共查询到20条相似文献,搜索用时 562 毫秒
1.
The adsorption of tris(2,2'-bipyridine)ruthenium(II) ([Ru(bpy)(3)]2+) complex cation into modified mesoporous silicas was investigated. In order to immobilize [Ru(bpy)(3)]2+, the mesopore surface was modified with sulfonic acid groups by the reactions between MCM-41 and phenethyl(dichloro)methylsilane and the subsequent sulfonation of the attached phenethyl groups with chlorosulfonic acid. The modified mesoporous silicas effectively adsorbed [Ru(bpy)(3)]2+ from ethanol solution. It was thought that the effective adsorption was the cause of the cooperative effects of the electrostatic interactions between [Ru(bpy)(3)]2+ cation and sulfonic acid group and the interactions between the phenyl rings on the mesopore surface and the bipyridine rings of the complex. The variation of the position and the intensity of the luminescence of [Ru(bpy)(3)]2+ suggested that the average distance between the adjacent [Ru(bpy)(3)]2+ changed with the loading amounts. 相似文献
2.
Easun TL Alsindi WZ Towrie M Ronayne KL Sun XZ Ward MD George MW 《Inorganic chemistry》2008,47(12):5071-5078
The dyad RuLRe contains (Re(bpy)(CO)3Cl) and (Ru(bpy)(bpyam)2)2+ termini (bpy = 2,2'-bipyridine; bpyam = 4,4'-diethylamido-2,2'-bipyridine) separated by a flexible ethylene spacer. Luminescence studies reveal the expected Re --> Ru photoinduced energy transfer, with partial quenching of Re(I)-based triplet metal-to-ligand charge-transfer (3MLCT) luminescence and consequent sensitization of the Ru(II)-based 3MLCT luminescence, which has a component with a grow-in lifetime of 0.76 (+/-0.2) ns. The presence of IR-active spectroscopic handles on both termini [CO ligands directly attached to Re(I) and amide carbonyl substituents on the bpy ligands coordinated to Ru(II)] allowed the excited-state dynamics to be studied by time-resolved IR (TRIR) spectroscopy in much more detail than allowed by luminescence methods. A combination of picosecond- and nanosecond-time-scale TRIR studies revealed the presence of at least three distinct Re --> Ru energy-transfer processes, with lifetimes of ca. 20 ps and 1 and 13 ns. This complex behavior occurs because of a combination of two different Ru-based 3MLCT states (Ru --> L and Ru --> bpyam), which are sensitized by energy transfer from the Re(I) donor at different rates; and the presence of at least two conformers of the flexible molecule RuLRe, which have different Re...Ru separations. 相似文献
3.
Spillane CB Morgan JL Fletcher NC Collins JG Keene FR 《Dalton transactions (Cambridge, England : 2003)》2006,(25):3122-3133
The two enantiomers of [Ru(bpy)2(bbtb)]2+{bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the Lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+{Me(2)bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association with hairpin oligonucleotides, again with the Lambda enantiomer binding more strongly. A (1)H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents. 相似文献
4.
The intervalence charge transfer (IVCT) properties of the mixed-valence forms of the diastereoisomers of the dinuclear [[Ru(bpy)2](mu-HAT)[M(bpy)2]]5+ (M = Ru or Os) complexes and the trinuclear heterochiral [[Ru(bpy)2]2[Os(bpy)2](mu-HAT)]n+ (n = 7, 8; HAT = 1,4,5,8,9,12-hexaazatriphenylene; bpy = 2,2'-bipyridine) species display a marked dependence on the nuclearity and extent of oxidation of the assemblies, while small differences are also observed for the diastereoisomers of the same complex in the dinuclear cases. The mixed-valence heterochiral [[Ru(bpy)2]2[Os(bpy)2](mu-HAT)]n+ (n = 7, 8) forms exhibit IVCT properties that are intermediate between those of the diastereoisomeric forms of the localized hetero-dinuclear complex [[Ru(bpy)2](mu-HAT)[Os(bpy)2]]5+ and the borderline localized-to-delocalized homo-trinuclear complex [[Ru(bpy)2]3(mu-HAT)]n+ (n = 7, 8). The near-infrared (NIR) spectrum of the +7 mixed-valence species exhibits both interconfigurational (IC) and IVCT transitions which are quantitatively similar to those in [[Ru(bpy)2](mu-HAT)[Os(bpy)2]]5+ and are indicative of the localized mixed-valence formulation [[Ru(II)(bpy)2]2[Os(III)(bpy)2](mu-HAT)]7+. The +8 state exhibits a new band attributable to an IVCT transition in the near-infrared region. 相似文献
5.
