Fernández ME 《Inorganic chemistry》2002,41(17):4435-4443
The five-coordinate palladium(II) and platinum(II) complexes [M(PP(3))Cl]Cl [M = Pd (1), Pt (2)] (PP(3) = tris[2-(diphenylphosphino)ethyl]phosphine) were prepared by interaction of aqueous solutions of MCl(4)(2-) salts with PP(3) in CHCl(3). Complexes 1 and 2 undergo facile chloro substitution reactions with KCN in 1:1 and 1:2 ratios to afford complexes [M(PP(3))(CN)]Cl [M = Pt (3)] and [M(PP(3))(CN)](CN) [M = Pd (4), Pt (5)] possessing M-C bonds, both in solution and in the solid state. The reaction of 1 and 2 with SnCl(2) in CDCl(3) occurs with insertion of SnCl(2) into M-Cl bonds leading to the formation of [M(PP(3))(SnCl(3))](SnCl(3)) [M = Pd (6), M = Pt (7)]. The isolation as solids of complexes 6 and 7 by addition of SnCl(2) to the precursors requires the presence of PPh(3) which activates the cleavage of M-Cl bonds, favors the SnCl(2) insertion, and does not coordinate to M in any observable extent. Solutions of 6 in CDCl(3) undergo tin dichloride elimination in higher proportion than solutions of 7. The reaction of complexes 1 and 2 with SnPh(2)Cl(2) leads to [M(PP(3))Cl](2)[SnPh(2)Cl(4)] [M = Pd (8)]. Complexes 2, 5, 7, and 8 were shown by X-ray diffraction to contain distorted trigonal bipyramidal monocations [M(PP(3))X](+) [M = Pt, X = Cl(-) (2), X = CN(-) (5), X = SnCl(3)(-) (7); M = Pd, X = Cl(-) (8)], the central P atom of PP(3) being trans to X in axial position and the terminal P donors in the equatorial plane of the bipyramids. The "preformed" catalyst 7 showed a relatively high aldehyde selectivity compared to most of the platinum catalysts. 相似文献