Photocatalytic Degradation of a Chlorinated Organic Chemical Using Activated Carbon Fiber Coupled with Semiconductor

Hydrothermal mediated synthesis was used to couple activated carbon fiber and semiconductor. Batch mode photocatalytic experiments were performed to investigate the efficacy of the developed photocatalyst in the degradation of 2, 4‐dichlorophenol. Operational parameters including initial concentration of 2, 4‐dichlorophenol and catalyst loading were optimized at natural pH conditions. Addition of inorganic anions during the degradation revealed that the presence of anions greatly affects the degradation efficiency. The significance of highly reactive radicals on the photocatalytic degradation was identified by the addition of radical scavengers such as isopropanol (OH˙), benzoquinone (˙ ${\text{O}}_2^{-}$) and potassium iodide (h⁺). Reusability of the photocatalyst was confirmed by conducting five cyclic studies. Further, the dissolution of Zn²⁺ in the solution was analyzed and determined to be 0.199 μg mL^?1. Seed germination study was conducted to examine the toxicity nature of ZnO on growth and development of Vigna radiata.     

Isomeric [C,H3,N,O]+˙ ions and their neutral counterparts

The isomeric ions [H₂NC(H)O]⁺˙, [H₂NCOH]⁺˙, [H₃CNO]⁺˙ and [H₂CNOH]⁺˙ were examined in the gas phase by mass spectrometry. Ab initio molecular orbital theory was used to calculate the relative stabilities of [H₂NC(H)O]⁺˙, [H₂NCOH]⁺˙, [H₃NCO]⁺˙ and their neutral counterparts. Theory predicted [H₂NC(H)O]⁺˙ to be the most stable ion. [H₂NCOH]⁺˙ ions were generated via a 1,4-hydrogen transfer in [H₂NC(O)OCH₃]⁺˙, [H₂NC(O)C(O)OH]⁺˙ and [H₂NC(O)CH₂CH₃]⁺˙. Its metastable dissociation takes place via [H₃NCO]⁺˙ with the isomerization as the rate-determining step. [H₂CNOH]⁺˙ undergoes a rate-determining isomerization into [H₃CNO]⁺˙ prior to metastable fragmentation. Neutralization-reionization mass spectrometry was used to identify the neutral counterparts of these [H₃,C,N,O]⁺˙ ions as stable species in the gas phase. The ion [H₃NCO]⁺˙ was not independently generated in these experiments; its neutral counterpart was predicted by theory to be only weakly bound.     

The unimolecular chemistry of [1,2-propanediol]+˙: a rationale in terms of hydrogen-bridged radical cations

By combining results from a variety of mass spectrometric techniques (metastatle ion, collisional activation, collision-induced dissociative ionization, neutralization–reionization spectrometry and appearance energy measurements) and the classical method of isotopic labelling, a unified mechanism is proposed for the complex unimolecular chemistry of ionized 1,2-propanediol. The key intermediates involved are the stable hydrogen-bridged radical cations [CH₂?C(H)? H…?O…?O(H)CH₃]⁺˙, which were generated independently from [4-methoxy, 1-butanol]⁺˙ (loss of C₂H₄) and [1-methoxyglycerol]⁺˙ (loss of CH₂O), [CH₃? C?O…?H…?O(H)CH₃]⁺˙ and the related ion-dipole complex [CH₂?C(OH)CH₃/H₂O]⁺˙. The latter species serves as the precursor for the loss of CH³˙ and in this reaction the same non-ergodic behaviour is observed as in the loss of CH³˙ from the ionized enol of acetone.     