Huynh MH Baker RT Jameson DL Labouriau A Meyer TJ 《Journal of the American Chemical Society》2002,124(17):4580-4582
Reactions between the Os(VI)-nitrido complexes, [OsVI(L2)(Cl)3(N)] (L2 = 2,2'-bipyridine (bpy) ([1]), 4,4'-dimethyl-2,2'-bipyridine (Me2bpy), 1,10-phenanthroline (phen), and 4,7-diphenyl-1,10-phenanthroline (Ph2phen)), and bis-(triphenylphosphoranylidene)ammonium azide (PPNN3) in dry CH3CN at 60 degrees C under N2 give the corresponding Os(IV)-azidoimido complexes, [OsIV(L2)(Cl)3(NN3)]- (L2 = bpy = [2]-, L2 = Me2bpy = [3]-, L2 = phen = [4]-, and L2 = Ph2phen = [5]-) as their PPN+ salts. The formulation of the N42- ligand has been substantiated by 15N-labeling, IR, and 15N NMR measurements. Hydroxylation of [2]- at Nalpha with O<--NMe3.3H2O occurs to give the Os(IV)-azidohydroxoamido complex, [OsIV(bpy)(Cl)3(N(OH)N3)] ([6]), which, when deprotonated, undergoes dinitrogen elimination to give the Os(II)-dinitrogen oxide complex, [OsII(bpy)(Cl)3(N2O)]- ([7]-). They are the first well-characterized examples of each kind of complex for Os. 相似文献
6.
A Das TM Scherer SM Mobin W Kaim GK Lahiri 《Chemistry (Weinheim an der Bergstrasse, Germany)》2012,18(35):11007-11018
Based on data from more than 40 crystal structures of metal complexes with azo-based bridging ligands (2,2'-azobispyridine, 2,2'-azobis(5-chloropyrimidine), azodicarbonyl derivatives), a correlation between the N?N bond lengths (d(NN) ) and the oxidation state of the ligand (neutral, neutral/back-donating, radical-anionic, dianionic) was derived. This correlation was applied to the analysis of four ruthenium compounds of 2,2'-azobispyridine (abpy), that is, the new asymmetrical rac-[(acac)(2) Ru1(μ-abpy)Ru2(bpy)(2) ](ClO(4) )(2) ([1](ClO(4) )(2) ), [Ru(acac)(2) (abpy)] (2), [Ru(bpy)(2) (abpy)](ClO(4) )(2) ([3](ClO(4) )(2) ), and meso-[(bpy)(2) Ru(μ-abpy)Ru(bpy)(2) ](ClO(4) )(3) ([4](ClO(4) )(3) ; acac(-) =2,4-pentanedionato, bpy=2,2'-bipyridine). In agreement with DFT calculations, both mononuclear species 2 and 3(2+) can be described as ruthenium(II) complexes of unreduced abpy(0) , with 1.295(5)相似文献
7.
