Differential binding of Mg2+, Zn2+, and Cd2+ at two sites in a hammerhead ribozyme motif, determined by 15N NMR

A decamer duplex model of Domain II of the hammerhead ribozyme was synthesized with [8-13C-1,7,NH2-15N3]-guanosine at the known metal binding site, G10.1 and, for comparison, [2-13C-1,7,NH2-15N3]-guanosine at G16.2. The 15N NMR chemical shifts of the labeled N7s monitored during addition of Mg2+, Cd2+, and Zn2+ showed the same preference for binding at G10.1 over G16.2 for each metal. These results demonstrate that 15N labeling can be used to evaluate the binding of different metals, including Mg2+, to a given nitrogen, as well as to compare the binding potential of different sites.     

Use of 13C as an indirect tag in 15N specifically labeled nucleosides. Syntheses of [8-13C-1,7,NH2-15N3]adenosine, -guanosine, and their deoxy analogues

We have previously reported the use of a 13C tag at the C2 of 15N-multilabeled purine nucleosides to distinguish the adjacent-labeled 15N atoms from those in an untagged nucleoside. We now introduce the use of an indirect tag at the C8 of 15N7-labeled purine nucleosides. This tag allows unambiguous differentiation between a pair of 15N7-labeled purines in which only one is 13C8 labeled. Although the very small C8-N7 coupling (<1 Hz) precludes its direct detection in 1D 15N spectra, 2D 1H-15N NMR experiments display the large C8-H8 coupling (>200 Hz) because H8 is coupled to both N7 and C8. The 13C8 atom is introduced by means of a ring closure of the exocyclic amino groups of a pyrimidinone using [13C]sodium ethyl xanthate. Here, we present methods for the syntheses of [8-13C-1,7,NH2-15N3]adenosine, -guanosine, and their deoxy analogues.     

Investigation of the copper binding site on the human islet amyloid polypeptide hormone

The metal ion binding sites of human islet amyloid polypeptide (hIAPP) have been investigated to explain the biological activity difference in the fibril formation process. The structures of [hIAPP...Cu (or Al)](n+) and [hIAPP17-30...Cu]2+ complex were investigated by electrospray ionization-mass spectrometry (ESI-MS). The fragmentation patterns of [hIAPP...Cu [or Al)](n+) and [hIAPP17-30...Cu]2+ complex were analyzed by tandem mass spectrometry (MS/MS) and multi-stage mass spectrometry (MS3) spectra. The [hIAPP+Cu+H]3+, [hIAPP+Al+H]4+ and [hIAPP17-30+Cu]2+ complexes were observed in MS spectra. The Cu binding site of hIAPP is suggested to be the N22-F-G-A-I26 part for the [hIAPP+Cu+H]3+ gas-phase complex. The original hIAPP conformation was supposed to be changed by the interaction between the Cu ion and the N22-F-G-A-I26 part in the [hIAPP+Cu+H]3+ gas-phase complex.     

Favorable pendant-amino metal chelation in VX nerve agent model systems

We have performed DFT computational studies [B3LYP, 6-31+G] to obtain metal ion coordination isomers of VX-Me [MeP(O)(OMe)(SCH2CH2NMe2)], a model of two of the most lethal nerve agents: VX [MeP(O)(OEt)(SCH2CH2N(iPr)2)] and Russian-VX [MeP(O)(OCH2CHMe2)(SCH2CH2N(Et)2)]. Our calculations involved geometry optimizations of the neutral VX-Me model as well as complexes with H+, Li+, Na+, K+, Be2+, Mg2+, and Ca2+ that yielded 2-8 different stable chelation modes for each ion that involved mainly mono- and bidentate binding. Importantly, our studies revealed that the [O(P),N] bidentate binding mode, long thought to be the active mode in differentiating the hydrolytic path of VX from other nerve agents, was the most stable for all ions studied here. Binding energy depended mainly on ionic size as well as charge, with binding energies ranging from 364 kcal mol(-1) for Be2+ to 33 kcal mol(-1) for K+. Furthermore, calculated NMR shifts for VX-Me correlate to experimental values of VX.     

