One-armed artificial receptors for the binding of polar tetrapeptides in water: probing the substrate selectivity of a combinatorial receptor library

We have recently developed a new class of one-armed artificial receptors 1 for the binding of the polar tetrapeptide N-Ac-D-Glu-L-Lys-D-Ala-D-Ala-OH (EKAA) 2 in water using a combined combinatorial and statistical approach. We have now further probed the substrate selectivity of this receptor library 1 by screening a second tetrapeptide substrate (3) with the inverse sequence N-Ac-D-Ala-D-Ala-L-Lys-D-Glu-OH (AAKE). This "inverse" substrate is also efficiently bound by our receptors, with K(ass) approximately 6000 M(-1) for the best receptors, as determined both by a quantitative on-bead binding assay and by UV and fluorescence titration studies in free solution. Hence, the inverse tetrapeptide 3 is in general bound two to three times less efficiently than the "normal" peptide 2 (K(ass) approximately 17,000 M(-1)), even though the complexation mainly involves long-range electrostatic interactions and both the receptor and substrate are rather flexible. Molecular modeling and ab initio calculations have been used to rationalize the observed substrate selectivity and to analyze the various binding interactions within the complex.     

5-Amino-dU: a nucleoside analogue in the central strand of DNA triplex for orientation selective binding of A/G/C/T in the third strand

[formula: see text] 5-Amino-dU, a designed nucleoside analogue, when placed in the central strand of DNA triple helix, recognizes all four bases A, G, C, and T in the third strand, with a selectivity based on the orientation (parallel/antiparallel) of the third strand.     

Combining the best in triplex recognition: synthesis and nucleic acid binding of a BQQ-neomycin conjugate

Synthesis of a BQQ-neomycin conjugate is reported. The conjugate combines two ligands, one known to intercalate triplexes (BQQ) and another known to bind in the triplex groove (neomycin). The conjugate stabilizes T.A.T, as well as mixed base DNA triplex, better than neomycin, BQQ, or a combination of both. The conjugate selectively stabilizes the triplex (in the presence of physiological salt concentrations), with as little as 4 muM of the ligand leading to a DeltaTm of >60 degrees C. Competition dialysis studies show a clear preference for the drug binding to triplex DNA/RNA over the duplex/single strand structures. Modeling studies suggest a structure of neomycin bound to the larger W-H (Watson-Hoogsteen) groove with BQQ intercalated between the triplex bases.     

Covalent Schiff base catalysis and turnover by a DNAzyme: a M2+ -independent AP-endonuclease mimic

A DNAzyme, synthetically modified with both primary amines and imidazoles, is found to act as a M2+ -independent AP lyase-endonuclease. In the course of the cleavage reaction, this DNAzyme forms a covalent Schiff base intermediate with an abasic site on a complementary oligodeoxyribonucleotide. This intermediate, which is inferred from NaCNBH3 trapping as well as cyanide inhibition, does not evidently accumulate because the second step, dehydrophosphorylative elimination, is fast compared to Schiff base formation. The 5'-product that remains linked to the catalyst hydrolyzes slowly to regenerate free catalyst. The use of duly modified DNAzymes to perform Schiff base catalysis demonstrates the value of modified nucleotides for enhancing the catalytic repertoire of nucleic acids. This work suggests that DNAzymes will be capable of catalyzing aldol condensation reactions.     

Visualizing the dose distribution and linear energy transfer by 1D and 2D ESR imaging: a potassium dithionate dosimeter irradiated with C6+ and N7+ ions

We report the application of one- and two-dimensional (1D and 2D) spectral-spatial electron spin resonance imaging (ESRI) for visualizing the dose distribution and linear energy transfer (LET) in a potassium dithionate, K2S2O6 (PDT), dosimeter irradiated with the heavy ions C(6+) and N(7+). The ESR spectrum in the irradiated PDT consists of a superposition of two isotropic signals assigned to two *SO3(-) radicals, R1 and R2, with no hyperfine splittings and slightly different g values. The 1D ESRI profiles clearly indicate the spatial penetration of the beams and the location of the sharp maximum dose, the "Bragg peak", detected for each beam. The depth penetrations are different: approximately 2.3 mm for C(6+) and approximately 1.8 mm for N(7+) beams, +/-0.1 mm; beyond these limits, no radicals were detected. 2D spectral-spatial ESRI images reflect both the dose distribution and the spatial dependence of the relative intensities of radicals R1 and R2, an effect that is assigned to the depth variation of the LET. This study has demonstrated that ESRI is a promising new method for dose and LET determination. Of particular interest are applications in the field of radiotherapy with heavy ions, because in this case the Bragg peak is pronounced and the dose can be focused at specific depths while the surrounding areas are protected.     

