Long-range cooperativity in molecular recognition of RNA by oligodeoxynucleotides with multiple C5-(1-propynyl) pyrimidines.

A heptamer composed of C5-(1-propynyl) pyrimidines (Y(p)'s) is a potent and specific antisense agent against the mRNA of SV40 large T antigen (Wagner, R. W.; Matteucci, M. D.; Grant, D.; Huang, T.; Froehler, B. C. Nat. Biotechnol. 1996, 14, 840-844). To characterize the role of the propynyl groups in molecular recognition, thermodynamic increments associated with substitutions in DNA:RNA duplexes, such as 5'-dCCUCCUU-3':3'-rGAGGAGGAAAU-5', have been measured by UV melting experiments. For nucleotides tested, an unpaired dangling end stabilizes unmodified and propynylated duplexes similarly, except that addition of a 5' unpaired rA is 1.4 kcal/mol more stabilizing on the propynylated, PODN:RNA, duplex than on the DNA:RNA duplex. Free energy increments for addition of single propynyl groups range from 0 to -4.0 kcal/mol, depending on the final number and locations of substitutions. A preliminary model for predicting the stabilities of Y(p)-containing hybrid duplexes is presented. Eliminating one amino group, and therefore a hydrogen bond, by substituting inosine (I) for guanosine (G), to give 5'-dC(p)C(p)U(p)C(p)C(p)U(p)U(p)-3':3'-rGAGIAGGAAAU-5', destabilizes the duplex by 3.9 kcal/mol, compared to 1.7 kcal/mol for the same change within the unpropynylated duplex. This 2.2 kcal/mol difference is eliminated by removing a single propynyl group three base pairs away. CD spectra suggest that single propynyl deletions within the PODN:RNA duplex have position-dependent effects on helix geometry. The results suggest long-range cooperativity between propynyl groups and provide insights for rationally programming oligonucleotides with enhanced binding and specificity. This can be exploited in developing technologies that are dependent upon nucleic acid-based molecular recognition.     

Structural studies of LNA:RNA duplexes by NMR: conformations and implications for RNase H activity

We have used NMR and CD spectroscopy to study the conformations of modified oligonucleotides (locked nucleic acid, LNA) containing a conformationally restricted nucleotide (T(L)) with a 2'-O,4'-C-methylene bridge. We have investigated two LNA:RNA duplexes, d(CTGAT(L)ATGC):r(GCAUAUCAG) and d(CT(L)GAT(L)AT(L)GC):r(GCAUAUCAG), along with the unmodified DNA:RNA reference duplex. Increases in the melting temperatures of +9.6 degrees C and +8.1 degrees C per modification relative to the unmodified duplex were observed for these two LNA:RNA sequences. The three duplexes all adopt right-handed helix conformations and form normal Watson-Crick base pairs with all the bases in the anti conformation. Sugar conformations were determined from measurements of scalar coupling constants in the sugar rings and distance information derived from 1H-1H NOE measurements; all the sugars in the RNA strands of the three duplexes adopt an N-type conformation (A-type structure), whereas the sugars in the DNA strands change from an equilibrium between S- and N-type conformations in the unmodified duplex towards more of the N-type conformation when modified nucleotides are introduced. The presence of three modified T(L) nucleotides induces drastic conformational shifts of the remaining unmodified nucleotides of the DNA strand, changing all the sugar conformations except those of the terminal sugars to the N type. The CD spectra of the three duplexes confirm the structural changes described above. On the basis of the results reported herein, we suggest that the observed conformational changes can be used to tune LNA:RNA duplexes into substrates for RNase H: Partly modified LNA:RNA duplexes may adopt a duplex structure between the standard A and B types, thereby making the RNA strand amenable to RNase H-mediated degradation.     

