A SURVEY OF PHOTOPRODUCTS OF AN IRRADIATED OLIGODEOXYNUCLEOTIDE BY MONOCHROMATIC PHOTONS WITH THE ENERGY RANGED FROM 6.5 TO 22.5 eV

We have irradiated 2'-deoxyadenylyl-(3'-5')-2'-deoxyadenosine (dephospho(dA)₂) in solid state with a newly developed synchrotron irradiation system over 6.5 to 22.5 eV photon energy range (190 to 55 nm in wavelength). Densitometric analysis of thin-layer chromatogram of photoproducts indicated that adenine and deoxyadenosine monophosphate were commonly produced above 7.3 eV (170 nm) in approximately equal amount. Deoxyribose was not detected by the fluorescence method with scratched materials from the chromatogram at any location except deoxyadenosine monophosphate and parent oligonucleotide positions. The photoproducts above mentioned were not observed at 6.5 eV (190 nm) even after very high radiation fluence. The energy dependence of this degradation indicates that the shorter the wavelength in use the smaller the fluence it requires. Careful examination of irradiated oligonucleotide on the chromatograms shows that the major portion of deoxyadenosine monophosphate so produced was the 5'phospho derivative. This site-selective degradation, independent of photon energy, seemed to be a remarkable characteristic of vacuum-UV induced effects above 7 eV. From these results a working hypothesis was advanced that the deoxypentose moiety was first destroyed in one of the nucleoside residues due to the strong absorption in the sugar-phosphate group, liberating adenine on the one hand and leaving 5'-deoxyadenosine monophosphate on the other hand.     

PHOTO-CIDNP STUDY OF ADENYLYL-CONTAINING DEOXY-DINUCLEOTIDES. PAIR SUBSTITUTION EFFECTS DUE TO INTRAMOLECULAR CATION RADICAL DEPROTONATION

Abstract— 360 MHz ¹H photo-CIDNP spectra of several adenylyl containing deoxy dinucleotides show that fast deprotonation at the 6-amino group of the adenylyl radical cation can occur via two intramolecular routes. One is mediated by the 5'-phosphomonoester group and only occurs for the pdA moiety at the 3' end of the dinucleotide, e.g. in pdTpdA and pdApdA; molecular model building studies reveal that fluctuations away from the B-DNA like conformation are involved. In the second route the deprotonation is catalyzed by N-l located on an adjacent adenine ring, like in dApdA and pdApdA; it probably occurs for both adenylyl units in a stacked conformation. This fast deprotonation leads to the observation of negative polarization for the adenineH–8 as was observed in the case of adenosine 5-monophosphate in the presence of added phosphate.     

Synthesis and properties of DNA oligomers containing 2'-deoxynucleoside N-oxide derivatives

Cytosine and adenine N-oxide derivatives have long been known as products resulting from the oxidative damage of DNA by peroxides such as hydrogen peroxide. Although the synthesis and properties of 2'-deoxynucleoside N-oxide derivatives have been well described, little has been reported about the chemical and biochemical behavior of initially formed DNA oligomers containing these N-oxide bases. In this study, we established a convenient method for the solid-phase synthesis of oligodeoxynucleotides incorporating 2'-deoxycytidine N-oxide (dC O) or 2'-deoxyadenosine N-oxide (dA O) by using the postsynthetic oxidation of N-protected DNA oligomers except for the target dC or dA site with m-CPBA in MeOH in a highly selective manner. In this strategy, the benzoyl, phthaloyl, and (4-isopropylphenoxy)acetyl groups proved to serve as base protecting groups to avoid oxidation of adenine, cytosine, and guanine, respectively, at the unmodified sites.     