Binding site of Zn2+ in ATP:N1 at low pH and N7 at high pH as evidenced by 1H-15N NMR HMBC experiments

Nuclear magnetic resonance (NMR) 1H-15N heteronuclear multiple bond correlation (HMBC) experiments on natural abundant adenosine-5'-triphosphate (ATP) showed that zinc(II) induced large chemical shifts (> 10 ppm) for N1 at lower pH (2-5) while for N7 at higher pH (5-7), suggesting that the binding site of Zn2+ in the purine base of ATP is pH dependent. The size effect of zinc(II) in coordination is also discussed.     

Contribution of Discharge Excited Atomic N,N2*, and N2+ to a Plasma/Liquid Interfacial Reaction as Suggested by Quantitative Analysis

Electric-discharge nitrogen comprises three main types of excited nitrogen species-atomic nitrogen (N_atom), excited nitrogen molecules (N₂*), and nitrogen ions (N₂⁺) – which have different lifetimes and reactivities. In particular, the interfacial reaction locus between the discharged nitrogen and the water phase produces nitrogen compounds such as ammonia and nitrate ions (denoted as N-compounds generically); this is referred to as the plasma/liquid interfacial (P/L) reaction. The N_atom amount was analyzed quantitatively to clarify the contribution of N_atom to the P/L reaction. We focused on the quantitative relationship between N_atom and the produced N-compounds, and found that both N₂* and N₂⁺, which are active species other than N_atom, contributed to P/L reaction. The production of N-compounds from N₂* and N₂⁺ was enhanced upon UV irradiation of the water phase, but the production of N-compounds from N_atom did not increase by UV irradiation. These results revealed that the P/L reactions starting from N_atom and those starting from N₂^* and N₂⁺ follow different mechanisms.     

Multiple metal binding to 6-oxopurine nucleobases as a source of deprotonation. The role of metal ions at N7 and N3

Simultaneous metal coordination to N7 (Pt(II)) and N3 (Pd(II)) of N9-blocked guanine leads to a 10(4) fold acidification of the guanine-N(1)H position and hence to a virtual complete deprotonation of the N(1)H position at neutral pH. The chelate-tethered nucleobase ethylenediamine-N9-ethylguanine was employed and relevant acid-base equilibria were studied by pD dependent 1H NMR spectroscopy. CH2 resonances of the tether were assigned on the basis of NOESY and COSY experiments. Our findings suggest a plausible method of formation of a previously reported trinuclear Pt(II) complex of 9-ethylguanine with metals coordinated to N1, N3 and N7. According to this, a sequence with the first metal binding to N7, the second one binding to N3, and only the third one binding to N1 with deprotonation of this site is proposed.     

Indium as a radical initiator in aqueous media: intermolecular alkyl radical addition to CN and CC bond

The carbon-carbon bond-forming method in aqueous media was investigated by using indium as a single-electron transfer radical initiator. The indium-mediated intermolecular alkyl radical addition to imine derivatives and electron-deficient CC bond proceeded effectively.     

Comparative study of the hypercoordinate ions C7H9+ and C8H9+ by the ab initio/GIAO-CCSD(T) method

A comparative study of the hypercoordinate square-pyramidal carbocations C7H9+ and C8H9+ was performed by the ab initio/GIAO-CCSD(T) method. The structures and 13C NMR chemical shifts of the cations were calculated at the GIAO-CCSD(T)/tzp/dz//MP2/cc-pVTZ level. The bishomo square pyramidal structure 1 was calculated for C7H9+ at the MP2/cc-pVTZ level. The calculated 13C NMR chemical shifts of structure 1 agree extremely well with the experimental values. However, unlike for C7H9+ both the bishomo square pyramidal structure 3 and the trishomocyclopropenium type structure 4 were found to be minima on the potential energy surface of C8H9+. They are very close energetically with cation 3, only 0.7 kcal/mol less stable than cation 4 at the MP2/cc-pVTZ//MP2/cc-pVTZ + ZPE level. Neither structure 3 nor 4 yields NMR spectra that agree with experiment. However, a weighted average of the two reproduces the observed NMR spectrum of C8H9+ (at -80 degrees C) quite well.     

Activation of SO2 by N/Si+ and N/B Frustrated Lewis Pairs: Experimental and Theoretical Comparison with CO2 Activation

The guanidine 1,5,7-triazabicyclo[4.4.0]dec-5-ene (TBD) and the substituted derivatives [TBD–SiR₂]⁺ and TBD–BR₂ reacted with SO₂ to give different FLP–SO₂ adducts. Molecular structures, elucidated by X-ray diffraction, showed some structural similarities with the analogous CO₂ adducts. Thermodynamic stabilities were both experimentally evidenced and computed through DFT calculations. The underlying parameters governing the relative stabilities of the different SO₂ and CO₂ adducts were discussed from a theoretical standpoint, with a focus on the influence of the Lewis acidic moiety.     

