Solid-state nuclear magnetic resonance spectroscopy studies of furanose ring dynamics in the DNA HhaI binding site

The dynamics of the furanose rings in the GCGC moiety of the DNA oligomer [d(G 1A 2T 3A 4 G 5 C 6 G 7 C 8T 9A 10T 11C 12)] 2 are studied by using deuterium solid-state NMR (SSNMR). SSNMR spectra obtained from DNAs selectively deuterated on the furanose rings of nucleotides within the 5'-GCGC-3' moiety indicated that all of these positions are structurally flexible. The furanose ring within the deoxycytidine that is the methylation target displays the largest-amplitude structural changes according to the observed deuterium NMR line shapes, whereas the furanose rings of nucleotides more remote from the methylation site have less-mobile furanose rings (i.e., with puckering amplitudes < 0.3 A). Previous work has shown that methylation reduces the amplitude of motion in the phosphodiester backbone of the same DNA, and our observations indicate that methylation perturbs backbone dynamics through the furanose ring. These NMR data indicate that the 5'-GCGC-3' is dynamic, with the largest-amplitude motions occurring nearest the methylation site. The inherent flexibility of this moiety in DNA makes the molecule more amenable to the large-amplitude structural rearrangements that must occur when the DNA binds to the HhaI methyltransferase.     

31P NMR investigation of backbone dynamics in DNA binding sites

The backbone conformation of DNA plays an important role in the indirect readout mechanisms for protein--DNA recognition events. Thus, investigating the backbone dynamics of each step in DNA binding sequences provides useful information necessary for the characterization of these interactions. Here, we use 31P dynamic NMR to characterize the backbone conformation and dynamics in the Dickerson dodecamer, a sequence containing the EcoRI binding site, and confirm solid-state 2H NMR results showing that the C3pG4 and C9pG10 steps experience unique dynamics and that these dynamics are quenched upon cytosine methylation. In addition, we show that cytosine methylation affects the conformation and dynamics of neighboring nucleotide steps, but this effect is localized to only near neighbors and base-pairing partners. Last, we have been able to characterize the percent BII in each backbone step and illustrate that the C3pG4 and C9pG10 favor the noncanonical BII conformation, even at low temperatures. Our results demonstrate that 31P dynamic NMR provides a robust and efficient method for characterizing the backbone dynamics in DNA. This allows simple, rapid determination of sequence-dependent dynamical information, providing a useful method for studying trends in protein-DNA recognition events.     

Solution structure of a DNA duplex containing the potent anti-poxvirus agent cidofovir

Cidofovir (1(S)-[3-hydroxy-2-(phosphonomethoxy)propyl]cytosine, CDV) is a potent inhibitor of orthopoxvirus DNA replication. Prior studies have shown that, when CDV is incorporated into a growing primer strand, it can inhibit both the 3'-to-5' exonuclease and the 5'-to-3' chain extension activities of vaccinia virus DNA polymerase. This drug can also be incorporated into DNA, creating a significant impediment to trans-lesion DNA synthesis in a manner resembling DNA damage. CDV and deoxycytidine share a common nucleobase, but CDV lacks the deoxyribose sugar. The acyclic phosphonate bears a hydroxyl moiety that is equivalent to the 3'-hydroxyl of dCMP and permits CDV incorporation into duplex DNA. To study the structural consequences of inserting CDV into DNA, we have used (1)H NMR to solve the solution structures of a dodecamer DNA duplex containing a CDV molecule at position 7 and of a control DNA duplex. The overall structures of both DNA duplexes were found to be very similar. We observed a decrease of intensity (>50%) for the imino protons neighboring the CDV (G6, T8) and the cognate base G18 and a large chemical shift change for G18. This indicates higher proton exchange rates for this region, which were confirmed using NMR-monitored melting experiments. DNA duplex melting experiments monitored by circular dichroism revealed a lower T(m) for the CDV DNA duplex (46 °C) compared to the control (58 °C) in 0.2 M salt. Our results suggest that the CDV drug is well accommodated and stable within the dodecamer DNA duplex, but the stability of the complex is less than that of the control, suggesting increased dynamics around the CDV.     