Role of sequence and conformation on the photochemistry and the photophysics of A-T DNA dimers: an experimental and computational approach

The role of base sequence and conformation on the photochemistry and photophysics of thymidylyl (3'-5')-2'-deoxyadenosine sodium salt (TpdA) and 2-deoxyadenylyl (3'-5')-thymidine ammonium salt (dApT) was studied. To this end, nanosecond transient absorption at 266 nm, steady-state irradiation at 254 nm, and quantum chemical calculations were used. The transient absorption spectra show the solvated electron broad band in the visible region for each dinucleotide. In addition, low-intensity absorption bands are observed in the UV region, which are attributed to the deprotonated and protonated neutral radicals of adenine and thymine bases. Photoionization (PI) occurs by one- and two-photon pathways; the latter accounting for approximately 70% of the net PI yield. A diffusion-limited rate constant of 2.0 x 10(10) M(-1) s(-1) was obtained for the reaction of the neutral molecule with the photoejected electron in both sequences. The photodestruction yield, measured from the chromophore loss at 260 nm, decreases in the presence of well-known electron scavengers. This suggests the participation of base radical anions as one of the photodegradation pathways, which is higher in TpdA than in dApT. The intermediacy of a radical ion pair (charge separated state) between the adjacent adenine and thymine bases is proposed in the formation of the [2 + 2] cycloadduct intermediate. The [2 + 2] cycloadduct intermediate is known to be the precursor of the thymine-adenine eight-member ring photoproduct (TA*). Conformational constrains in the radical ion pair are suggested to explain the absence of the TA* photoproduct in dApT. This hypothesis is supported by semiempirical calculations performed on all relevant reactive intermediates proposed to participate in the mechanism of formation of TA*. Altogether, the results show that sequence and conformation profoundly influence the photochemistry and the photophysics of these DNA model systems.     

The photochemistry of thymidylyl-(3'-5')-5-methyl-2'-deoxycytidine in aqueous solution

The photochemistry of the dinucleoside monophosphate thymidylyl-(3'-5')-5-methyl-2'-deoxycytidine (Tpm5dC) has been studied in aqueous solution using both 254 nm and UV-B radiation. A variety of dinucleotide photoproducts containing 5-methylcytosine (m5C) have been isolated and characterized. These include two cyclobutane dimers (CBD) (the cis-syn [c,s]and trans-syn forms), a (6-4) adduct and its related Dewar isomer, and two isomers of a product in which the m5C moiety was converted into an acrylamidine. Small amounts of thymidylyl-(3'-5')-thymidine (TpT) were also formed, presumably as a secondary photoreaction product. In addition, a photoproduct was characterized in which the m5C moiety was lost, thus generating 3'-thymidylic acid esterified with 2'-deoxyribose at the 5-hydroxyl on the sugar moiety. The c,s CBD of Tpm5dC readily undergoes deamination to form the corresponding CBD of TpT. The kinetics of this deamination process has been studied; the corresponding enthalpy and entropy of activation for the reaction have been evaluated at pH 7.4 as being, respectively, 73.4 kJ/mol and -103.5 J/K mol. Deamination was not observed for the other characterized photoproducts of Tpm5dC.     

Synthesis of an azide-bearing N-mustard analogue of S-adenosyl-L-methionine

The synthesis of an azide-bearing N-mustard S-adenosyl-L-methionine (SAM) analogue, 8-azido-5'-(diaminobutyric acid)-N-iodoethyl-5'-deoxyadenosine, has been accomplished in 10 steps from commercially available 2',3'-isopropylidene adenosine. Critical to this success was executing C8 azidation prior to derivatizing the 5'-position of the ribose sugar and the late stage alkylation of the 5' amino group with bromoethanol, which was necessitated by the reactivity of the aryl azide moiety. The azide-bearing N-mustard is envisioned as a useful biochemical tool by which to probe DNA and protein methylation patterns.     