Binding Equilibrium Studies Between Co2+ and HAS or BSA

Introduction Up to now,the interactions of Cu2+,Ni2+ and Zn2+ with serum albumin have been extensively studied[1-3].However,the interaction of serum with Co2+ has rarely been studied.Our study of Co2+-HSA by means of charge transfer spectra indicated that the metal center took an octahedron configuration and the binding site was probably located at the tripeptide segment of the N-terminal of albumin[4].Sadler et al.[5]has reported that the binding site of Co2+ in HSA is located at the tripeptide segment of HSA involving the four nitrogen atoms and a carboxyl oxygen atom of Aspl.In this paper the interaction of HSA and BSA with Co2+ at physiological pH is further studied by equilibrium dialysis.The number of binding sites and the cooperation among the binding sites are reported.According to the equilibrium dialysis results and the study of competition between Co2+ and Cu2+,Ca2+ or Zn2+ to be bound to HSA or BSA,it is suggested that there are three strong binding sites in both HSA and BSA.The possible locations of the strong binding sites of Co2+ in HSA and BSA have also been determined.     

Magnetism of cyano-bridged Ln3+-M3+ complexes. Part II: one-dimensional complexes (Ln3+ = Eu, Tb, Dy, Ho, Er, Tm; M3+ = Fe or Co) with bpy as blocking ligand

The reaction of Ln(NO3)3(aq) with K3[Fe(CN)6] or K3[Co(CN)6] and 2,2'-bipyridine in water/ethanol led to 13 one-dimensional complexes: trans-[M(CN)4(mu-CN)2Ln(H2O)4(bpy)]n.4nH2O.1.5nbpy (Ln = Eu3+, Tb3+, Dy3+, Ho3+, Er3+, Tm3+, Lu3+; M = Fe3+, Co3+). The structures for [EuFe]n (1), [TbFe]n (2), [DyFe]n (3), [HoFe]n (4), [ErFe]n (5), [TmFe]n (6), [LuFe]n (7), [EuCo]n (8), [TbCo]n (9), [DyCo]n (10), [HoCo]n (11), [ErCo]n (12), and [TmCo]n (13) have been solved: they crystallize in the triclinic space group P and are isomorphous. They exhibit a supramolecular architecture created by the interplay of coordinative, hydrogen bonding, and pi-pi interactions. A stereochemical study of the eight-vertex polyhedra of the lanthanide ions, based on continuous shape measures, is presented. The Ln3+-Fe3+ interaction is antiferromagnetic in [DyFe]n and [TbFe]n. For [EuFe]n, [HoFe]n, [ErFe]n, and [TmFe]n, there is no sign of any significant interaction. The magnetic behavior of [DyFe]n suggests the onset of weak long-range ferromagnetic ordering at 2.5 K.     

Magnetic properties of cyano-bridged Ln3+-M3+ complexes. Part I: trinuclear complexes (Ln3+ = La, Ce, Pr, Nd, Sm; M3+ = FeLS, Co) with bpy as blocking ligand

The reaction of Ln(NO3)3(aq) with K3[Fe(CN)6] or K3[Co(CN)6] and 2,2'-bipyridine in water/ethanol led to eight trinuclear complexes: trans-[M(CN)4(mu-CN)2{Ln(H2O)4(bpy)2}2][M(CN)6].8H2O (M = Fe3+ or Co3+, Ln = La3+, Ce3+, Pr3+, Nd3+, and Sm3+). The structures for the eight complexes [La2Fe] (1), [Ce2Fe] (2), [Pr2Fe] (3), [Nd2Fe] (4), [Ce2Co] (5), [Pr2Co] (6), [Nd2Co] (7), and [Sm2Co] (8) have been solved; they crystallize in the triclinic space group P and are isomorphous. They exhibit a supramolecular 3D architecture through hydrogen bonding and pi-pi stacking interactions. A stereochemical study of the nine-vertex polyhedra of the lanthanide ions, based on continuous shape measures, is presented. No significant magnetic interaction was found between the lanthanide(III) and the iron(III) ions.     