Solid-phase synthesis of positively charged deoxynucleic guanidine (DNG) tethering a Hoechst 33258 analogue: triplex and duplex stabilization by simultaneous minor groove binding

Deoxynucleic guanidine (DNG), a DNA analogue in which positively charged guanidine replaces the phosphodiester linkages, tethering to Hoechst 33258 fluorophore by varying lengths has been synthesized. A pentameric thymidine DNG was synthesized on solid phase in the 3' --> 5' direction that allowed stepwise incorporation of straight chain amino acid linkers and a bis-benzimidazole (Hoechst 33258) ligand at the 5'-terminus using PyBOP/HOBt chemistry. The stability of (DNA)(2).DNG-H triplexes and DNA.DNG-H duplexes formed by DNG and DNG-Hoechst 33258 (DNG-H) conjugates with 30-mer double-strand (ds) DNA, d(CGCCGCGCGCGCGAAAAACCCGGCGCGCGC)/d(GCGGCGCGCGCGCTTTTTGGGCCGCGCGCG), and single-strand (ss) DNA, 5'-CGCCGCGCGCGCGAAAAACCCGGCGCGCGC-3', respectively, has been evaluated by thermal melting and fluorescence emission experiments. The presence of tethered Hoechst ligand in the 5'-terminus of the DNG enhances the (DNA)(2).DNG-H triplex stability by a DeltaT(m) of 13 degrees C. The fluorescence emission studies of (DNA)(2).DNG-H triplex complexes show that the DNG moiety of the conjugates bind in the major groove while the Hoechst ligand resides in the A:T rich minor groove of dsDNA. A single G:C base pair mismatch in the target site decreases the (DNA)(2).DNG triplex stability by 11 degrees C, whereas (DNA)(2).DNG-H triplex stability was decreased by 23 degrees C. Inversion of A:T base pair into T:A base pair in the center of the binding site, which provides a mismatch selectively for DNG moiety, decreases the triplex stability by only 5-6 degrees C. Upon hybridization of DNG-Hoechst conjugates with the 30-mer ssDNA, the DNA.DNG-H duplex exhibited significant increase in the fluorescence emission due to the binding of the tethered Hoechst ligand in the generated DNA.DNG minor groove, and the duplex stability was enhanced by DeltaT(m) of 7 degrees C. The stability of (DNA)(2).DNG triplexes and DNA.DNG duplexes is independent of pH, whereas the stability of (DNA)(2).DNG-H triplexes decreases with increase in pH.     

Neomycin-neomycin dimer: an all-carbohydrate scaffold with high affinity for AT-rich DNA duplexes

A dimeric neomycin-neomycin conjugate 3 with a flexible linker, 2,2'-(ethylenedioxy)bis(ethylamine), has been synthesized and characterized. Dimer 3 can selectively bind to AT-rich DNA duplexes with high affinity. Biophysical studies have been performed between 3 and different nucleic acids with varying base composition and conformation by using ITC (isothermal calorimetry), CD (circular dichroism), FID (fluorescent intercalator displacement), and UV (ultraviolet) thermal denaturation experiments. A few conclusions can be drawn from this study: (1) FID assay with 3 and polynucleotides demonstrates the preference of 3 toward AT-rich sequences over GC-rich sequences. (2) FID assay and UV thermal denaturation experiments show that 3 has a higher affinity for the poly(dA)·poly(dT) DNA duplex than for the poly(dA)·2poly(dT) DNA triplex. Contrary to neomycin, 3 destabilizes poly(dA)·2poly(dT) triplex but stabilizes poly(dA)·poly(dT) duplex, suggesting the major groove as the binding site. (3) UV thermal denaturation studies and ITC experiments show that 3 stabilizes continuous AT-tract DNA better than DNA duplexes with alternating AT bases. (4) CD and FID titration studies show a DNA binding site size of 10-12 base pairs/drug, depending upon the structure/sequence of the duplex for AT-rich DNA duplexes. (5) FID and ITC titration between 3 and an intramolecular DNA duplex [d(5'-A(12)-x-T(12)-3'), x = hexaethylene glycol linker] results in a binding stoichiometry of 1:1 with a binding constant ～10(8) M(-1) at 100 mM KCl. (6) FID assay using 3 and 512 hairpin DNA sequences that vary in their AT base content and placement also show a higher binding selectivity of 3 toward continuous AT-rich than toward DNA duplexes with alternate AT base pairs. (7) Salt-dependent studies indicate the formation of three ion pairs during binding of the DNA duplex d[5'-A(12)-x-T(12)-3'] and 3. (8) ITC-derived binding constants between 3 and DNA duplexes have the following order: AT continuous, d[5'-G(3)A(5)T(5)C(3)-3'] > AT alternate, d[5'-G(3)(AT)(5)C(3)-3'] > GC-rich d[5'-A(3)G(5)C(5)T(3)-3']. (9) 3 binds to the AT-tract-containing DNA duplex (B* DNA, d[5'-G(3)A(5)T(5)C(3)-3']) with 1 order of magnitude higher affinity than to a DNA duplex with alternating AT base pairs (B DNA, d[5'-G(3)(AT)(5)C(3)-3']) and with almost 3 orders of magnitude higher affinity than a GC-rich DNA (A-form, d[5'-A(3)G(5)C(5)T(3)-3']).     