Synthesis and properties of RNA analogues having amides as interuridine linkages at selected positions

Oligoribonucleotide analogues having amide internucleoside linkages (AM1: 3'-CH(2)CONH-5' and AM2: 3'-CH(2)NHCO-5') at selected positions have been synthesized and the thermal stability of duplexes formed by these analogues with complementary RNA fragments has been evaluated by UV melting experiments. Two series of oligomers with either 2'-OH or 2'-OMe vicinal to the amide linkages were studied. Monomeric synthons (3' and 5'-C amines and carboxylic acids) were synthesized as follows: For synthesis of the AM1 analogue, the known sequence of radical allylation followed by the cleavage of the double bond was adopted. For synthesis of the AM2 analogue, novel routes via addition of nitromethane followed by conversion of the nitro function to either amino or carboxyl groups were developed. Coupling of monomeric amines and carboxylic acids followed by protecting group manipulation and phosphonylation gave dimeric 3'-hydrogenphosphonate building blocks for oligonucleotide synthesis. Monomeric model compounds having 3'-amide and 2'-OH or 2'-OMe groups were also prepared and their conformational equilibrium was determined by (1)H NMR. The AM1 and AM2 models showed equal preferences for the North conformers (at 40 degrees C, 88-89% with 2'-OH, and 92-93% with 2'-OMe). At physiological salt concentration (0.1 M NaCl) the duplexes between AM1 modified oligonucleotides and RNA had stability similar to unmodified RNA-RNA duplexes (Delta t(m)= -0.2 to +0.7 degrees C per modification). However, the AM2 modification resulted in substantial stabilization of duplexes: Delta t(m)= +1 to +2.4 degrees C per modification compared to all RNA. A 2'-O-methyl vicinal to the AM2 linkage further increased the duplex stability. Our results suggest that RNA analogues having amide internucleoside bonds are very promising candidates for medicinal applications.     

The structure of a mixed LNA/DNA:RNA duplex is driven by conformational coupling between LNA and deoxyribose residues as determined from 13C relaxation measurements

A study of the internal dynamics of an LNA/DNA:RNA duplex has been performed to further characterize the conformational changes associated with the incorporation of locked nucleic acid (LNA) nucleotides in a DNA:RNA duplex. In general, it was demonstrated that the LNA/DNA:RNA duplex has a very high degree of order compared to dsDNA and dsRNA duplexes. The order parameters of the aromatic carbon atoms in the LNA/DNA strand are uniformly high, whereas a sharp drop in the degree of order was seen in the RNA strand in the beginning of the AUAU stretch in the middle of the strand. This can be related to a return to normal dsRNA dynamics for the central A:U base pair. The high order of the heteroduplex is consistent with preorganization of the chimera strand for an A-form duplex conformation. These results partly explain the dramatic increase in T(m) of the chimeric heteroduplex over dsDNA and DNA:RNA hybrids of the same sequence.     

Analogues of a locked nucleic acid with three-carbon 2',4'-linkages: synthesis by ring-closing metathesis and influence on nucleic acid duplex stability and structure

Two bicyclic 2'-deoxynucleoside analogues containing a saturated and an unsaturated three-carbon 2',4'-linkage, respectively, have been synthesized using a ring-closing metathesis-based linear strategy starting from uridine. Both analogues have been incorporated into oligodeoxynucleotide sequences and increased the stability of DNA:RNA hybrid duplexes (DeltaT(m) approximately 2.5-5.0 degrees C per modification) and decreased the stability of dsDNA duplexes (DeltaT(m) approximately 2.5-1.0 degrees C per modification). CD spectroscopy revealed that the bicyclic nucleosides induced formation of A-type-like duplexes albeit to a lesser degree than found for locked nucleic acid (LNA) monomers. From the CD data and UV melting analysis, we propose that the 2'-oxygen atom of the bicyclic moiety is essential for the formation of stabilized A-type-like dsDNA but not for the formation of a stabilized A-type DNA:RNA hybrid.     

NMR solution structure of an oligonucleotide hairpin with a 2'F-ANA/RNA stem: implications for RNase H specificity toward DNA/RNA hybrid duplexes.