Ion‐Responsive Hemin–G‐Quadruplexes for Switchable DNAzyme and Enzyme Functions

Programmed nucleic acid sequences undergo K⁺ ion‐induced self‐assembly into G‐quadruplexes and separation of the supramolecular structures by the elimination of K⁺ ions by crown ether or cryptand ion‐receptors. This process allows the switchable formation and dissociation of the respective G‐quadruplexes. The different G‐quadruplex structures bind hemin, and the resulting hemin–G‐quadruplex structures reveal horseradish peroxidase DNAzyme catalytic activities. The following K⁺ ion/receptor switchable systems are described: 1) The K⁺‐induced self‐assembly of the Mg²⁺‐dependent DNAzyme subunits into a catalytic nanostructure using the assembly of G‐quadruplexes as bridging unit. 2) The K⁺‐induced stabilization of the anti‐thrombin G‐quadruplex nanostructure that inhibits the hydrolytic functions of thrombin. 3) The K⁺‐induced opening of DNA tweezers through the stabilization of G‐quadruplexes on the “tweezers’ arms" and the release of a strand bridging the tweezers into a closed structure. In all of the systems reversible, switchable, functions are demonstrated. For all systems two different signals are used to follow the switchable functions (fluorescence and the catalytic functions of the derived hemin–G‐quadruplex DNAzyme).     

Synthesis,Characterization and Photocatalytic Activity of Ag+‐ and Sn2+‐Doped KTi0.5Te1.5O6

In this study, the photocatalytic dye degradation efficiency of KTi_0.5Te_1.5O₆ synthesized through solid‐state method was enhanced by cation (Ag⁺/Sn⁺²) doping at potassium site via ion exchange method. As prepared materials were characterized by XRD, SEM‐EDS, IR, TGA and UV–Vis Diffuse reflectance spectroscopic (DRS) techniques. All the compounds were crystallized in cubic lattice with space group. The bandgap energies of parent, Ag⁺‐ and Sn⁺²‐doped KTi_0.5Te_1.5O₆ materials obtained from DRS profiles were found to be 2.96, 2.55 and 2.40 eV, respectively. Photocatalytic efficiency of parent, Ag⁺‐ and Sn⁺²‐doped materials was evaluated against the degradation of methylene blue (MB) and methyl violet (MV) dyes under visible light irradiation. The Sn⁺²‐doped KTi_0.5Te_1.5O₆ showed higher activity toward the degradation of both MB and MV dyes and its higher activity is ascribed to the lower bandgap energy compared to the parent and Ag⁺‐doped KTi_0.5Te_1.5O₆. The mechanistic degradation pathway of methylene blue (MB) was studied in the presence of Sn²⁺‐doped KTi_0.5Te_1.5O₆. Quenching experiments were performed to know the participation of holes, super oxide and hydroxyl radicals in the dye degradation process. The stability and reusability of the catalysts were studied.     

Photo‐Fenton and Riboflavin‐photosensitized Processes of the Isoxaflutole Herbicide

The proherbicide Isoxaflutole (IXF) hydrolyzes spontaneously to diketonitrile (DKN) a phytotoxic compound with herbicidal activity. In this work, the sensitized degradation of IXF using Riboflavin (Rf), a typical environmentally friendly sensitizer, Fenton and photo‐Fenton processes has been studied. The results indicate that only the photo‐Fenton process produces a significant degradation of the IXF. Photolysis experiments of IXF sensitized by Riboflavin is not a meaningful process, IXF quenches the Rf excited triplet (³Rf*) state with a quenching rate constant of 1.5 · 10⁷ m ^?1 s^?1 and no reaction is observed with the species O₂(¹Δ_g) or ${\mathrm{O}}_2^{·?}$ generated from ³Rf*. The Fenton reaction produces no changes in the IXF concentration. While the photo‐Fenton process of the IXF, under typical conditions, it produces a degradation of 99% and a mineralization to CO₂ and H₂O of 88%. A rate constant value of 1.0 × 10⁹ m ^?1 s^?1 was determined for the reaction between IXF and HO˙. The photo‐Fenton process degradation products were identified by UHPLC‐MS/MS analysis.     