Initial members of the family of molecular mid-valent high-nuclearity iron nitrides: [Fe4N2X10]4- and [Fe10N8X12]5- (X = Cl-, Br-)

Current theoretical and experimental evidence points toward X = N as the identity of the interstitial atom in the [MoFe7S9X] core of the iron-molybdenum cofactor cluster of nitrogenase. This atom functions with mu6 bridging multiplicity to six iron atoms and, if it is nitrogen as nitride, raises a question as to the existence of a family of molecular iron nitrides of higher nuclearity than known dinuclear Fe(III,IV) species with linear [Fe-N-Fe]5+,4+ bridges. This matter has been initially examined by variation of reactant stoichiometry in the self-assembly systems [FeX4]1-/(Me3Sn)3N (X = Cl-, Br-) in acetonitrile. A 2:1 mol ratio affords [Fe4N2Cl10]4- (1), isolated as the Et4N+ salt (72%). This cluster has idealized C2h symmetry with a planar antiferromagnetically coupled [Fe(III)4(mu3-N)2]6+ core containing an Fe2N2 rhombus to which are attached two FeCl3 units. DFT calculations have been performed to determine the dominant magnetic exchange pathway. An 11:8 mol ratio leads to [Fe10N8Cl12]5- (3) as the Et4N+ salt (37%). The cluster possesses idealized D2h symmetry and is built of 15 edge- and vertex-shared rhomboids involving two mu3-N and six mu4-N bridging atoms, and incorporates two of the core units of 1. Four FeN2Cl2 and four FeN3Cl sites are tetrahedral and two FeN5 sites are trigonal pyramidal. The cluster is mixed-valence (9Fe(III) + Fe(IV)); a discrete Fe(IV) site was not detected by crystallography or M?ssbauer spectroscopy. The corresponding clusters [Fe4N2Br10]4- and [Fe10N8Br12]5- are isostructural with 1 and 3, respectively. Future research is directed toward defining the scope of the family of molecular iron nitrides.     

Ditopic hexaazamacrocycles containing pyridine: synthesis, protonation and complexation studies

Structural studies of metal complexes of five ditopic hexaazamacrocycles containing two pyridine rings ([n]py2N4 n= 18, 20, 22, 24 and 26) have been carried out. The synthesis of macrocycles [22]- to [26]-py2N4 are also reported. The protonation constants of the last three compounds and the stability constants of their complexes with Ni2+, Cu2+, Zn2+, and Pb2+ were determined at 25 degrees C in 0.10 mol dm(-3) KNO3 in aqueous solution. Our results with [22]py2N4 show significant differences from those described previously, while [24]py2N4 has not been studied before and [26]py2N4 is a new compound. Mononuclear and dinuclear complexes of the divalent metal ions studied with [22]- to [26]-py2N4 were found in solution. The stability constants for the ML complexes of the three ligands follow the Irving-Williams order: NiL2+ < CuL2+ > ZnL2+ > PbL2+, however for the dinuclear complexes the values for Pb2+ complexes are higher than the corresponding values for the Ni2+ and the Zn2+ complexes. The X-ray single crystal structures of the supramolecular aggregates [Cu2([20]py2N4)(H2O)4][Cu(H2O)6](SO4)3 x 3H2O and [Cu(2)([20]py(2)N4)(CH3CN)4][Ni([20]py2N4)]2(ClO4)8 x H2O, which are composed of homodinuclear [Cu2([20]py2N4])(H2O)4]4+ and [Cu2([20]py2N4])(CH3CN))4]4+, and mononuclear species, [Cu(H2O)6]2+ and [Ni([20]py2N4)]2+, respectively, assembled by an extensive network of hydrogen bonds, are also reported. In both homodinuclear complexes the copper centres are located at the end of the macrocycle and display distorted square pyramidal coordination environments with the basal plane defined by three consecutive nitrogen donors and one solvent molecule, water in and acetonitrile in . The macrocycle adopts a concertina-type conformation leading to the formation of macrocyclic cavities with the two copper centres separated by intramolecular distances of 5.526(1) and 5.508(7) A in 1a and 2a, respectively. The mononuclear complex [Ni([20]py2N4])]2+ displays a distorted octahedral co-ordination environment with the macrocycle wrapping the metal centre in a helical shape. EPR spectroscopy of the copper complexes indicated the presence of mono- and dinuclear species.     