Base-displaced intercalated structure of the food mutagen 2-amino-3-methylimidazo[4,5-f]quinoline in the recognition sequence of the NarI restriction enzyme, a hotspot for -2 bp deletions

The solution structure of the oligodeoxynucleotide 5'-d(CTCGGCXCCATC)-3'.5'-d(GATGGCGCCGAG)-3' containing the heterocyclic amine 8-[(3-methyl-3H-imidazo[4,5-f]quinolin-2-yl)amino]-2'-deoxyguanosine adduct (IQ) at the third guanine in the NarI restriction sequence, a hot spot for -2 bp frameshifts, is reported. Molecular dynamics calculations restrained by distances derived from 24 (1)H NOEs between IQ and DNA, and torsion angles derived from (3)J couplings, yielded ensembles of structures in which the adducted guanine was displaced into the major groove with its glycosyl torsion angle in the syn conformation. One proton of its exocyclic amine was approximately 2.8 A from an oxygen of the 5' phosphodiester linkage, suggesting formation of a hydrogen bond. The carcinogen-guanine linkage was defined by torsion angles alpha' [N9-C8-N(IQ)-C2(IQ)] of 159 +/- 7 degrees and beta' [C8-N(IQ)-C2(IQ)-N3(IQ)] of -23 +/- 8 degrees . The complementary cytosine was also displaced into the major groove. This allowed IQ to intercalate between the flanking C.G base pairs. The disruption of Watson-Crick hydrogen bonding was corroborated by chemical-shift perturbations for base aromatic protons in the complementary strand opposite to the modified guanine. Chemical-shift perturbations were also observed for (31)P resonances corresponding to phosphodiester linkages flanking the adduct. The results confirmed that IQ adopted a base-displaced intercalated conformation in this sequence context but did not corroborate the formation of a hydrogen bond between the IQ quinoline nitrogen and the complementary dC [Elmquist, C. E.; Stover, J. S.; Wang, Z.; Rizzo, C. J. J. Am. Chem. Soc. 2004, 126, 11189-11201].     

Template-directed synthesis using the heterogeneous templates produced by montmorillonite catalysis. A possible bridge between the prebiotic and RNA worlds

The synthesis of oligoguanylates [oligo(G)s] is catalyzed by a template of oligocytidylates [oligo(C)s] containing 2',5'- and 3',5'-linked phosphodiester bonds with and without incorporated C5'ppC groupings. An oligo(C) template containing exclusively 2',5'-phosphodiester bonds also serves as a template for the synthesis of complementary oligo(G)s. The oligo(C) template was prepared by the condensation of the 5'-phosphorimidazolide of cytidine on montmorillonite clay. These studies establish that RNA oligomers prepared by mineral catalysis, or other routes on the primitive earth, did not have to be exclusively 3',5'-linked to catalyze template-directed synthesis, since oligo(C)s containing a variety of linkage isomers serve as templates for the formation of complementary oligo(G)s. These findings support the postulate that origin of the RNA world was initiated by the RNA oligomers produced by polymerization of activated monomers formed by prebiotic processes.     