Photochemical Reaction Between 1,2‐Naphthoquinone and Adenine in Binary Water‐Acetonitrile Solutions

The photochemical reaction between 1,2‐naphthoquinone (NQ ) and adenine was investigated using nanosecond time‐resolved laser flash photolysis. With photolysis at 355 nm, the lowest triplet state T₁ of NQ was produced via intersystem crossing from its singlet excited state. The triplet‐triplet absorption of the state contributes three bands of transient spectra at 374, 596 and 650 nm, respectively, in pure acetonitrile and binary water‐acetonitrile solutions. In the presence of adenine, the observation of ⁺ (at 363 nm) and radical (at 343 and 485 nm) indicates a multistep mechanism of electron transfer process followed by a proton transfer between ³NQ * and adenine. By fitting with the Stern‐Volmer relationship, the quenching rate constant k _q of ³NQ * by adenine in binary water‐acetonitrile solutions (4/1, volume ratio, v/v) is determined as 1.66 × 10⁹ m ⁻¹ s⁻¹. Additionally, no spectral evidence confirms the existence of electron transfer between ³NQ * with thymine, cytosine and uracil.     

Massenspektrometrie isomerer Diazaphenanthrene—I

The mass spectra of five diazaphenanthrenes formed by photochemical cyclodehydrogenation of styryl diazines are investigated. It is shown that fragmentation of these compounds starts almost exclusively at the heterocyclic part of the molecule and proceeds by competitive α-cleavage. From the intensity ratios of the ions [M ? H˙]⁺, [M ? HCN]⁺˙, [M ? N₂]⁺˙ and [M ? 2 HCN]⁺˙ generated in this way, each isomer can unequivocally be identified.     

Photophysical Properties of Fluorescent 2‐(Phenylamino)‐1,10‐phenanthroline Derivatives†

The present study details the experimental and theoretical characterization of the photophysical properties of 14 examples of 2‐(phenylamino)‐1,10‐phenanthrolines ( 1 ). The absorption spectra of 1 are substituent‐dependent but in a general manner present absorption bands at wavelengths of ~230; ~300; ~335 and a shoulder at ~380 nm. Electron‐donating groups (EDG) and electron‐withdrawing groups (EWG), respectively, result in bathochromic and hypsochromic shifts. Compounds 1 are highly luminescent, in contrast to phenanthroline, and emit in the region between 350 and 500 nm with substituent‐dependent λ_max emission. The emission spectra show a redshift for EDG (4‐OMe 62 nm; 4‐Me 19 nm) and a blueshift for EWG (4‐CN 41 nm; 4‐CF₃ 38 nm) relative to the emission of the unsubstituted parent compound 1a . Plotting the ${\mathbf{\lambda }}_{\mathbf{max}}^{\mathbf{\text{EM}}}$ against Hammett σ+ constants gave an excellent linear correlation demonstrating the electron‐deficient nature of the excited state and how the substituents (de)stabilize S₁. Theoretical calculations revealed a HOMO‐LUMO π‐π* electronic transition to S₁ which in combination with difference (S₁–S₀) in electron density maps revealed charge‐transfer character. Strongly electron‐withdrawing substituents switch off the charge transfer to give rise to a local excitation.     

Electronic Excitations in G‐quadruplexes Formed by the Human Telomeric Sequence: A Time‐Resolved Fluorescence Study

The present study deals with G‐quadruplexes formed by folding of the human telomeric sequence d(GGGTTAGGGTTAGGGTTAGGG), in presence of K⁺ cations, noted Tel21/K⁺. Fluorescence decays and fluorescence anisotropy decays, obtained upon excitation at 267 nm, are probed from femtosecond to nanosecond domains using two different detection techniques, fluorescence upconversion and time‐correlated single photon counting. The results are discussed in light of recent theoretical studies. It is shown that efficient energy transfer takes place among the bases on the femtosecond time scale, possible only via exciton states. The major part of the fluorescence originates from bright excited states having weak charge transfer character and decaying between 1 and 100 ps. Charge transfer states involving guanines in different tetrads decay mainly after 100 ps and emit at the red wing of the spectrum. The persistence of electronic excitations in Tel21/K⁺ is longer and the contribution of charge transfer states is more pronounced than what is observed for G‐quadruplexes formed by association of four d(TGGGT) strands and containing the same number of tetrads. This difference is due to the increased structural rigidity of monomolecular structures which reduces nonradiative deactivation pathways and favors collective effects.     