2-rhodaoxetanes: their formation of oxidation of [RhI(ethene)]+ and their reactivity upon protonation

New cationic, pentacoordinate complexes [(TPA)Rh1(ethene)]+, [1a]+, and [(MeTPA)Rh1(ethene)]+, [1b]+, have been prepared (TPA = N,N,N-tri(2-pyridylmethyl)amine, MeTPA = N-[(6-methyl-2-pyridyl)-methyl]-N,N-di(2-pyridylmethyl)amine). Complex [1a]+ is selectively converted by aqueous HCl to [(TPA)RhIII-(ethyl)Cl]+, [2a]+. The same reaction with [1b]+ results in the [(MeTPA)RhIII-(ethyl)Cl]+ isomers [2b]+ and [2c]+. Treatment of [1a]+ and [1b]+ with aqueous H2O2 results in a selective oxygenation to the unsubstituted 2-rho-da(III)oxetanes (1-oxa-2-rhoda(III)cyclo-butanes) [(TPA)RhIII(kappa2-C,O-2-oxyethyl)]+, [3a]+, and [(MeTPA)RhIII(kappa2-C,O-2-oxyethyl)]+, [3b]+. The reactivity of 2-rhodaoxetanes [3a]+ and [3b]+ is dominated by the nucleophilic character of their 2-oxyethyl oxygen. Reaction of [3a]+ and [3b]+ with the non-coordinating acid HBAr(f)4 results in the dicationic protonated 2-rhodaoxetanes [(TPA)RhIII(kappa2-2-hydroxyethyl)]2+, [4a]2+, and [(MeTPA)RhIII(kappa2-2-hydroxyethyl)]2+, [4b]2+. These eliminate acetaldehyde at room temperature, probably via a coordinatively unsaturated kappa1-2-hydroxyethyl complex. In acetonitrile, complex [4a]2+ is stabilised as [(TPA)-RhIII(kappa1-2-hydroxyethyl)(MeCN)]2+, [5a]2+, whereas the MeTPA analogue [4b]2+ continues to eliminate acetaldehyde. Reaction of [3a]+ with NH4Cl and Mel results in the coordinatively saturated complexes [(TPA)RhIII(kappa1-2-hydroxyethyl)(Cl)]+, [6a]+, and [(TPA)-RhIII(kappa1-2-methoxyethyl)(I)+, [7a]+, respectively. Reaction of [3a]+ with NH4+ in MeCN results in formation of the dicationic metallacyclic amide [(TPA)-RhIII [kappa2-O,C-2-(acetylamino)ethyl]]2+, [9]2+, via the intermediates [4a]2+, [5a]2+ and the metallacyclic iminoester [(TPA)RhIII[kappa2-N,C-2-(acetimidoyloxy)ethyl]]2+, [8]2+. The observed overall conversion of the [Rh(I)(ethene)] complex [1a]+ to the metallacyclic amide [9]2+ via 2-rhodaoxetane [3a]+, provides a new route for the amidation of a [RhI(ethene)] fragment.     

Uridine binding by Zn(II) macrocyclic complexes: diversion of RNA cleavage catalysts

Zn(II) complexes of 1-oxa-4,7,10-triazacyclododecane (12[ane]N3O), 1,5,9-triazacyclododecane (12[ane]N3), and 1-hydroxyethyl-1,4,7-triazacyclononane (9[ane]N3OH) promote cleavage of the RNA analogue, 2-hydroxypropyl-4-nitrophenyl phosphate (HpPNP) at pH 8.0, I=0.10 M (NaCl), 25 degrees C with second-order rate constants of 8.9x10(-3), 9.0x10(-3), and 3.3x10(-3) M-1 s-1, respectively. Cleavage of HpPNP by these catalysts is inhibited by uridine with inhibition constants (Ki) of 1.2, 0.46, and 45 mM, respectively, under these conditions. Binding constants derived from these inhibition constants are 2-200-fold larger than those for binding of related Zn(II) complexes to phosphate diesters under similar conditions, suggesting that uridine sequences in RNA will inhibit Zn(II)-catalyzed cleavage by competing with phosphate diester binding sites. Further studies are carried out that utilize pH-potentiometric titrations to monitor uridine binding to five Zn(II) macrocyclic complexes in aqueous solution at 25 degrees C, I=0.10 M (NaCl). The data are consistent with binding of the Zn(II) complexes to the N3-deprotonated form of uridine to give log KU.-values of 5.29, 4.57, 4.56, 3.47, and 2.65 for the Zn(II) complexes of 12[ane]N3, 12[ane]N4, 12[ane]N3O, 15[ane]N3O2, and 9[ane]N3OH, respectively (12[ane]N4=1,4,7,10-tetraazacyclododecane, 15[ane]N3O2=1,4-dioxa-7,10,13-triazacyclopentadecane). For the five Zn(II) complexes studied, there is a linear relationship between uridine anion binding constants and hydroxide binding constants.     