The first structure of a 2'-deoxy-2'-fluoro-D-arabinose nucleic acid (2'F-ANA)/RNA duplex is presented. We report the structural characterization by NMR spectroscopy of a small hybrid hairpin, r(GGAC)d(TTCG)2'F-a(GTCC), containing a 2'F-ANA/RNA stem and a four-residue DNA loop. Complete (1)H, (13)C, (19)F, and (31)P resonance assignments, scalar coupling constants, and NOE constraints were obtained from homonuclear and heteronuclear 2D spectra. In the chimeric duplex, the RNA strand adopts a classic A-form structure having C3' endo sugar puckers. The 2'F-ANA strand is neither A-form nor B-form and contains O4' endo sugar puckers. This contrasts strongly with the dynamic sugar conformations previously observed in the DNA strands of DNA/RNA hybrid duplexes. Structural parameters for the duplex, such as minor groove width, x-displacement, and inclination, were intermediate between those of A-form and B-form duplexes and similar to those of DNA/RNA duplexes. These results rationalize the enhanced stability of 2'F-ANA/RNA duplexes and their ability to elicit RNase H activity. The results are relevant for the design of new antisense drugs based on sugar-modified nucleic acids.     

Site-selective RNA cleavage by DNA bearing a base pair-mimic nucleoside

We have synthesized the deoxyadenosine derivative tethering a phenyl group (X), which mimics the Watson-Crick A/T base pair. The RNA/DNA hybrid duplexes containing X in the middle of the DNA sequence showed a similar thermal stability regardless of the ribonucleotide species (A, G, C, or U) opposite to X, probably because of the phenyl group stacking inside of the duplex accompanied by the opposite ribonucleotide base flipped in an extrahelical position. The RNA strand hybridized with the DNA strand bearing X was cleaved on the 3'-side of the ribonucleotide opposite to X in the presence of MgCl2, and the RNA sequence to be cleaved was not restricted. The site-specific RNA hydrolysis suggests that the DNA strand bearing X has the advantage of the site-selective base flipping in the target sequence and the development of a "universal deoxyribozyme" to exclusively cleave a target RNA sequence.     

A novel RNA motif based on the structure of unusually stable 2',5'-linked r(UUCG) loops

We have recently shown that hairpins containing 2',5'-linked RNA loops exhibit superior thermodynamic stability compared to native hairpins comprised of 3',5'-RNA loops [Hannoush, R. N.; Damha, M. J. J. Am. Chem. Soc. 2001, 123, 12368-12374]. A remarkable feature of the 2',5'-r(UUCG) tetraloop is that, unlike the corresponding 3',5'-linked tetraloop, its stability is virtually independent of the hairpin stem composition. Here, we determine the solution structure of unusually stable hairpins of the sequence 5'-G(1)G(2)A(3)C(4)-(U(5)U(6)C(7)G(8))-G(9)(U/T(10))C(11)C(12)-3' containing a 2',5'-linked RNA (UUCG) loop and either an RNA or a DNA stem. The 2',5'-linked RNA loop adopts a new fold that is completely different from that previously observed for the native 3',5'-linked RNA loop. The 2',5'-RNA loop is stabilized by (a). U5.G8 wobble base pairing, with both nucleotide residues in the anti-conformation, (b). extensive base stacking, and (c). sugar-base and sugar-sugar contacts, all of which contribute to the extra stability of this hairpin structure. The U5:G8 base pair stacks on top of the C4:G9 loop-closing base pair and thus appears as a continuation of the stem. The loop uracil U6 base stacks above U5 base, while the cytosine C7 base protrudes out into the solvent and does not participate in any of the stabilizing interactions. The different sugar pucker and intrinsic bonding interactions within the 2',5'-linked ribonucleotides help explain the unusual stability and conformational properties displayed by 2',5'-RNA tetraloops. These findings are relevant for the design of more effective RNA-based aptamers, ribozymes, and antisense agents and identify the 2',5'-RNA loop as a novel structural motif.     