Ozawa H Yokoyama Y Haga MA Sakai K 《Dalton transactions (Cambridge, England : 2003)》2007,(12):1197-1206
The photo-hydrogen-evolving activity (activity to enhance the photochemical EDTA-reduction of water into molecular hydrogen) was evaluated for three different Ru(II)Pt(II) dimers with a general formula of [(bpy)2Ru(micro-bridge)PtCl2]2+(bpy = 2,2'-bipyridine; bridge = 4,4'-bis(N-(3-aminopropyl)carbamoyl)-2,2'-bipyridine (L1), 2,3-bis(2-pyridyl)pyrazine (L2), and 4,4'-bis(N-(4-pyridyl)methylcarbamoyl)-2,2'-bipyridine (L3); EDTA = ethylenediaminetetraacetic acid disodium salt). A new Ru(II)Pt(II) complex, [(bpy)2Ru(micro-L3)PtCl2]2+, was synthesized and characterized. It was confirmed that all three compounds are ineffective towards photochemical H2 production. In each case, an acetate-buffer solution (pH = 5) containing the Ru(II)Pt(II) dimer and EDTA was photolysed using a 350-W Xe lamp under an Ar atmosphere, during which the amount of H2 evolved was analysed by gas chromatography. Additional photolysis experiments were carried out by adding [Ru(bpy)3]2+ and methylviologen (N,N'-dimethyl-4,4'-bipyridinium) to the photolysis solutions described above to test the H2-evolving activity of the Pt(II) unit involved in these Ru(II)Pt(II) dimers. As a result, the Pt(II) units involved in the L1 and L2 compounds were found to be active as an H2-evolving catalyst, while that of the L3 compound was found to show no activity at all. The extent of intramolecular electron-transfer quenching from the 3MLCT excited state of the [Ru(bpy)3]2+ derivative to the tethering Pt(II) catalyst centre was investigated by comparison of the luminescence spectra of these compounds, together with the related compounds. The results showed that the quenching of the 3MLCT luminescence is not at all enhanced in either the L1 or the L3 compounds. On the other hand, the L2 compound is strongly quenched as previously reported. In addition to the above studies, the H2-evolving activity of some Pt(II) monomers, cis-PtCl2(NH3)2, PtCl2(en)(en = ethylenediamine), cis-PtCl2(4-methylpyridine)2, PtCl2(2,2'-bipyrimidine), PtCl2(4,4'-dicarboxy-2,2'-bipyridine), and [PtCl(terpy)]+(terpy = 2,2':6',2'-terpyridine), were similarly investigated in the presence of EDTA, [Ru(bpy)3]2+ and methylviologen, since they were regarded as structural analogues of the Pt(II) units involved in the L1-L3 compounds. The compounds having a cis-Pt(II)Cl2 unit were generally found to show high H2-evolving activity. This was interpreted in terms of the ligation of negatively charged chloride anions leading to the destabilization of the Pt(II) dz2 orbital responsible for the hydrogenic activation. Importantly, cis-PtCl2(4-methylpyridine)2 exhibited relatively high activity as an H2-evolving catalyst, suggesting the importance of the flexible rotation of the pyridyl ligands for efficient hydrogenic activation at the axial site of the Pt(II) ion. The DFT calculations also showed the validity of the structure-activity relationship discussed above for the L3 compound. 相似文献
8.
Kepert CM Deacon GB Sahely N Spiccia L Fallon GD Skelton BW White AH 《Inorganic chemistry》2004,43(9):2818-2827
The reactions of bidentate diimine ligands (L2) with binuclear [Ru(L1)(CO)Cl2]2 complexes [L1 not equal to L2 = 2,2'-bipyridine (bpy), 4,4'-dimethyl-2,2'-bipyridine (4,4'-Me2bpy), 5,5'-dimethyl-2,2'-bipyridine (5,5'-Me2bpy), 1,10-phenanthroline (phen), 4,7-dimethyl-1,10-phenanthroline (4,7-Me2phen), 5,6-dimethyl-1,10-phenanthroline (5,6-Me2phen), di(2-pyridyl)ketone (dpk), di(2-pyridyl)amine (dpa)] result in cleavage of the dichloride bridge and the formation of cationic [Ru(L1)(L2)(CO)Cl]+ complexes. In addition to spectroscopic characterization, the structures of the [Ru(bpy)(phen)(CO)Cl]+, [Ru(4,4'-Me2bpy)(5,6-Me2phen)(CO)Cl]+ (as two polymorphs), [Ru(4,4'-Me2bpy)(4,7-Me2phen)(CO)Cl]+, [Ru(bpy)(dpa)(CO)Cl]+, [Ru(5,5'-Me2bpy)(dpa)(CO)Cl]+, [Ru(bpy)(dpk)(CO)Cl]+, and [Ru(4,4'-Me2bpy)(dpk)(CO)Cl]+ cations were confirmed by single crystal X-ray diffraction studies. In each case, the structurally characterized complex had the carbonyl ligand trans to a nitrogen from the incoming diimine ligand, these complexes corresponding to the main isomers isolated from the reaction mixtures. The synthesis of [Ru(4,4'-Me2bpy)(5,6-Me2bpy)(CO)(NO3)]+ from [Ru(4,4'-Me2bpy)(5,6-Me2bpy)(CO)Cl]+ and AgNO3 demonstrates that exchange of the chloro ligand can be achieved. 相似文献
9.