Luminescence properties and water coordination of Eu3+ in the binary solvent mixture water/1-butyl-3-methylimidazolium chloride

The effect of relative water content on the luminescence properties and speciation of Eu3+ ions in solutions of EuCl3 in the binary solvent mixture water/[BMI]Cl is presented, where [BMI]Cl is the ionic liquid (IL) 1-butyl-3-methylimidazolium chloride. Using luminescence techniques, the binding properties of water to Eu3+ are determined for samples with mole ratios of water-to-IL ranging from 0 to 5. Very little water binds to Eu3+ at mole ratios of water-to-IL less than 1, above which binding increases rapidly with increasing water concentration. It is shown that only certain hydration numbers for Eu3+ complexes are stable in the water/IL solutions. The data presented suggest that the Eu3+ species present are [EuClx]3-x, [EuCly(H2O)3-4]3-y, [EuClz(H2O)6]3-z, and [Eu(H2O)8-9]3+ (where x > y > z). Comparison of the positions of the 5D0<--7F0 transitions of the Eu3+ complexes in IL solution with those of model crystal systems provides insight into the extent of Cl- complexation. This study suggests that [BMI]Cl is a promising medium for luminescent lanthanide (Ln) compounds due to the low-energy phonon environment of the [LnClx]3-x complex and to the fact that moderate water contamination does not result in direct binding of water to Ln3+, which would result in luminescence quenching.     

Model studies of azide binding to functional analogues of CcO

N3- binding to a functional model of CcO is investigated in its Fe3+, Fe3+Cu+, and Fe3+Cu2+ forms. A combination of EPR and FTIR indicates that N3- binds in a bridging mode in the bimetallic sites and signature N3- bands are identified for several forms of N3- binding to the site. The presence of the distal metal increases the binding affinity of N3-. This bridging enables antiferromagnetic interaction between the two metal centers in the Fe3+Cu2+ state, which results in an EPR-silent ground state.     

3.3]Ferrocenophanes with guanidine bridging units as multisignalling receptor molecules for selective recognition of anions, cations, and amino acids

The synthesis, electrochemical, and optical properties of a new [3.3]ferrocenophane framework in which two ferrocene subunits, with similar electronic environments, are linked through two substituted guanidine moieties, are reported. The receptors 4-7 have been prepared in good yields by the reaction of bis(carbodiimide) 3 with primary amines. This architecture is exceptionally "tunable" because a variety of "legs" may be appended to the basic [3.3]ferrocenophane scaffold to give a wide range of signaling units. These receptors show remarkable ion-sensing properties, due to the presence of a redox active unit (ferrocene), and an amphoteric binding site (guanidine). In this nitrogen-rich structural motif the guanidine bridges act as multipoint binding sites for anions, cations, and amino acids. Sensing of anions takes place both by unprecedented redox-ratiometric measurements (F-, Cl-, AcO-, NO3-, HSO4-, H2PO4-, and HP2O7(3-)), and colorimetric change (F-, AcO-, H2PO4-, and HP2O7(3-)). Sensing and discrimination of amino acids takes place by redox-ratiometric measurements, whereas the recognition of metal cations (Zn2+, Ni2+, and Cd2+) is achieved either by electrochemical or fluorescence measurements. Moreover, the reported receptors display splitting of the oxidation wave of the Fe(II)/Fe(III) redox couple, and form the mixed-valence species 4+* -7+* by electrochemical partial oxidation which, interestingly, show intervalence charge-transfer transitions associated to the appearance of absorption bands in the near infrared spectral region.     