Synthesis and pairing properties of oligodeoxynucleotides containing bicyclo-RNA and bicyclo-ANA modifications

The synthesis of the ribo(bc-rT)- and arabino(bc-araT)-version of bicyclothymidine (bc-dT) has been achieved. A conformational analysis by X-ray and/or (1)H NMR spectroscopy on the corresponding 3',5'-benzyl-protected nucleosides featured a rigid C(2')-endo conformation for the furanose ring, irrespective of the configuration of the OH group at C(2'). The conformation of the carbocyclic ring in these nucleosides was found to be less defined and thus more flexible. Both nucleosides were converted into the corresponding phosphoramidites and incorporated into oligodeoxynucleotides by standard DNA chemistry. T(m)-data of duplexes with cDNA and RNA revealed that a bc-rT unit strongly destabilized duplexes with cDNA and RNA by 6-8 °C/mod, while bc-araT was almost T(m) neutral. A rationale based on a previous structure of a bc-DNA mini duplex suggests that the strong destabilization caused by a bc-rT unit arises from unfavorable steric interactions of the equatorial 2'-OH group with the sugar residue of the 3'-neighboring nucleotide unit.     

NMR and UV studies of 3'-S-phosphorothiolate modified DNA in a DNA : RNA hybrid dodecamer duplex; implications for antisense drug design

High-resolution NMR spectroscopy has been used to establish the conformational consequences of the introduction of a single 3[prime or minute]-S-phosphorothiolate link in the DNA strand of a DNA : RNA hybrid. These systems are of interest as potential antisense therapeutic agents. Previous studies on similarly modified dinucleotides have shown that the conformation of the sugar to which the sulfur is attached shifts to the north (C(3[prime or minute])-endo/C(2[prime or minute])-exo). Comparisons made between NOESY cross-peak intensities, and coupling constants from PE-COSY spectra, for both non-modified and modified duplexes confirm that this conformational shift is also present in the double helical oligonucleotide system. In addition it is noted that in both the dinucleotides and the modified duplex, the conformation of the sugar ring 3[prime or minute] to the site of modification is also shifted to the north. That this pattern is observed in the small monomeric system as well as the larger double helix is suggestive of some pre-ordering of the sequences. The conclusion is supported by consideration of the (1)H chemical shifts of the heterocyclic bases near the site of the modification. The enhanced stability that these conformational changes should bring was confirmed by UV thermal melting studies. Subsequently a series of singly and doubly 3[prime or minute]-S-phosphorothiolate-modified duplexes were investigated by UV. The results are indicative of an additive effect of the modification with thermodynamic benefit being derived from alternate spacing of two modified linkers.     

Short-RNA selective binding of oligonucleotides modified using adenosine and guanosine derivatives that possess cyclohexyl phosphates as substituents

We have developed new artificial oligonucleotides which distinguish short RNA targets from long ones. The modification of the 5' termini of oligonucleotides by using adenosine derivatives that possess a bulky cyclohexyl phosphate moiety at their base moiety and a phosphate group at the position of their 5'-hydroxyl group maximized their short RNA selectivity. The 2'-O-methyl-RNA (5'-XC(m)A(m)A(m)C(m)C(m)U(m)A(m)C(m)U(m)) having these modifications exhibits ca. 10 °C higher T(m) in the duplexes with the complementary short RNA (3'-GUUGGAUGA-5') than with the long RNA (3'-AUUAUAUGUUGGAUGAUGGUUA-5'). The oligodeoxynucleotides having the same modification exhibited similar selectivity. Such short-RNA selective binding of terminally modified oligonucleotides can be employed to distinguish between mature microRNAs and pre-microRNAs.     

Influence of intervening mismatches on long-range guanine oxidation in DNA duplexes