The oxidation of benzaldehyde and several of its derivatives to their carboxylic acids by cis-[Ru(IV)(bpy)2(py)(O)]2+ (Ru(IV)=O2+; bpy is 2,2'-bipyridine, py is pyridine), cis-[Ru(III)(bpy)2(py)(OH)]2+ (Ru(III)-OH2+), and [Ru(IV)(tpy)(bpy)(O)]2+ (tpy is 2,2':6',2'-terpyridine) in acetonitrile and water has been investigated using a variety of techniques. Several lines of evidence support a one-electron hydrogen-atom transfer (HAT) mechanism for the redox step in the oxidation of benzaldehyde. They include (i) moderate k(C-H)/k(C-D) kinetic isotope effects of 8.1 +/- 0.3 in CH3CN, 9.4 +/- 0.4 in H2O, and 7.2 +/- 0.8 in D2O; (ii) a low k(H2O/D2O) kinetic isotope effect of 1.2 +/- 0.1; (iii) a decrease in rate constant by a factor of only approximately 5 in CH3CN and approximately 8 in H2O for the oxidation of benzaldehyde by cis-[Ru(III)(bpy)2(py)(OH)]2+ compared to cis-[Ru(IV)(bpy)2(py)(O)]2+; (iv) the appearance of cis-[Ru(III)(bpy)2(py)(OH)]2+ rather than cis-[Ru(II)(bpy)2(py)(OH2)]2+ as the initial product; and (v) the small rho value of -0.65 +/- 0.03 in a Hammett plot of log k vs sigma in the oxidation of a series of aldehydes. A mechanism is proposed for the process occurring in the absence of O2 involving (i) preassociation of the reactants, (ii) H-atom transfer to Ru(IV)=O2+ to give Ru(III)-OH2+ and PhCO, (iii) capture of PhCO by Ru(III)-OH2+ to give Ru(II)-OC(O)Ph+ and H+, and (iv) solvolysis to give cis-[Ru(II)(bpy)2(py)(NCCH3)]2+ or the aqua complex and the carboxylic acid as products. 相似文献
10.
Song LQ Feng J Wang XS Yu JH Hou YJ Xie PH Zhang BW Xiang JF Ai XC Zhang JP 《Inorganic chemistry》2003,42(11):3393-3395
The unique behavior of a new Ru(II) diimine complex, Ru(bpy)(2)(L)(2+) (where L is 4-methyl-4'-[p-(dimethyl- amino)-alpha-styryl]-2,2'-bipyridine, bpy is 2,2'-bipyridine), was studied in detail. Due to the strong electron donating property of the amino group, an ILCT (intraligand charge transfer) state is involved either in the absorption spectra or in the time-resolved emission spectra. Dual emission based on (3)MLCT and (3)ILCT states was observed at room temperature for the first time via a time-resolved technique in Ru(II) diimine complexes. 相似文献
11.