Charge stripping mass spectra: A method for identifying isomeric [C5H8]+˙ and [C3H6]+˙ ions

Charge stripping (collisional ionization) mass spectra are reported for isomeric [C₅H₈]⁺˙ and [C₃H₆]⁺˙ ions. The results provide the first method for adequately quantitatively determining the structures and abundances of these species when they are generated as daughter ions. Thus, loss of H₂O from the molecular ions of cyclopentanol and pentanal is shown to produce mixtures of ionized penta-1,3- and -1,4-dienes. Pent-1-en-3-ol generates [penta-1,3-diene]⁺˙. [C₃H₆]⁺˙ ions from ionized butane, methylpropane and 2-methylpropan-1-ol are shown to have the [propene]⁺˙ structure, whereas [cyclopropane]⁺˙ is produced from ionized tetrahydrofuran, penta-1,3-diene and pent-1-yne.     

MALDI‐MS of flavonoids: a systematic investigation of ionization and in‐source dissociation mechanisms

Matrix assisted laser desorption ionization (MALDI) is a technique widely employed in the analysis of proteins and peptides, and nowadays it has also been applied to small molecules. There is little significant information regarding the in‐source dissociation processes on MALDI for natural products. Twenty‐six flavonoids (flavanones, flavones and flavonols) were analyzed by MALDI using different methods (with different matrices) and without matrix to comprehend the in‐source reactions and establish good analysis methods for these compounds. Depending on the class, structure and the laser intensity applied, methoxylated flavonoid aglycones can eliminate methyl radicals (˙CH₃) in the source, such as flavonols, but lithium 2,4‐dihydroxybenzoate matrix suppresses the ˙CH₃ eliminations and retro‐Diels–Alder cleavages in the source. All of the flavonoid O‐glycosides evaluated herein eliminated the sugar in source, even in the presence of the matrix, and its product radical ions ([M‐H‐sugar]^?˙) were observed in the negative mode. The flavone C‐glycosides suffered intense dissociation, which was reduced by the addition of a matrix and the application of low laser intensity, mainly in the negative mode. Depending on the hydroxyl substituents, the [M‐H‐H]^?˙ ion was observed with variable relative intensity in the spectra. Copyright © 2015 John Wiley & Sons, Ltd.     

Charge localization and aromatic stabilization in large ring ions: Mass spectra of ms-porphyrins

The major mass spectrometric fragments of ms-tetraphenylporphin and ms-tetra(p-chloro)phenylporphin are [M ? H]⁺˙ and [M ? Cl]⁺˙, respectively. Metal derivatives of these compounds give a modified characteristic fragmentation pattern with peak groups ending in the ions [M ? 4H]⁺˙, [M ? ? ? 5H]⁺˙ and [M ? 2? ? 2H]⁺˙ for the metallo ms-tetraphenylporphins, and [M ? ?Cl ? 2Cl ? 3H]⁺˙ and [M ? 2?Cl ? Cl ? H]⁺˙ for Mgms-tetra(p-chloro)phenylporphin. Deuterated metal derivatives indicate random hydrogen loss from both phenyl and pyrrole carbons. However, metal substituents do not significantly modify the fragmentation pattern in the case of ms-tetra(p-methoxy)phenylporphin. These patterns can be explained in terms of aromatic stabilization of the fragmentation products, coupled with charge localization on the π system in the free base, on the metal atom in the metallo derivatives and on the methoxy function in the p-methoxyphenyl derivative.     