A systematic investigation of the efficiency of oxidative damage at guanine residues through long-range charge transport was carried out as a function of intervening base mismatches. A series of DNA oligonucleotides were synthesized that incorporate a ruthenium intercalator linked covalently to the 5' terminus of one strand and containing two 5'-GG-3' sites in the complementary strand. Single base mismatches were introduced between the two guanine doublet steps, and the efficiency of transport through the mismatches was determined through measurements of the ratio of oxidative damage at the guanine doublets distal versus proximal to the intercalated ruthenium oxidant. Differing relative extents of guanine oxidation were observed for the different mismatches. The damage ratio of oxidation at the distal versus proximal site for the duplexes containing different mismatches varies in the order GC approximately GG approximately GT approximately GA > AA > CC approximately TT approximately CA approximately CT. For all assemblies, damage found with the Delta-Ru diastereomer was found to be greater than with the Lambda-diastereomer. The extent of distal/proximal guanine oxidation in different mismatch-containing duplexes was compared with the helical stability of the duplexes, electrochemical data for intercalator reduction on different mismatch-containing DNA films, and base-pair lifetimes for oligomers containing the different mismatches derived from 1H NMR measurements of the imino proton exchange rates. While a clear correlation is evident both with helix stability and electrochemical data monitoring reduction of an intercalator through DNA films, damage ratios correlate most closely with base-pair lifetimes. Competitive hole trapping at the mismatch site does not appear to be a key factor governing the efficiency of transport through the mismatch. These results underscore the importance of base dynamics in modulating long-range charge transport through the DNA base-pair stack.     

Electrochemiluminescent monomers for solid support syntheses of Ru(II)-PNA bioconjugates: multimodal biosensing tools with enhanced duplex stability

The feasibility of devising a solid support mediated approach to multimodal Ru(II)-peptide nucleic acid (PNA) oligomers is explored. Three Ru(II)-PNA-like monomers, [Ru(bpy)(2)(Cpp-L-PNA-OH)](2+) (M1), [Ru(phen)(2)(Cpp-L-PNA-OH)](2+) (M2), and [Ru(dppz)(2)(Cpp-L-PNA-OH)](2+) (M3) (bpy = 2,2'-bipyridine, phen = 1,10-phenanthroline, dppz = dipyrido[3,2-a:2',3'-c]phenazine, Cpp-L-PNA-OH = [2-(N-9-fluorenylmethoxycarbonyl)aminoethyl]-N-[6-(2-(pyridin-2yl)pyrimidine-4-carboxamido)hexanoyl]-glycine), have been synthesized as building blocks for Ru(II)-PNA oligomers and characterized by IR and (1)H NMR spectroscopy, mass spectrometry, electrochemistry and elemental analysis. As a proof of principle, M1 was incorporated on the solid phase within the PNA sequences H-g-c-a-a-t-a-a-a-a-Lys-NH(2) (PNA1) and H-P-K-K-K-R-K-V-g-c-a-a-t-a-a-a-a-lys-NH(2) (PNA4) to give PNA2 (H-g-c-a-a-t-a-a-a-a-M1-lys-NH(2)) and PNA3 (H-P-K-K-K-R-K-V-g-c-a-a-t-a-a-a-a-M1-lys-NH(2)), respectively. The two Ru(II)-PNA oligomers, PNA2 and PNA3, displayed a metal to ligand charge transfer (MLCT) transition band centered around 445 nm and an emission maximum at about 680 nm following 450 nm excitation in aqueous solutions (10 mM PBS, pH 7.4). The absorption and emission response of the duplexes formed with the cDNA strand (DNA: 5'-T-T-T-T-T-T-T-A-T-T-G-C-T-T-T-3') showed no major variations, suggesting that the electronic properties of the Ru(II) complexes are largely unaffected by hybridization. The thermal stability of the PNA·DNA duplexes, as evaluated from UV melting experiments, is enhanced compared to the corresponding nonmetalated duplexes. The melting temperature (T(m)) was almost 8 °C higher for PNA2·DNA duplex, and 4 °C for PNA3·DNA duplex, with the stabilization attributed to the electrostatic interaction between the cationic residues (Ru(II) unit and positively charged lysine/arginine) and the polyanionic DNA backbone. In presence of tripropylamine (TPA) as co-reactant, PNA2, PNA3, PNA2·DNA and PNA3·DNA displayed strong electrochemiluminescence (ECL) signals even at submicromolar concentrations. Importantly, the combination of spectrochemical, thermal and ECL properties possessed by the Ru(II)-PNA sequences offer an elegant approach for the design of highly sensitive multimodal biosensing tools.     

Stability and structure of RNA duplexes containing isoguanosine and isocytidine.