The new heteroditopic ligand 2,3-dihydroxy-N-(1,10-phenanthroline-5-yl)benzamide (H2-L3) was synthesized and coordinated to [Ru(bpy)2(phen)]2+- and [ReBr(CO)3(phen)]-type luminophores (bpy = 2,2'-bipyridine and phen = 1,10-phenanthroline). The resulting chemosensors [Ru(bpy)2(H2-L3)]2+ and [ReBr(CO)3(H2-L3)] were fully characterized and their solid-state structures and spectroscopic properties were investigated to assess how the photophysical properties of the luminescent signaling units affect the performance of the sensors. [Ru(bpy)2(H2-L3)]2+ and [ReBr(CO)3(H2-L3)] both signal the presence and concentration of molybdate and vanadate in aqueous acetonitrile through a decrease in emission intensity. [ReBr(CO)3(H2-L3)] also detects tungstate. Due to the higher emission intensity of the Ru-based sensor, its detection limits for molybdate (43 microg L(-1)) and vanadate (24 microg L(-1)) are almost 1 order of magnitude lower than the ones achieved with the Re-based sensor. The optimum working pH of the chemosensors is determined by the pKa values of the 2-hydroxy-groups of the receptor units: pH 4 for [ReBr(CO)3(H2-L3)] and pH 3 for [Ru(bpy)2(H2-L3)]2+. Both sensors are selective: equimolar amounts of PO4(3-), SO4(2-), ReO4-, Mn(II), Fe(III), Co(II), Ni(II), Cu(II), and Zn(II) do not interfere with the detection of molybdate or vanadate. 相似文献
12.
Ehret F Bubrin M Hübner R Schweinfurth D Hartenbach I Záliš S Kaim W 《Inorganic chemistry》2012,51(11):6237-6244
The series of 4-center unsaturated chelate ligands A═B-C═D with redox activity to yield (-)A-B═C-D(-) in two steps has been complemented by two new combinations RNNC(R')E, E = O or S, R = R' = Ph. The ligands N-benzoyl-N'-phenyldiazene = L(O), and N-thiobenzoyl-N'-phenyldiazene = L(S), (obtained in situ) form structurally characterized compounds [(acac)(2)Ru(L)], 1 with L = L(O), and 3 with L = L(S), and [(bpy)(2)Ru(L)](PF(6)), 2(PF(6)) with L = L(O), and 4(PF(6)) with L = L(S) (acac(-) = 2,4-pentanedionato; bpy = 2,2'-bipyridine). According to spectroscopy and the N-N distances around 1.35 ? and N-C bond lengths of about 1.33 ?, all complexes involve the monoanionic (radical) ligand form. For 1 and 3, the antiferromagnetic spin-spin coupling with electron transfer-generated Ru(III) leads to diamagnetic ground states of the neutral complexes, whereas the cations 2(+) and 4(+) are EPR-active radical ligand complexes of Ru(II). The complexes are reduced and oxidized in reversible one-electron steps. Electron paramagnetic resonance (EPR) and UV-vis-NIR spectroelectrochemistry in conjunction with time-dependent density functional theory (TD-DFT) calculations allowed us to assign the electronic transitions in the redox series, revealing mostly ligand-centered electron transfer: [(acac)(2)Ru(III)(L(0))](+) ? [(acac)(2)Ru(III)(L(?-))] ? [(acac)(2)Ru(III)(L(2-))](-)/[(acac)(2)Ru(II)(L(?-))](-), and [(bpy)(2)Ru(III)(L(?-))](2+)/[(bpy)(2)Ru(II)(L(0))](2+) ? [(bpy)(2)Ru(II)(L(?-))](+) ? [(bpy)(2)Ru(II)(L(2-))](0). The differences between the O and S containing compounds are rather small in comparison to the effects of the ancillary ligands, acac(-) versus bpy. 相似文献
13.