Laser-flash photolysis of naphthyl diselenides; reactivities of naphthylseleno radicals

Transient absorption spectra of 1-naphthylseleno (1-NaphSe˙), and 2-naphthylseleno (2-NaphSe˙) radicals, which are generated by laser-flash photolysis of the corresponding diselenides, were observed. The reactions of 1-NaphSe˙, and 2-NaphSe˙ with 2-methyl-1,3-butadiene and α-methylstyrene were investigated by following the decay rates of these seleno radicals. By both steady-state and laser-flash photolysis, it is proved that these seleno radicals add to alkenes in a reversible manner. The reaction rate constants for such reversible addition reactions were determined by conducting the reaction in the presence of O₂, which traps selectively the carbon-centered radicals formed by the addition reaction of the seleno radicals to the alkenes. The reactivity of 2-NaphSe˙ is higher than that of 1-NaphSe˙, both of which are less reactive than PhSe˙. These reactivities were interpreted with the properties of SOMO calculated by MO method. © 1998 John Wiley & Sons, Inc. Int J Chem Kinet 30: 193–200, 1998.     

Translational energy release and stereochemistry of steroids. VIII-The mechanism of the elimination of water from metastable ions in epimeric 3-hydroxy steroids of the 5α-series

The mechanism of water elimination from metastable molecular, [M ? CH₃˙]⁺ and [M ? ring D]⁺˙ ions of epimeric 3-hydroxy steroids of the 5α-series has been elucidated. Deuterium labelling, the measurement of the translational energy released during the loss of water, and collision-induced decomposition mass-analysed kinetic energy spectrometry were the techniques used. It was found that the mechanisms of water loss from metastable M⁺˙ and [M ? ring D]⁺˙ ions is different from that from [M ? CH₃˙]⁺ ions.     

Reversible pH Switch of Two‐Quartet G‐Quadruplexes Formed by Human Telomere

A four‐repeat human telomere DNA sequence without the 3′‐end guanine, d[TAGGG(TTAGGG)₂TTAGG] (htel1‐ΔG23) has been found to adopt two distinct two G‐quartet antiparallel basket‐type G‐quadruplexes, TD and KDH⁺ in presence of KCl. NMR, CD, and UV spectroscopy have demonstrated that topology of KDH⁺ form is distinctive with unique protonated T18?A20⁺?G5 base triple and other capping structural elements that provide novel insight into structural polymorphism and heterogeneity of G‐quadruplexes in general. Specific stacking interactions amongst two G‐quartets flanking base triples and base pairs in TD and KDH⁺ forms are reflected in 10 K higher thermal stability of KDH⁺. Populations of TD and KDH⁺ forms are controlled by pH. The (de)protonation of A20 is the key for pH driven structural transformation of htel1‐ΔG23. Reversibility offers possibilities for its utilization as a conformational switch within different compartments of living cell enabling specific ligand and protein interactions.     

Structure and formation of gaseous [C4H6O]+˙ ions: 1—The enolic ions [CH2C(OH)?CHCH2]+˙ and [CH2CH?CHCH(OH)]+˙ and their relationship with their keto counterparts

The [C₄H₆O]^+˙ ion of structure [CH₂?CHCH?CHOH]^+˙ (a) is generated by loss of C₄H₈ from ionized 6,6-dimethyl-2-cyclohexen-1-ol. The heat of formation ΔH_f of [CH₂?CHCH?CHOH]^+˙ was estimated to be 736 kJ mol^?1. The isomeric ion [CH₂?C(OH)CH?CH₂]^+˙ (b) was shown to have ΔH_f, ? 761 kJ mol^?1, 54 kJ mol^?1 less than that of its keto analogue [CH₃COCH?CH₂]^+˙. Ion [CH₂?C(OH)CH?CH₂]^+˙ may be generated by loss of C₂H₄ from ionized hex-1-en-3-one or by loss of C₄H₈ from ionized 4,4-dimethyl-2-cyclohexen-1-ol. The [C₄H₆O]^+˙ ion generated by loss of C₂H₄ from ionized 2-cyclohexen-1-ol was shown to consist of a mixture of the above enol ions by comparing the metastable ion and collisional activation mass spectra of [CH₂?CHCH?CHOH]^+˙ and [CH₂?C(OH)CH?CH₂]^+˙ ions with that of the above daughter ion. It is further concluded that prior to their major fragmentations by loss of CH₃˙ and CO, [CH₂?CHCH?CHOH]⁺˙ and [CH₂?C(OH)CH?CH₂]^+˙ do not rearrange to their keto counterparts. The metastable ion and collisional activation characteristics of the isomeric allenic [C₄H₆O]^+˙ ion [CH₂?C?CHCH₂OH]^+˙ are also reported.     