Isoguanosine (iG) and isocytidine (iC) differ from guanosine (G) and cytidine (C), respectively, in that the amino and carbonyl groups are transposed. The thermodynamic properties of a set of iG, iC containing RNA duplexes have been measured by UV optical melting. It is found that iG-iC replacements usually stabilize duplexes, and the stabilization per iG-iC pair is sequence-dependent. The sequence dependence can be fit to a nearest-neighbor model in which the stabilities of iG--iC pairs depend on the adjacent iG--iC or G--C pairs. For 5'-CG-3'/3'-GC-5' and 5'-GG-3'/3'-CC-5' nearest neighbors, the free energy differences upon iG-iC replacement are smaller than 0.2 kcal/mol at 37 degrees C, regardless of the number of replacements. For 5'-GC-3'/3'-CG-5', however, each iG--iC replacement adds 0.6 kcal/mol stabilizing free energy at 37 degrees C. Stacking propensities of iG and iC as unpaired nucleotides at the end of a duplex are similar to those of G and C. An NMR structure is reported for r(CiGCGiCG)(2) and found to belong to the A-form family. The structure has substantial deviations from standard A-form but is similar to published NMR and/or crystal structures for r(CGCGCG)(2) and 2'-O-methyl (CGCGCG)(2). These results provide benchmarks for theoretical calculations aimed at understanding the fundamental physical basis for the thermodynamic stabilities of nucleic acid duplexes.     

2-Aminopurine: a probe of structural dynamics and charge transfer in DNA and DNA:RNA hybrids

Spectroscopic techniques are employed to probe relationships between structural dynamics and charge transfer (CT) efficiency in DNA duplexes and DNA:RNA hybrids containing photoexcited 2-aminopurine (Ap). To better understand the variety of interactions and reactions, including CT, between Ap and DNA, the fluorescence behavior of Ap is investigated in a full series of redox-inactive as well as redox-active assemblies. Thus, Ap is developed as a dual reporter of structural dynamics and base-base CT reactions in nucleic acid duplexes. CD, NMR, and thermal denaturation profiles are consistent with the family of DNA duplexes adopting a distinct conformation versus the DNA:RNA hybrids. Fluorescence measurements establish that the d(A)-r(U) tract of the DNA:RNA hybrid exhibits enhanced structural flexibility relative to that of the d(A)-d(T) tract of the DNA duplexes. The yield of CT from either G or 7-deazaguanine (Z) to Ap in the assemblies was determined by comparing Ap emission in redox-active G- or Z-containing duplexes to otherwise identical duplexes in which the G or Z is replaced by inosine (I), the redox-inactive nucleoside analogue. Investigations of CT not only demonstrate efficient intrastrand base-base CT in the DNA:RNA hybrids but also reveal a distance dependence of CT yield that is more shallow through the d(A)-r(U) bridge of the A-form DNA:RNA hybrids than through the d(A)-d(T) bridge of the B-form DNA duplexes. The shallow distance dependence of intrastrand CT in DNA:RNA hybrids correlates with the increased conformational flexibility of bases within the hybrid duplexes. Measurements of interstrand base-base CT provide another means to distinguish between the A- and B-form helices. Significantly, in the A-form DNA:RNA hybrids, a similar distance dependence is obtained for inter- and intrastrand reactions, while, in B-DNA, a more shallow distance dependence is evident with interstrand CT reactions. These observations are consistent with evaluations of intra- and interstrand base overlap in A- versus B-form duplexes. Overall, these data underscore the sensitivity of CT chemistry to nucleic acid structure and structural dynamics.     