Naokazu Yoshikawa Takeko Matsumura-Inoue Nobuko Kanehisa Yasushi Kai Hiroshi Takashima Keiichi Tsukahara 《Analytical sciences》2004,20(12):1639-1644
Hexafluorophosphate salts of mononuclear complexes [Ru(II)Cl(L)(terpy)]+ (L = dmbpy (1); dpbpy (2), sambpy (3), and dpp (7), and binuclear complexes [Ru(II)2Cl2(dpp)(terpy)2]2+ (8) and [Ir(III)Ru(II)Cl2(dpp)(terpy)2]3+ (9) were prepared and characterized. Abbreviations of the ligands are bpy = 2,2'-bipyridine, dmbpy = 4,4'-dimethyl-2,2'-bipyridine, dpbpy = 4,4'-diphenyl-2,2'-bipyridine, dpp = 2,3-bis(2-pyridyl)pyrazine, sambpy = 4,4'-bis((S)-(+)-alpha-1-phenylethylamido)-2,2'-bipyridine, and terpy = 2,2':6',2'-terpyridine. The absorption spectra of 8 and 9 are dominated by ligand-centered bands in the UV region and by metal-to-ligand charge-transfer bands in the visible region. The details of their spectroscopic and electrochemical properties were investigated. In both binuclear complexes, it has been found that the HOMO is based on the Ru metal, and LUMO is dpp-based. [Ir(III)Ru(II)Cl2(dpp)(terpy)2]3+, indicating intense emission at room temperature, and a lifetime of 154 ns. The long lifetime of this bimetallic chromophore makes it a useful component in the design of supramolecular complexes. 相似文献
14.
Gao J Wang ZP Yuan CL Jia HS Wang KZ 《Spectrochimica acta. Part A, Molecular and biomolecular spectroscopy》2011,79(5):1815-1822
A new Ru(II) complex of [Ru(bpy)2(Hmspip)]Cl2 {in which bpy=2,2'-bipyridine, Hmspip=2-(4-(methylsulfonyl)phenyl)-1H-imidazo[4,5-f][1,10]phenanthroline} have been synthesized and characterized. The ground- and excited-state acid-base properties of [Ru(bpy)2(Hmspip)]Cl2 and its parent complex of [Ru(bpy)2(Hpip)]Cl2 {Hpip=2-phenyl-1H-imidazo[4,5-f][1,10]phenanthroline} have been studied by UV-visible (UV-vis) and emission spectrophotometric pH titrations. [Ru(bpy)2(Hmspip)]Cl2 acts as a calf thymus DNA intercalators with a binding constant of 4.0×10(5) M(-1) in buffered 50 mM NaCl, as evidenced by UV-vis and luminescence titrations, steady-state emission quenching by [Fe(CN)6]4-, DNA competitive binding with ethidium bromide, reverse salt titrations and viscosity measurements. 相似文献
15.
Spillane CB Smith JA Buck DP Collins JG Keene FR 《Dalton transactions (Cambridge, England : 2003)》2007,(45):5290-5296
1H NMR spectroscopy and molecular modelling have been used to investigate the binding of the DeltaDelta-and LambdaLambda-enantiomers of the dinuclear ruthenium(II) complex [[Ru(Me2bpy)2]2(mu-bpm)]4+ [Me2bpy = 4,4'-dimethyl-2,2'-bipyridine; bpm = 2,2'-bipyrimidine] to an RNA tridecanucleotide duplex containing a single-base bulge [r(CCGAGAAUUCCGG)2]], and the corresponding control dodecanucleotide [r(CCGGAAUUCCGG)2]. Both enantiomers bound the control RNA sequence weakly. From upfield shifts of the metal complex H3 and H3' protons throughout the titration of the control dodecanucleotide with DeltaDelta-[[Ru(Me2bpy)2]2(mu-bpm)]4+, a binding constant of 1 x 10(3) M(-1) was determined. In NOESY spectra of the control sequence with added DeltaDelta-[[Ru(Me2bpy)2]2(mu-bpm)]4+, NOEs were only observed to protons from the terminal base-pair residues. No significant changes in chemical shift were observed for either the metal complex or RNA protons upon addition of the LambdaLambda-enantiomer to the control dodecanucleotide. The DeltaDelta-[[Ru(Me2bpy)2]2(mu-bpm)]4+ complex bound the bulge-containing RNA with a significantly greater affinity (6 x 10(4) M(-1)) than the non-bulge control RNA duplex. Competition binding experiments indicated that the LambdaLambda-isomer bound the tridecanucleotide with similar affinity to the DeltaDelta-enantiomer. Addition of DeltaDelta-[[Ru(Me2bpy)2]2(mu-bpm)]4+ to the bulge-containing tridecanucleotide induced selective changes in chemical shift for the base H8 and sugar H1' resonances from the adenine bulge residue, and resonances from nucleotide residues adjacent to the bulge site. Intermolecular NOEs observed in NOESY spectra of the tridecanucleotide with added DeltaDelta-[[Ru(Me2bpy)2]2(mu-bpm)]4+ confirmed the selective binding of the ruthenium complex at the bulge site. Preliminary binding models, consistent with the NMR data, showed that the ruthenium complex could effectively associate in the RNA minor groove at the bulge site. 相似文献
16.