Evaluation of nitric oxide chemical ionization mass spectra of substituted benzenes

Nitric oxide chemical ionization mass spectra of substituted benzenes obtained with the Townsend discharge technique were studied. There were four kinds of base peaks in the mass spectra, i.e. [M + NO]⁺˙, M⁺˙, [M ? H]⁺ and [M ? OR]⁺ (R = H, CH₃). The formation of the specific ion [M + NO]⁺˙ was highly dependent on the kind of substituent, and it was produced more abundantly in the case of substitutions involving electron-accepting groups. The measure of [M + NO]⁺˙ production was evaluated from the value of the ratio [M + NO]⁺˙/M⁺˙. In mono-substitutions, it was clarified that the ratios of [M + NO]⁺˙/M ⁺˙ were correlated with the Hammett substituent constant s?_p or the electrophilic substituent constant s?_p⁺. Monosubstitutions (C₆H₅R) and toluene substitutions (CH₃C₆H₄R) could be classified into six groups in terms of base peak species, [M + NO]⁺˙/M⁺˙ ratios and substituents. In disubstitutions, the mass spectral patterns were governed by the combination of substituents. Mass spectral distinctions among ortho, meta and para isomers could be made in many cases.     

Effects of Ultraviolet Radiation (UV‐A+UV‐B) on the Antioxidant Metabolism of the Red Macroalga Species Acanthophora spicifera (Rhodophyta,Ceramiales) From Different Salinity and Nutrient Conditions

Acanthophora spicifera (M.Vahl) Børgesen is a macroalga of great economic importance. This study evaluated the antioxidant responses of two algal populations of A. spicifera adapted to different abiotic conditions when exposed to ultraviolet‐A+ultraviolet‐B radiation (UV‐A+UV‐B). Experiments were performed using the water at two collection points for 7 days of acclimatization and 7 days of exposure to UVR (3 h per day), followed by metabolic analyses. At point 1, water of 30 ± 1 practical salinity unit (psu) had concentrations of 1.06 ± 0.27 mm ${\text{NH}}_4^{+}$, 8.47 ± 0.01 mm ${\text{NO}}_3^{?}$, 0.17 ± 0.01 mm ${\text{PO}}_4^{?3}$ and pH 7.88. At point 2, water of 35 ± 1 psu had concentrations of 1.13 ± 0.05 mm ${\text{NH}}_4^{+}$, 3.73 ± 0.01 mm ${\text{NO}}_3^{?}$, 0.52 ± 0.01 mm ${\text{PO}}_4^{?3}$ and pH 8.55. Chlorophyll a, phycobiliproteins, carotenoids, mycosporins, polyphenolics and antioxidant enzymes (catalase, superoxide dismutase and guaiacol peroxidase) were evaluated. The present study demonstrates that ultraviolet radiation triggers antioxidant activity in the A. spicifera. However, such activation resulted in greater responses in samples of the point 1, with lower salinity and highest concentration of nutrients.     

Hydrogen transfer in the retro diels–alder fragmentation of oxygen-containing heterocyclic compounds. II—Chromones

Mass Spectra of unsubstituted, 2-methyl-, 3-methyl and 2,3-dimethylchromones were examined. These compounds showed [RDA]⁺˙ and [RDA + H]⁺ ions as characteristc ions, together with [M? H]⁺,[M? CO]⁺˙,[M? CHO]⁺ and [RDA? CO]⁺˙ ions. Based on deuterium labelling experiments and measurement of metastable peaks by the ion kinetic energy defocusing technique, the origin of transferred hydrogen in the [RDA + H]⁺ ion was clarified. The mechanism of the [RDA + H]⁺ ion formation is discussed.