Remarkable stability of hairpins containing 2',5'-linked RNA loops.

We report here the results of a comparative study of hairpin loops that differ in the connectivity of phosphodiester linkages (3',5'- versus 2',5'-linkages). In addition, we have studied the effect of changing the stem composition on the thermodynamic stability of hairpin loops. Specifically, we constructed hairpins containing one of six stem duplex combinations, i.e., DNA:DNA ("DD"), RNA:RNA ("RR"), DNA:RNA ("DR"), 2',5'-RNA:RNA ("RR"), 2',5'-RNA:DNA ("RD"), and 2',5'-RNA:2',5'-RNA ("RR"), and one of three tetraloop compositions, i.e., 2',5'-RNA ("R"), RNA ("R"), and DNA ("D"). All hairpins contained the conserved and well-studied loop sequence 5'-...C(UUCG)G...-3' [Cheong et al. Nature 1990, 346, 680-682]. We show that the 2',5'-linked loop C(UUCG)G, i.e.,...C(3'p5')U(2'p5')U(2'p5')C(2'p5')G(2'p5')G(3'p5')..., like its "normal" RNA counterpart, forms an unusually stable tetraloop structure. We also show that the stability imparted by 2',5'-RNA loops is dependent on base sequence, a property that is shared with the regioisomeric 3',5'-RNA loops. Remarkably, we find that the stability of the UUCG tetraloop is virtually independent of the hairpin stem composition (DD, RR, RR, etc.), whereas the native RNA tetraloop exerts extra stability only when the stem is duplex RNA (R:R). As a result, the relative stabilities of hairpins with a 2',5'-linked tetraloop, e.g. ggac(UUCG)gtcc (T(m) = 61.4 degrees C), are often superior to those with RNA tetraloops, e.g. ggac(UUCG)gtcc (T(m) = 54.6 degrees C). In fact, it has been possible to observe the formation of a 2',5'-RNA:DNA hybrid duplex by linking the hybrid's strands to a (UUCG) loop. These duplexes (RD), which are not stable enough to form in an intermolecular complex [Wasner et al. Biochemistry 1998, 37, 7478-7486], were stable at room temperature (T(m) approximately 50 degrees C). Thus, 2',5'-loops have potentially important implications in the study of nucleic acid complexes where structural data are not yet available. Furthermore, they may be particularly useful as structural motifs for synthetic ribozymes and nucleic acid "aptamers".     

Synthesis of N3- and 2-NH2-substituted 6,7-diphenylpterins and their use as intermediates for the preparation of oligonucleotide conjugates designed to target photooxidative damage on single-stranded DNA representing the bcr-abl chimeric gene