Patra S Sarkar B Maji S Fiedler J Urbanos FA Jimenez-Aparicio R Kaim W Lahiri GK 《Chemistry (Weinheim an der Bergstrasse, Germany)》2005,12(2):489-498
The new compounds [(acac)2Ru(mu-boptz)Ru(acac)2] (1), [(bpy)2Ru(mu-boptz)Ru(bpy)2](ClO4)2 (2-(ClO4)2), and [(pap)2Ru(mu-boptz)Ru(pap)2](ClO4)2 (3-(ClO4)2) were obtained from 3,6-bis(2-hydroxyphenyl)-1,2,4,5-tetrazine (H2boptz), the crystal structure analysis of which is reported. Compound 1 contains two antiferromagnetically coupled (J = -36.7 cm(-1)) Ru(III) centers. We have investigated the role of both the donor and acceptor functions containing the boptz2- bridging ligand in combination with the electronically different ancillary ligands (donating acac-, moderately pi-accepting bpy, and strongly pi-accepting pap; acac = acetylacetonate, bpy = 2,2'-bipyridine pap = 2-phenylazopyridine) by using cyclic voltammetry, spectroelectrochemistry and electron paramagnetic resonance (EPR) spectroscopy for several in situ accessible redox states. We found that metal-ligand-metal oxidation state combinations remain invariant to ancillary ligand change in some instances; however, three isoelectronic paramagnetic cores Ru(mu-boptz)Ru showed remarkable differences. The excellent tolerance of the bpy co-ligand for both Ru(III) and Ru(II) is demonstrated by the adoption of the mixed-valent form in [L2Ru(mu-boptz)RuL2]3+, L = bpy, whereas the corresponding system with pap stabilizes the Ru(II) states to yield a phenoxyl radical ligand and the compound with L = acac- contains two Ru(III) centers connected by a tetrazine radical-anion bridge. 相似文献
17.
Neutral ruthenium(II) complexes [RuLL'(CN)2] (L, L' = bpy, dmb, dbb; bpy = 2,2'-bipyridine, dmb = 4,4'-dimethyl-2,2'-bipyridine, dbb = 4,4'-tert-butyl-2,2'-bipyridine) were prepared, and the luminescence characteristics of the complexes in the solid state were measured. The luminescence was tuned by crystal waters included in the crystals; for example, [Ru(dbb)2(CN)2] x 2H2O, [Ru(dbb)2(CN)2] x H2O, and [Ru(dbb)2(CN)2] emit luminescence at 640, 685, and 740 nm, respectively. 相似文献
18.