GA and AG sequences of DNA react with cisplatin at comparable rates

The sequence selectivity of the antitumor drug cisplatin (cis-[PtCl(2)(NH(3))(2)] (1)) between the 5'-AG-3' and 5'-GA-3' sites of DNA has been a matter of discussion for more than twenty years. In this work, we compared the reactivity of GA and AG sequences of DNA towards the aquated forms of cisplatin (cis-[PtCl(NH(3))(2)(H(2)O)](+) (2), cis-[Pt(NH(3))(2)(H(2)O)(2)](2+) (3), and cis-[Pt(OH)(NH(3))(2)(H(2)O)](+) (4)) using two sets of experiments. In the first, we investigated a DNA hairpin, whose duplex stem contained a TGAT sequence as the single reactive site, and determined the individual rate constants of platination with 2 and 3 for G and A in acidic solution. The rate constants at 20 degrees C in 0.1M NaClO(4) at pH 4.5+/-0.1 were 0.09(4) M(-1)s(-1) (G) and 0.11(3) M(-1)s(-1) (A) for 2, and 9.6(1) M(-1)s(-1) (G) and 1.7(1) M(-1)s(-1) (A) for 3. These values are similar to those obtained previously for an analogous hairpin that contained a TAGT sequence. The monoadducts formed with 2 by both GA purines are extremely long-lived, partly as a result of the slow hydrolysis of the chloro monoadduct at A, and partly because of the very low chelation rate (1.4 x 10(-5)s(-1) at 20 degrees C) of the aqua monoadduct on the guanine. In the second set of experiments, we incubated pure or enriched samples of 1, 2, 3, or 4 for 18-64 h at 25 degrees C with a 19 base pair (bp) DNA duplex, whose radiolabeled top strand contained one GA and one AG sequence as the only reactive sites. Quantification of the number of GA and AG cross-links afforded a ratio of about two in favor of AG, irrespective of the nature of the leaving ligands. These results disagree with a previous NMR spectroscopy study, and indicate that GA sequences of DNA are substantially more susceptible to attack by cisplatin than previously thought.     

Solid-phase synthesis of positively charged deoxynucleic guanidine (DNG) tethering a Hoechst 33258 analogue: triplex and duplex stabilization by simultaneous minor groove binding

Deoxynucleic guanidine (DNG), a DNA analogue in which positively charged guanidine replaces the phosphodiester linkages, tethering to Hoechst 33258 fluorophore by varying lengths has been synthesized. A pentameric thymidine DNG was synthesized on solid phase in the 3' --> 5' direction that allowed stepwise incorporation of straight chain amino acid linkers and a bis-benzimidazole (Hoechst 33258) ligand at the 5'-terminus using PyBOP/HOBt chemistry. The stability of (DNA)(2).DNG-H triplexes and DNA.DNG-H duplexes formed by DNG and DNG-Hoechst 33258 (DNG-H) conjugates with 30-mer double-strand (ds) DNA, d(CGCCGCGCGCGCGAAAAACCCGGCGCGCGC)/d(GCGGCGCGCGCGCTTTTTGGGCCGCGCGCG), and single-strand (ss) DNA, 5'-CGCCGCGCGCGCGAAAAACCCGGCGCGCGC-3', respectively, has been evaluated by thermal melting and fluorescence emission experiments. The presence of tethered Hoechst ligand in the 5'-terminus of the DNG enhances the (DNA)(2).DNG-H triplex stability by a DeltaT(m) of 13 degrees C. The fluorescence emission studies of (DNA)(2).DNG-H triplex complexes show that the DNG moiety of the conjugates bind in the major groove while the Hoechst ligand resides in the A:T rich minor groove of dsDNA. A single G:C base pair mismatch in the target site decreases the (DNA)(2).DNG triplex stability by 11 degrees C, whereas (DNA)(2).DNG-H triplex stability was decreased by 23 degrees C. Inversion of A:T base pair into T:A base pair in the center of the binding site, which provides a mismatch selectively for DNG moiety, decreases the triplex stability by only 5-6 degrees C. Upon hybridization of DNG-Hoechst conjugates with the 30-mer ssDNA, the DNA.DNG-H duplex exhibited significant increase in the fluorescence emission due to the binding of the tethered Hoechst ligand in the generated DNA.DNG minor groove, and the duplex stability was enhanced by DeltaT(m) of 7 degrees C. The stability of (DNA)(2).DNG triplexes and DNA.DNG duplexes is independent of pH, whereas the stability of (DNA)(2).DNG-H triplexes decreases with increase in pH.     