Two 17-mer oligodeoxynucleotide-5'-linked-(6,7-diphenylpterin) conjugates, 2 and 3, were prepared as photosensitisers for targeting photooxidative damage to a 34-mer DNA oligodeoxynucleotide (ODN) fragment 1 representing the chimeric bcr-abl gene that is implicated in the pathogenesis of chronic myeloid leukaemia (CML). The base sequence in the 17-mer was 3'G G T A G T T A T T C C T T C T T5'. In the first of these ODN conjugates (2) the pterin was attached at its N3 atom, via a -(CH2)3OPO(OH)- linker, to the 5'-OH group of the ODN. Conjugate 2 was prepared from 2-amino-3-(3-hydroxypropyl)-6,7-diphenyl-4(3H)-pteridinone 10, using phosphoramidite methodology. Starting material 10 was prepared from 5-amino-7-methylthiofurazano[3,4-d]pyrimidine 4 via an unusual highly resonance stabilised cation 8, incorporating the rare 2H,6H-pyrimido[6,1-b][1,3]oxazine ring system. In the characterisation of 10 two pteridine phosphazenes, 15 and 29, were obtained, as well as new products containing two uncommon tricyclic ring systems, namely pyrimido[2,1-b]pteridine (20 and 24) and pyrimido[1,2-c]pteridine (27). In the second ODN conjugate the linker was -(CH2)5CONH(CH2)6OPO(OH)- and was attached to the 2-amino group of the pterin. In the preparation of 3, the N-hydroxysuccinimide ester 37 of 2-(5-carboxypentylamino)-6,7-diphenyl-4(3H)-pteridinone was condensed with the hexylamino-modified 17-mer. Excitation of 36 with near UV light in the presence of the single-stranded target 34-mer, 5'T G A C C A T C A A T A A G14 G A A G18 A A G21 C C C T T C A G C G G C C3' 1 caused oxidative damage at guanine bases, leading to alkali-labile sites which were monitored by polyacrylamide gel electrophoresis. Cleavage was observed at all guanine sites with a marked preference for cleavage at G14. In contrast, excitation of ODN-pteridine conjugate 2 in the presence of 1 caused oxidation of the latter predominantly at G18, with a smaller extent of cleavage at G15 and G14 (in the double-stranded portion) and G21. These results contrast with our previous observation of specific cleavage at G21 with ruthenium polypyridyl sensitisers, and suggest that a different mechanism, probably one involving Type 1 photochemical electron transfer, is operative. Much lower yields were found with the ODN-pteridine conjugate 3, perhaps as a consequence of the longer linker between the ODN and the pteridine in this case.     

Combined theoretical and computational study of interstrand DNA guanine-guanine cross-linking by trans-[Pt(pyridine)2] derived from the photoactivated prodrug trans,trans,trans-[Pt(N3)2(OH)2(pyridine)2

Molecular modeling and extensive experimental studies are used to study DNA distortions induced by binding platinum(II)-containing fragments derived from cisplatin and a new class of photoactive platinum anticancer drugs. The major photoproduct of the novel platinum(IV) prodrug trans,trans,trans-[Pt(N(3))(2)(OH)(2)(py)(2)] (1) contains the trans-{Pt(py)(2)}(2+) moiety. Using a tailored DNA sequence, experimental studies establish the possibility of interstrand binding of trans-{Pt(py)(2)}(2+) (P) to guanine N7 positions on each DNA strand. Ligand field molecular mechanics (LFMM) parameters for Pt-guanine interactions are then derived and validated against a range of experimental structures from the Cambridge Structural Database, published quantum mechanics (QM)/molecular mechanics (MM) structures of model Pt-DNA systems and additional density-functional theory (DFT) studies. Ligand field molecular dynamics (LFMD) simulation protocols are developed and validated using experimentally characterized bifunctional DNA adducts involving both an intra- and an interstrand cross-link of cisplatin. We then turn to the interaction of P with the DNA duplex dodecamer, d(5'-C(1)C(2)T(3)C(4)T(5)C(6)G(7)T(8)C(9)T(10)C(11)C(12)-3')·d(5'-G(13)G(14)A(15)G(16)A(17)C(18)G(19)A(20)G(21)A(22)G(23)G(24)-3') which is known to form a monofunctional adduct with cis-{Pt(NH(3))(2)(py)}. P coordinated to G(7) and G(19) is simulated giving a predicted bend toward the minor groove. This is widened at one end of the platinated site and deepened at the opposite end, while the P-DNA complex exhibits a global bend of ～67° and an unwinding of ～20°. Such cross-links offer possibilities for specific protein-DNA interactions and suggest possible mechanisms to explain the high potency of this photoactivated complex.     