The associations of macrocyclic ethers with cations in 1,4-dioxane/water mixtures; potentiometric Na+ and K+ binding measurements and computational study

This paper deals with the study of different degrees of association constants of Na⁺ and K⁺ ions with macrocycles of [12]crown-4, [15]crown-5, [18]crown-6, and Diaza[18]crown-6 in (1:1)dioxane/water mixture using the sodium and potassium ion selective electrodes (ISE). The gas phase molecular mechanical and quantum chemical calculations of [18]crown-6 and diaza[18]crown-6 were performed at MM+, AM1, MINDO/3, HF/6-31G(d), and B3LYP/6-31G(d) levels with the help of Gaussian03 program. Conformational abilities were compared with the ion binding results of ISE measurements. The results were also discussed in terms of oxygen charges and enthalpy stabilized association mechanism.     

Stereochemistry of the cyclization-rearrangement of (+)-copalyl diphosphate to (-)-abietadiene catalyzed by recombinant abietadiene synthase from Abies grandis

[reaction: see text] Syntheses and enzymatic cyclizations of 8alpha-hydroxy-17-nor copalyl diphosphate (8a), (15R)-[15-2H1] 8b, and (15R,17E)-[15-3H1,17-2H1] copalyl diphosphate ([2H,3H] 2) catalyzed by recombinant abietadiene synthase (rAS) gave 17-nor manoyl oxide (9a), (16E)-[16-2H1] 9b, and (15S,16R)-[16-2H1,16-3H1] abietadiene ([2H1,3H1] 4), respectively. These and other results indicate that conversion of CPP (2) to abietadiene (4) occurs by anti S(N)' cyclization to a sandaracopimar-15-en-8-yl carbocation intermediate (13+, 13beta-methyl) followed by hydrogen transfer and methyl migration suprafacially on the si face of the vinyl group.     

Binding to DNA purine base and structure-activity relationship of a series of structurally related Ru(II) antitumor complexes: a theoretical study

The thermodynamics of the binding of a series of structurally related Ru(II) antitumor complexes, that is, alpha-[Ru(azpy)2Cl2] 1, beta-[Ru(azpy)2Cl2] 2, alpha-[Ru(azpy)(bpy)Cl2] 3, and cis-[Ru(bpy)2Cl2] 4 to DNA purine bases (gunine, adenine at N7 site) has been studied by using the DFT method. The binding of imine form of 9-methyladenine (9-MeAde) to the Ru(II) moiety in a didentate fashion via its N6 and N7 atoms was also considered. The geometrical structures of the DNA model base adducts were obtained at the B3LYP/(LanL2DZ + 6-31G(d)) level in vacuo. The following exact single-point energy calculations were performed at the B3LYP/(LanL2DZ(f)+6-311+G(2d, 2p)) level both in vacuo and in aqueous solution using the COSMO model. The bond dissociation enthalpies and free energies, reaction enthalpies and free energies both in the gas phase and in aqueous solution for all considered Ru(II)-DNA model base adducts were obtained from the computations. The calculated bond dissociation enthalpies and free energies allow us to build a binding affinity order for the considered Ru(II)-DNA model base adducts. The theoretical results show that the guanine N7 is a preferred site for this series of complexes and support such an experimental fact that alpha-[Ru(azpy)(bpy)(9-EtGua)H2O](2+) (3-(9-EtGua)) is isomerized to alpha'-[Ru(azpy)(bpy)(9-EtGua)H2O](2+) (3'-(9-EtGua)). On the basis of structural and thermodynamical characteristics, the possible structure-activity relationship was obtained, and the distinct difference in cytotoxicities of this series of structurally related antitumor complexes was explained theoretically.     

Internal versus terminal metalation of double-helical oligodeoxyribonucleotides

The formation of adducts between cis-[Pt(NH(3))(2)Cl(2)], Zn(II), and Mn(II) and double-stranded oligodeoxynucleotides was studied by 1D and 2D (1)H, (31)P, and (15)N NMR spectroscopy. For labile adducts involving Zn(II) and Mn(II), both (1)H chemical shifts (Zn(II)) and (1)H line-broadening effects (Mn(II)) showed that in the hexamer [d(GGCGCC)](2) I, the terminal G(1)-N7 is the exclusive binding site, while for the dodecamer [d(GGTACCGGTACC)](2) II, which contains both a terminal and internal GG pair, the preference for metal binding is the internal guanine G(7). Zn(II) binding to II was confirmed by natural-abundance 2D [(1)H,(15)N] HMBC NMR spectroscopy, which unambiguously showed that G(7)-N7 is the preferred binding site. The long duplex [d(GGTATATATACCGGTATATATACC)](2) III was expected to have a more pronounced accumulation of electrostatic potential towards the central part of the sequence (vs the terminal part) than does II. However, the Zn(II) titration of III showed no increase in coordination with the internal Gs (vs the terminal Gs), compared with what was observed for II. The reaction between the nonlabile metal complex cis-[PtCl(2)((15)NH(3))(2)] (cisplatin) and II showed a slight preference for the internal GG pair over the terminal GG pair. However, when the diaqua form of cisplatin cis-[Pt((15)NH(3))(2)(H(2)O)(2)] was reacted with II a more pronounced binding preference for the internal GG pair was observed.     