Optimizing the stacking moiety and linker of 2'-acylamido caps of DNA duplexes with 3'-terminal adenine residues

Reported here is the synthesis of oligodeoxynucleotides with a 3'-terminal 2'-acylamido-2'-deoxyadenosine residue. The route to these oligonucleotides employs an N,O-Alloc-protected 5'-phosphoramidite of 2'-amino-2'-deoxyadenosine that was prepared in 11 steps from arabinoadenosine. Small combinatorial libraries of oligonucleotides were generated via acylation with a mixture of linker amino acids and subsequent acylation of their amino groups. Mass spectrometrically monitored nuclease selection assays led to oligonucleotides whose 2'-substituent increases the thermal stability of the DNA duplexes. A linker with three methylene groups between a perylene stacking moiety and the amido group gives a UV-melting point increase of up to 27.9 degrees C for the DNA sequence (TGCGCA*)2, where A* denotes the 2'-acylamidoadenosine residue. The same acylamido group improves mismatch discrimination at the terminal position with a melting point depression of >or=7 degrees C for any of the three mismatches in the target sequence of the octamer 5'-AGGTTGAA-3'. These results demonstrate how even a very weakly base-pairing nucleotide at the 3'-terminus of a DNA probe strand can be enforced to engage in strong and highly sequence-selective base-pairing interactions.     

A ribose sugar conformational switch in the LTR-retrotransposon Ty3 polypurine tract-containing RNA/DNA hybrid

To probe structural features of a polypurine tract (PPT) that mediate its specific recognition and processing, a model 20 bp RNA/DNA hybrid duplex, which includes the full PPT sequence of the Saccharomyces cerevisiae LTR-retrotransposon Ty3, has been investigated using solution NMR spectroscopy. While homonuclear NOESY and DQF-COSY analyses indicate that this PPT-containing RNA/DNA hybrid adopts an overall A-form-like helical geometry, an unexpected sugar pucker switch has been detected for the ribose at position +1, relative to the cleavage site, on the RNA strand. A model of the conformational changes induced by the A- to B-type sugar pucker switch shows a significant change in the backbone trajectory of the RNA strand, which alters the presentation of backbone phosphate and 2' hydroxyl groups 3' of this residue. This observation implies that part of the mechanism governing RNase H fidelity may be through distortion of the RNA/DNA helix one base ahead of the scissile bond.     

5' modification of duplex DNA with a ruthenium electron donor-acceptor pair using solid-phase DNA synthesis

Incorporation of metalated nucleosides into DNA through covalent modification is crucial to measurement of thermal electron-transfer rates and the dependence of these rates with structure, distance, and position. Here, we report the first synthesis of an electron donor-acceptor pair of 5' metallonucleosides and their subsequent incorporation into oligonucleotides using solid-phase DNA synthesis techniques. Large-scale syntheses of metal-containing oligonucleotides are achieved using 5' modified phosporamidites containing [Ru(acac)(2)(IMPy)](2+) (acac is acetylacetonato; IMPy is 2'-iminomethylpyridyl-2'-deoxyuridine) (3) and [Ru(bpy)(2)(IMPy)](2+) (bpy is 2,2'-bipyridine; IMPy is 2'-iminomethylpyridyl-2'-deoxyuridine) (4). Duplexes formed with the metal-containing oligonucleotides exhibit thermal stability comparable to the corresponding unmetalated duplexes (T(m) of modified duplex = 49 degrees C vs T(m) of unmodified duplex = 47 degrees C). Electrochemical (3, E(1/2) = -0.04 V vs NHE; 4, E(1/2) = 1.12 V vs NHE), absorption (3, lambda(max) = 568, 369 nm; 4, lambda(max) = 480 nm), and emission (4, lambda(max) = 720 nm, tau = 55 ns, Phi = 1.2 x 10(-)(4)) data for the ruthenium-modified nucleosides and oligonucleotides indicate that incorporation into an oligonucleotide does not perturb the electronic properties of the ruthenium complex or the DNA significantly. In addition, the absence of any change in the emission properties upon metalated duplex formation suggests that the [Ru(bpy)(2)(IMPy)](2+)[Ru(acac)(2)(IMPy)](2+) pair will provide a valuable probe for DNA-mediated electron-transfer studies.