Impact of pyrophosphate and O-ethyl-substituted pyrophosphate groups on DNA structure

Design of novel DNA probes to inhibit specific repair pathways is important for basic science applications and for use as therapeutic agents. As shown previously, single pyrophosphate (PP) and O-ethyl-substituted pyrophosphate (SPP) modifications can inhibit the DNA glycosylase activities on damaged DNA. To understand the structural basis of this inhibition, the influence of the PP and SPP internucleotide groups on the helical parameters and geometry of a double-stranded DNA was studied by using molecular modeling tools including molecular dynamics and quantum mechanical-molecular mechanical (QM/MM) approaches. Native and locally modified PP- and SPP-containing DNA duplexes of dodecanucleotide d(C1G2C3G4A5A6T7T8C9G10C11G12) were simulated in aqueous solution. The energies and forces were computed by using the PBE0/6-31+G** approach in the QM part and the AMBER force-field parameters in the MM part. Analysis of the local base-pair helical parameters, internucleotide distances, and overall global structure at the located stationary points revealed a close similarity of the initial and modified duplexes, with only torsion angles of the main chain being altered in the vicinity of introduced chemical modification. Results show that the PP and SPP groups are built into a helix structure without elongation of the internucleotide distance due to flipping-out of phosphate group from the sugar-phosphate backbone. The mechanism of such embedding has only a minor impact on the base pairs stacking and Watson-Crick interactions. Biochemical studies revealed that the PP and SPP groups immediately 5', but not 3', to the 8-oxoguanosine (8oxodG) inhibit translesion synthesis by a DNA polymerase in vitro. These results suggest that subtle perturbations of the DNA backbone conformation influence processing of base lesions.     

Conformational flexibility of a microcrystalline globular protein: order parameters by solid-state NMR spectroscopy

The majority of protein structures are determined in the crystalline state, yet few methods exist for the characterization of dynamics for crystalline biomolecules. Solid-state NMR can be used to probe detailed dynamic information in crystalline biomolecules. Recent advances in high-resolution solid-state NMR have enabled the site-specific assignment of (13)C and (15)N nuclei in proteins. With the use of multidimensional separated-local-field experiments, we report the backbone and side chain conformational dynamics of ubiquitin, a globular microcrystalline protein. The measurements of molecular conformational order parameters are based on heteronuclear dipolar couplings, and they are correlated to assigned chemical shifts, to obtain a global perspective on the sub-microsecond dynamics in microcrystalline ubiquitin. A total of 38 Calpha, 35 Cbeta and multiple side chain unique order parameters are collected, and they reveal the high mobility of ubiquitin in the microcrystalline state. In general the side chains show elevated motion in comparison with the backbone sites. The data are compared to solution NMR order parameter measurements on ubiquitin. The SSNMR measurements are sensitive to motions on a broader time scale (low microsecond and faster) than solution NMR measurements (low nanosecond and faster), and the SSNMR order parameters are generally lower than the corresponding solution values. Unlike solution NMR relaxation-based order parameters, order parameters for (13)C(1)H(2) spin systems are readily measured from the powder line shape data. These results illustrate the potential for detailed, extensive, and site-specific dynamic studies of biopolymers by solid-state NMR.     

Insight into G[bond]T mismatch recognition using molecular dynamics with time-averaged restraints derived from NMR spectroscopy

Molecular dynamics (MD) simulations were conducted for a G[bond]T mismatch-containing DNA decamer, d(CCATGCGTGG)(2), and its Watson-Crick parent sequence, d(CCACGCGTGG)(2). Dynamics in unrestrained MD trajectories were in poor agreement with prior (13)C NMR studies. However, the accuracy of the trajectories was improved by the use of time-averaged interatomic distance restraints derived from (1)H NMR. Postprocess smoothing of the trajectories further improved accuracy. Comparison of restrained and smoothed trajectories of the two DNA molecules revealed distinct differences in dynamics. The major groove width of the mismatched oligomer was more variable over the course of the simulation compared to its parent sequence. Greater variability in helical parameters stretch and opening for the mismatches indicated less kinetically stable base pairing. Interbase helical parameters rise, roll, and tilt were also more variable in certain base steps involving mismatched bases. These dynamic differences between normal and G[bond]T mismatched DNA reflect differences in local flexibility that may play a role in mismatch recognition by the MutS. A potential alternate G[bond]T mismatch binding mode for MutS is also proposed.     