Tuning the selectivity/specificity of fluorescent metal ion sensors based on N2S2 pyridine-containing macrocyclic ligands by changing the fluorogenic subunit: spectrofluorimetric and metal ion binding studies

Two new fluorescent chemosensors for metal ions have been synthesized and characterized, and their photophysical properties have been explored; they are the macrocycles 5-(2-quinolinylmethyl)-2,8-dithia-5-aza-2,6-pyridinophane (L5) and 5-(5-chloro-8-hydroxyquinolinylmethyl)-2,8-dithia-5-aza-2,6-pyridinophane (L6). Both systems have a pyridyl-thioether-containing 12-membered macrocycle as a binding site. The coordination properties of these two ligands toward CuII, ZnII, CdII, HgII, and PbII have been studied in MeCN/H2O (1:1 v/v) and MeCN solutions and in the solid state. The stoichiometry of the species formed at 25 degrees C have been determined from absorption, fluorescence, and potentiometric titrations. The complexes [CuL5](ClO4)(2).1/2MeCN, [ZnL5(H2O)](ClO4)2, [HgL5(MeCN)](ClO4)2, [PbL5(ClO4)2], [Cu3(5-Cl-8-HDQH-1)(L6H-1)2](ClO4)(3).7.5H2O (HDQ=hydroxyquinoline), and [Cu(L6)2](BF4)(2).2MeNO2 have also been characterized by X-ray crystallography. A specific CHEF-type response of L5 and L6 to the presence of ZnII and CdII, respectively, has been observed at about pH 7.0 in MeCN/H2O (1:1 v/v) solutions.     

Specificity in molecular design: a physical framework for probing the determinants of binding specificity and promiscuity in a biological environment

Binding specificity is an important consideration in drug design. An effective drug molecule often must bind with high specificity to its intended target in the body; lower specificity implies the possibility of significant binding to unintended partners, which could instigate deleterious side effects. However, if the target is a rapidly mutating agent, a drug that is too specific will quickly lose its efficacy by not binding well to functional mutants. Therefore, in molecular design, it is crucial to tailor the binding specificity of a drug to the problem at hand. In practice, specificity is often studied on a case-by-case basis, and it is difficult to create general understanding of the determinants of specificity from the union of such available cases. In this work, we undertook a comprehensive, general study of molecular binding with emphasis on understanding the determinants of specificity from a physical standpoint. By extending a theoretical framework grounded in continuum electrostatics and creating an abstracted lattice model that captures key physical aspects of binding interactions, we systematically explored the relationship between a molecule's physical characteristics and its binding specificity toward potential partners. The theory and simulated binding interactions suggested that charged molecules are more specific binders than their hydrophobic counterparts for several reasons. First, the biological spectrum of possible binding characteristics includes more partners that bind equally well to hydrophobic ligands than to charged ligands. Also, charged ligands, whose electrostatic potentials have strong orientational dependence, are more sensitive to shape complementarity than their hydrophobic counterparts. Ligand conformational and orientational flexibility can further influence a charged molecule's ability to bind specifically. Interestingly, we found that conformational flexibility can increase the specificity of polar and charged ligands, by allowing them to greatly lower the binding free energy to a select few partners relative to others. Additionally, factors such as a molecule's size and the ionic strength of the solution were found to predictably affect binding specificity. Taken together, these results, all of which stem from a unified theoretical framework, provide valuable physical insight into the general determinants of binding specificity and promiscuity in a biological environment. The general principles discussed here could prove useful in the design of molecules with tailored specificities, leading to more effective therapeutics.     

Host-guest complexation-37 : Synthesis and binding properties of a transacylase partial mimic with imidazole and benzyl alcohol in place

The design and 30-step synthesis of a transacylase partial mimic is described. The target catalyst combines a macrocyclic binding site, a hydroxymethyl group, and an imidazole group organized to act cooperatively through their attachment to a quaterphenyl support structure. The binding site is composed of three cyclic urea units in a tripod arrangement, rigidified by their incorporation into a macrocycle along with two anisyl and one m-xylyl spacer units. The binding and catalytic sites are complementary to amino acid ester salts. The host catalyst collects and orients through complexation the guest substrate to provide substantial rate enhancements for transacylation of amino ester salts. The free energies are reported for the host in CDCl₃ binding the picrate salts of Li⁺, Na⁺, K⁺, Rb⁺,Cs⁺, NH₄⁺, CH₃NH₃⁺ and t-BuNH₃⁺.     