Investigation of Spectra（NMR,Mass）of Some Fe3S3Cluster Compounds

1　ＩＮＴＲＯＤＵＣＴＩＯＮＴｈｅｉｒｏｎ ｓｕｌｆｕｒｐｒｏｔｅｉｎｉｓｏｎｅｏｆｔｈｅｍｅｔａｌｐｒｏｔｅｉｎｓｔｈａｔｃａｎｔｒａｎｓｍｉｔｅｌｅｃｔｒｏｎｓ.Ｉｒｏｎ ｓｕｌｆｕｒｐｒｏｔｅｉｎｓａｒｅｆｏｕｎｄｉｎｍｏｓｔｏｆｔｈｅｌｉｆｅｆｏｒｍｓ,ｙｅｔｉｔｗａｓｎｏｔｕｎｔｉｌａｒｏｕｎｄ1960ｔｈａｔｉｒｏｎ ｓｕｌｆｕｒｐｒｏｔｅｉｎｓｗｅｒｅｆｏｕｎｄｉｎｐｈｏｔｏｓｙｎｔｈｅｔｉｃｏｒｇａｎｉｓｍ〔1〕,ｎｉｔｒｏｇｅｎ ｆｉｘ ｉｎｇｂａｃｔｅｒｉａ〔2〕,ａｎｄｓｕｂｍｉｔｏｃｈｏ…     

Acid-base and metal-ion-binding properties of xanthosine 5'-monophosphate (XMP) in aqueous solution: complex stabilities, isomeric equilibria, and extent of macrochelation

The four acidity constants of threefold protonated xanthosine 5'-monophosphate, H3(XMP)+, reveal that at the physiological pH of 7.5 (XMP-H)(3-) strongly dominates (and not XMP(2-) as given in textbooks); this is in contrast to the related inosine (IMP(2-)) and guanosine 5'-monophosphate (GMP(2-)) and it means that XMP should better be named as xanthosinate 5'-monophosphate. In addition, evidence is provided for a tautomeric (XMP-HN1)(3-)/(XMP-HN3)(3-) equilibrium. The stability constants of the M(H;XMP)+ species were estimated and those of the M(XMP) and M(XMP-H)- complexes (M2+=Mg2+, Ca2+, Sr2+, Ba2+, Mn2+, Co2+, Ni2+, Cu2+, Zn2+, Cd2+) measured potentiometrically in aqueous solution. The primary M2+ binding site in M(XMP) is (mostly) N7 of the monodeprotonated xanthine residue, the proton being at the phosphate group. The corresponding macrochelates involving P(O)2(OH)- (most likely outer-sphere) are formed to approximately 65% for nearly all M2+. In M(XMP-H)- the primary M2+ binding site is (mostly) the phosphate group; here the formation degree of the N7 macrochelates varies widely from close to zero for the alkaline earth ions, to approximately 50% for Mn2+, and approximately 90% or more for Co2+, Ni2+, Cu2+, Zn2+, and Cd2+. Because for (XMP-H)(3-) the micro stability constants quantifying the M2+ affinity of the xanthosinate and PO3(2-) residues are known, one may apply a recently developed quantification method for the chelate effect to the corresponding macrochelates; this chelate effect is close to zero for the alkaline earth ions and it amounts to about one log unit for Co2+, Ni2+, Cu2+. This method also allows calculation of the formation degrees of the monodentatally coordinated isomers; this information is of relevance for biological systems because it demonstrates how metal ions can switch from one site to another through macrochelate formation. These insights are meaningful for metal-ion-dependent reactions of XMP in metabolic pathways; previous mechanistic proposals based on XMP(2-) need revision.