Chemical and structural implications of 1',2'- versus 2',4'- conformational constraints in the sugar moiety of modified thymine nucleosides

In order to understand how the chemical nature of the conformational constraint of the sugar moiety in ON/RNA(DNA) dictates the duplex structure and reactivity, we have determined molecular structures and dynamics of the conformationally constrained 1',2'-azetidine- and 1',2'-oxetane-fused thymidines, as well as their 2',4'-fused thymine (T) counterparts such as LNA-T, 2'-amino LNA-T, ENA-T, and aza-ENA-T by NMR, ab initio (HF/6-31G** and B3LYP/6-31++G**), and molecular dynamics simulations (2 ns in the explicit aqueous medium). It has been found that, depending upon whether the modification leads to a bicyclic 1',2'-fused or a tricyclic 2',4'-fused system, they fall into two distinct categories characterized by their respective internal dynamics of the glycosidic and the backbone torsions as well as by characteristic North-East type sugar conformation (P = 37 degrees +/- 27 degrees , phi(m) = 25 degrees +/- 18 degrees ) of the 1',2'-fused systems, and (ii) pure North type (P = 19 degrees +/- 8 degrees , phi(m) = 48 degrees +/- 4 degrees ) for the 2',4'-fused nucleosides. Each group has different conformational hyperspace accessible, despite the overall similarity of the North-type conformational constraints imposed by the 1',2'- or 2',4'-linked modification. The comparison of pK(a)s of the 1-thyminyl aglycon as well as that of endocyclic sugar-nitrogen obtained by theoretical and experimental measurements showed that the nature of the sugar conformational constraints steer the physicochemical property (pK(a)) of the constituent 1-thyminyl moiety, which in turn can play a part in tuning the strength of hydrogen bonding in the basepairing.     

Double-strand DNA cleavage by copper complexes of 2,2'-dipyridyl with guanidinium/ammonium pendants

Two ligands with guanidinium/ammonium groups were synthesized and their copper complexes, [Cu(L1)Cl2](ClO4)2.H2O (1) and [Cu(L2)Cl2](ClO4)2 (2) (L1 = 5,5'-di[1-(guanidyl)methyl]-2,2'-bipyridyl cation and L2 = 5,5'-di[1-(amino)methyl]-2,2'-bipyridyl cation), were prepared to serve as nuclease mimics. X-Ray analysis revealed that Cu(II) ion in 1 has a planar square CuN2Cl2-configuration. The shortest distance between the nitrogen of guanidinium and copper atoms is 6.5408(5) A, which is coincident with that of adjacent phosphodiesters in DNA (ca. 6 A). In the absence of reducing agent, supercoiled plasmid DNA cleavage by the complexes were performed and their hydrolytic mechanisms were demonstrated with radical scavengers and T4 ligase. The pseudo-Michaelis-Menten kinetic parameters (kcat, KM) were calculated to be 4.42 h(-1), 7.46 x 10(-5) M for 1, and 4.21 h(-1), 1.07 x 10(-4) M for 2, respectively. The result shows that their cleavage efficiency is about 10-fold higher than the simple analogue [Cu(bipy)Cl2] (3) (0.50 h(-1), 3.5 x 10(-4) M). The pH dependence of DNA cleavage by 1 and its hydroxide species in solution indicates that mononuclear [Cu(L1)(OH)(H2O)]3+ ion is the active species. Highly effective DNA cleavage ability of is attributed to the effective cooperation of the metal moiety and two guanidinium pendants with the phosphodiester backbone of nucleic acid.     