Gholamkhass B Mametsuka H Koike K Tanabe T Furue M Ishitani O 《Inorganic chemistry》2005,44(7):2326-2336
We study the electrochemical, spectroscopic, and photocatalytic properties of a series of Ru(II)-Re(I) binuclear complexes linked by bridging ligands 1,3-bis(4'-methyl-[2,2']bipyridinyl-4-yl)propan-2-ol (bpyC3bpy) and 4-methyl-4'-[1,10]phenanthroline-[5,6-d]imidazol-2-yl)bipyridine (mfibpy) and a tetranuclear complex in which three [Re(CO)3Cl] moieties are coordinated to the central Ru using the bpyC3bpy ligands. In the bpyC3bpy binuclear complexes, 4,4'-dimethyl-2,2'-bipyridine (dmb) and 4,4'-bis(trifluoromethyl)-2,2'-bipyridine ({CF3}2bpy), as well as 2,2'-bipyridine (bpy), were used as peripheral ligands on the Ru moiety. Greatly improved photocatalytic activities were obtained only in the cases of [Ru{bpyC3bpyRe(CO)3Cl}3]2+ (RuRe3) and the binuclear complex [(dmb)2Ru(bpyC3bpy)Re(CO)3Cl]2+ (d2Ru-Re), while photocatalytic responses were extended further into the visible region. The excited state of ruthenium in all Ru-Re complexes was efficiently quenched by 1-benzyl-1,4-dihydronicotinamide (BNAH). Following reductive quenching in the case of d2Ru-Re, generation of the one-electron-reduced (OER) species, for which the added electron resides on the Ru-bound bpy end of the bridging ligand bpyC3bpy, was confirmed by transient absorption spectroscopy. The reduced Re moiety was produced via a relatively slow intramolecular electron transfer, from the reduced Ru-bound bpy to the Re site, occurring at an exchange rate (DeltaG approximately 0). Electron transfer need not be rapid, since the rate-determining process is reduction of CO2 with the OER species of the Re site. Comparison of these results with those for other bimetallic systems gives us more general architectural pointers for constructing supramolecular photocatalysts for CO2 reduction. 相似文献
19.
Gallagher LA Serron SA Wen X Hornstein BJ Dattelbaum DM Schoonover JR Meyer TJ 《Inorganic chemistry》2005,44(6):2089-2097
Photocurrent measurements have been made on nanocrystalline TiO2 surfaces derivatized by adsorption of a catalyst precursor, [Ru(tpy)(bpy(PO3H2)2)(OH2)]2+, or chromophore, [Ru(bpy)2 (bpy(PO3H2)2)]2+ (tpy is 2,2':6',2' '-terpyridine, bpy is 2,2'-bipyridine, and bpy(PO3H2)2 is 2,2'-bipyridyl-4,4'-diphosphonic acid), and on surfaces containing both complexes. This is an extension of earlier work on an adsorbed assembly containing both catalyst and chromophore. The experiments were carried out with the I3-/I- or quinone/hydroquinone (Q/H2Q) relays in propylene carbonate, propylene carbonate-water mixtures, and acetonitrile-water mixtures. Electrochemical measurements show that oxidation of surface-bound Ru(III)-OH2(3+) to Ru(IV)=O(2+) is catalyzed by the bpy complex. Addition of aqueous 0.1 M HClO4 greatly decreases photocurrent efficiencies for adsorbed [Ru(tpy)(bpy(PO3H2)2)(OH2)]2+ with the I3-/I- relay, but efficiencies are enhanced for the Q/H2Q relay in both propylene carbonate-HClO4 and acetonitrile-HClO4 mixtures. The dependence of the incident photon-to-current efficiency (IPCE) on added H2Q in 95% propylene carbonate and 5% 0.1 M HClO4 is complex and can be interpreted as changing from rate-limiting diffusion to the film at low H2Q to rate-limiting diffusion within the film at high H2Q. There is no evidence for photoelectrochemical cooperativity on mixed surfaces containing both complexes with the IPCE response reflecting the relative surface compositions of the two complexes. These results provide insight into the possible design of photoelectrochemical synthesis cells for the oxidation of organic substrates. 相似文献
20.
The reaction of [Ru(solvent)2(bpy)2]2+ (bpy = 2,2'-bipyridine) with Haet (2-aminoethanethiol) in ethanol/water in the presence of Ag+ gave a thiolato-bridged RuIIAgIRuII trinuclear complex, [Ag{Ru(aet)(bpy)2}2]3+, in which two [RuII(aet)(bpy)2]+ units are linked by an AgI atom. When this complex was treated with HCl in acetonitrile/water, a disulfide-bridged RuIIRuII dinuclear complex, [Ru2(cysta)(bpy)4]4+ (cysta = cystamine), was produced as a result of the removal of an AgI atom and the autoxidation of thiolato groups. It was found that the dinuclear structure in [Ru2(cysta)(bpy)4]4+ is reverted back to [Ag{Ru(aet)(bpy)2}2]3+ by treatment with Ag+ assisted by Zn reduction. 相似文献