Solid-phase synthesis of positively charged deoxynucleic guanidine (DNG) tethering a Hoechst 33258 analogue: triplex and duplex stabilization by simultaneous minor groove binding

Deoxynucleic guanidine (DNG), a DNA analogue in which positively charged guanidine replaces the phosphodiester linkages, tethering to Hoechst 33258 fluorophore by varying lengths has been synthesized. A pentameric thymidine DNG was synthesized on solid phase in the 3' --> 5' direction that allowed stepwise incorporation of straight chain amino acid linkers and a bis-benzimidazole (Hoechst 33258) ligand at the 5'-terminus using PyBOP/HOBt chemistry. The stability of (DNA)(2).DNG-H triplexes and DNA.DNG-H duplexes formed by DNG and DNG-Hoechst 33258 (DNG-H) conjugates with 30-mer double-strand (ds) DNA, d(CGCCGCGCGCGCGAAAAACCCGGCGCGCGC)/d(GCGGCGCGCGCGCTTTTTGGGCCGCGCGCG), and single-strand (ss) DNA, 5'-CGCCGCGCGCGCGAAAAACCCGGCGCGCGC-3', respectively, has been evaluated by thermal melting and fluorescence emission experiments. The presence of tethered Hoechst ligand in the 5'-terminus of the DNG enhances the (DNA)(2).DNG-H triplex stability by a DeltaT(m) of 13 degrees C. The fluorescence emission studies of (DNA)(2).DNG-H triplex complexes show that the DNG moiety of the conjugates bind in the major groove while the Hoechst ligand resides in the A:T rich minor groove of dsDNA. A single G:C base pair mismatch in the target site decreases the (DNA)(2).DNG triplex stability by 11 degrees C, whereas (DNA)(2).DNG-H triplex stability was decreased by 23 degrees C. Inversion of A:T base pair into T:A base pair in the center of the binding site, which provides a mismatch selectively for DNG moiety, decreases the triplex stability by only 5-6 degrees C. Upon hybridization of DNG-Hoechst conjugates with the 30-mer ssDNA, the DNA.DNG-H duplex exhibited significant increase in the fluorescence emission due to the binding of the tethered Hoechst ligand in the generated DNA.DNG minor groove, and the duplex stability was enhanced by DeltaT(m) of 7 degrees C. The stability of (DNA)(2).DNG triplexes and DNA.DNG duplexes is independent of pH, whereas the stability of (DNA)(2).DNG-H triplexes decreases with increase in pH.     

A tryptophan-containing open-chain framework for tuning a high selectivity for Ca2+ and 13C NMR observation of a Ca2+-indole interaction in aqueous solution

Two molecular architectures featuring the cation-responsive tryptophan indole were designed and investigated for the development of a novel fluorescent chemosensor for Ca2+. We observed that the Trp-based open-framework chemosensor EW2 exhibits remarkable selectivity for Ca2+ over Mg2+, Ba2+, K+, Na+, and Li+ in water between pH 4.6 and 7.0 on the basis of Ca2+-induced high fluorescence enhancement of the Trp residue. A combined 13C NMR and CD spectroscopic study has demonstrated a dynamic reorientation of the indole ring due to the cation-indole interaction accompanying the Ca2+-induced dramatic fluorescence enhancement. The results suggest that the highly sensitive, metal-ion-dependent Trp indolyl C(3) chemical shifts may serve as a promising indicator for monitoring metal ion-indole noncovalent interaction in solution.     

High-performance liquid chromatographic assay of N(G)-monomethyl-L-arginine, N(G),N(G)-dimethyl-L-arginine, and N(G),N(G)'-dimethyl-L-arginine using 4-fluoro-7-nitro-2, 1,3-benzoxadiazole as a fluorescent reagent

N(G)-Monomethyl-L-arginine (L-NMMA), N(G),N(G)-dimethyl-L-arginine (ADMA), and N(G),N(G)'-dimethyl-L-arginine (SDMA) are emerging cardiovascular risk factors. A high-performance liquid chromatographic method with fluorescence detection for the simultaneous determination of L-NMMA, ADMA and SDMA is described. The assay employed 4-fluoro-7-nitro-2,1,3-benzoxadiazole (NBD-F) as a fluorescent derivatization reagent. After solid phase extraction with cation-exchange column, the methylated arginines were converted to fluorescent derivatives with NBD-F, and the derivatives were separated within 32 min on a reversed-phase column. Nomega-Propyl-L-arginine was Used as an internal standard. Extrapolated detection limits were 12 nM (12 fmol per injection) for L-NMMA and 20 nM (20 fmol per injection) for ADMA and SDMA, respectively, with a signal-to-noise ratio of 3. The calibration curves for L-NMMA, ADMA and SDMA were linear within the range of 50-5000 fmol. The method was applied to the quantitative determination of L-NMMA, ADMA and SDMA in 200 microl of rat plasma. The concentrations of L-NMMA, ADMA and SDMA in rat plasma were 0.16 +/- 0.03, 0.80 +/- 0.25 and 0.40 +/- 0.21 microM, respectively (n = 5).