The NMR structure of [Xd(C2)]4 investigated by molecular dynamics simulations

The i‐motif tetrameric structure is built up from two parallel duplexes intercalated in a head‐to‐tail orientation, and held together by hemiprotonated cytosine pairs. Two topologies exist for the i‐motif structure, one with outermost 3′ extremities and the other with outermost 5′ extremities, called the 3′E and 5′E topology, respectively. Since the comparison of sugar and phosphate group interactions between the two topologies is independent of the length of the intercalation motif, the relative stability of the 3′E and 5′E topologies therefore should not depend on this length. Nevertheless, it has been shown that the 3′E topology of the [d(C2)]4 is much more stable than the 5′E topology, and that the former is the only species observed in solution. In order to understand the reason for this atypical behavior, the NMR structure of the [Xd(C2)]4 was determined and analyzed by molecular dynamics simulations. In the NMR structure, the width of the narrow groove is slightly smaller than in previously determined i‐motif structures, which supports the importance of phosphodiester backbone interactions in the structure stability. The simulations show that the stacking of cytosines, essential for the i‐motif stability, is produced by a similar and non‐negative twisting of the phosphodiester backbones. The twisting is induced by an interaction between the backbones; the [Xd(C2)]4 in 5′E topology, exhibiting very limited interaction between the phosphodiester backbones, is thus unstable. Copyright © 2002 John Wiley & Sons, Ltd.     

Imidazopyridine/Pyrrole and hydroxybenzimidazole/pyrrole pairs for DNA minor groove recognition

The DNA binding properties of fused heterocycles imidazo[4,5-b]pyridine (Ip) and hydroxybenzimidazole (Hz) paired with pyrrole (Py) in eight-ring hairpin polyamides are reported. The recognition profile of Ip/Py and Hz/Py pairs were compared to the five-membered ring pairs Im/Py and Hp/Py on a DNA restriction fragment at four 6-base pair recognition sites which vary at a single position 5'-TGTNTA-3', where N = G, C, T, A. The Ip/Py pair distinguishes G.C from C.G, T.A, and A.T, and the Hz/Py pair distinguishes T.A from A.T, G.C, and C.G, affording a new set of heterocycle pairs to target the four Watson-Crick base pairs in the minor groove of DNA.     

Interconversion of the cis-5R,6S- and trans-5R,6R-thymine glycol lesions in duplex DNA

Thymine glycol (Tg), 5,6-dihydroxy-5,6-dihydrothymine, is formed in DNA by the reaction of thymine with reactive oxygen species. The 5R Tg lesion was incorporated site-specifically into 5'-d(G(1)T(2)G(3)C(4)G(5)Tg(6)G(7)T(8)T(9)T(10)G(11)T(12))-3'; Tg = 5R Tg. The Tg-modified oligodeoxynucleotide was annealed with either 5'-d(A(13)C(14)A(15)A(16)A(17)C(18)A(19)C(20)G(21)C(22)A(23)C(24))-3', forming the Tg(6) x A(19) base pair, corresponding to the oxidative damage of thymine in DNA, or 5'-d(A(13)C(14)A(15)A(16)A(17)C(18)G(19)C(20)G(21)C(22)A(23)C(24))-3', forming the mismatched Tg(6) x G(19) base pair, corresponding to the formation of Tg following oxidative damage and deamination of 5-methylcytosine in DNA. At 30 degrees C, the equilibrium ratio of cis-5R,6S:trans-5R,6R epimers was 7:3 for the duplex containing the Tg(6) x A (19) base pair. In contrast, for the duplex containing the Tg(6) x G(19) base pair, the cis-5R,6S:trans-5R,6R equilibrium favored the cis-5R,6S epimer; the level of the trans-5R,6R epimer remained below the level of detection by NMR. The data suggested that Tg disrupted hydrogen bonding interactions, either when placed opposite to A(19) or G(19). Thermodynamic measurements indicated a 13 degrees C reduction of T(m) regardless of whether Tg was placed opposite dG or dA in the complementary strand. Although both pairings increased the free energy of melting by 3 kcal/mol, the melting of the Tg x G pair was more enthalpically favored than was the melting of the Tg x A pair. The observation that the position of the equilibrium between the cis-5R,6S and trans-5R,6R thymine glycol epimers in duplex DNA was affected by the identity of the complementary base extends upon observations that this equilibrium modulates the base excision repair of Tg [Ocampo-Hafalla, M. T.; Altamirano, A.; Basu, A. K.; Chan, M. K.; Ocampo, J. E.; Cummings, A., Jr.; Boorstein, R. J.; Cunningham, R. P.; Teebor, G. W. DNA Repair (Amst) 2006, 5, 444-454].