One-pot two-step enzymatic coupling of pyrimidine bases to 2-deoxy-D-ribose-5-phosphate. A new strategy in the synthesis of stable isotope labeled deoxynucleosides

The enzymatic synthesis of thymidine from 2-deoxy-D-ribose-5-phosphate is achieved, in a one-pot two-step reaction using phosphoribomutase (PRM) and commercially available thymidine phosphorylase (TP). In the first step the sugar-5-phosphate is enzymatically rearranged to alpha-2-deoxy-D-ribose-1-phosphate. Highly active PRM is easily obtained from genetically modified overproducing E. coli cells (12,000 units/84 mg protein) and is used without further purification. In the second step thymine is coupled to the sugar-1-phosphate. The thermodynamically unfavorable equilibrium is shifted to the product by addition of MnCl(2) to precipitate inorganic phosphate. In this way the overall yield of the beta-anomeric pure nucleoside increases from 14 to 60%. In contrast to uracil, cytosine is not accepted by TP as a substrate. Therefore, 2'-deoxy-cytidine is obtained by functional group transformations of the enzymatically prepared 2'-deoxy-uridine. The method has been demonstrated by the synthesis of [2',5'-(13)C(2)]- and [1',2',5'-(13)C(3)]thymidine as well as [1',2',5'-(13)C(3)]2'-deoxyuridine and [3',4'-(13)C(2)]2'-deoxycytidine. In addition the nucleoside bases thymine and uracil are tetralabeled at the (1,3-(15)N(2),2,4-(13)C(2))-atomic positions. All compounds are prepared without any scrambling or dilution of the labeled material and are thus obtained with a very high isotope enrichment (96-99%). In combination with the methods that have been developed earlier it is concluded that each of the (13)C- and (15)N-positions and combination of positions of the pyrimidine deoxynucleosides can be efficiently labeled starting from commercially available and highly (13)C- or (15)N-enriched formaldehyde, acetaldehyde, acetic acid, potassium cyanide, methylamine hydrochloride, and ammonia.     

Design of a new fluorescent cofactor for DNA methyltransferases and sequence-specific labeling of DNA

Sequence-specific labeling of DNA is of immense interest for analytical and functional studies of DNA. We present a novel approach for sequence-specific labeling of DNA using a newly designed fluorescent cofactor for the DNA methyltransferase from Thermus aquaticus (M.TaqI). Naturally, M.TaqI catalyzes the nucleophilic attack of the exocyclic amino group of adenine within the double-stranded 5'-TCGA-3' DNA sequence onto the methyl group of the cofactor S-adenosyl-L-methionine (AdoMet) leading to methyl group transfer. The design of a new fluorescent cofactor for covalent labeling of DNA was based on three criteria: (1) Replacement of the methionine side chain of the natural cofactor AdoMet by an aziridinyl residue leads to M.TaqI-catalyzed nucleophilic ring opening and coupling of the whole nucleoside to DNA. (2) The adenosyl moiety is the molecular anchor for cofactor binding. (3) Attachment of a fluorophore via a flexible linker to the 8-position of the adenosyl moiety does not block cofactor binding. According to these criteria the new fluorescent cofactor 8-amino[1'-(N'-dansyl)-4'-aminobutyl]-5'-(1-aziridinyl)-5'-deoxyadenosine (3) was synthesized. 3 binds about 4-fold better than the natural cofactor AdoMet to M.TaqI and is coupled with a short duplex oligodeoxynucleotide by M.TaqI. The identity of the expected modified nucleoside was verified by electrospray ionization mass spectrometry after enzymatic fragmentation of the product duplex. In addition, the new cofactor 3 was used to sequence-specifically label plasmid DNA in a M.TaqI-catalyzed reaction.     

Acid/azole complexes as highly effective promoters in the synthesis of DNA and RNA oligomers via the phosphoramidite method

The utility of various kinds of acid salts of azole derivatives as promoters for the condensation of a nucleoside phosphoramidite and a nucleoside is investigated. Among the salts, N-(phenyl)imidazolium triflate, N-(p-acetylphenyl)imidazolium triflate, N-(methyl)benzimidazolium triflate, benzimidazolium triflate, and N-(phenyl)imidazolium perchlorate have shown extremely high reactivity in a liquid phase. These reagents serve as powerful activators of deoxyribonucleoside 3'-(allyl N,N-diisopropylphosphoramidite)s or 3'-(2-cyanoethyl N,N-diisopropylphosphoramidite)s employed in the preparation of deoxyribonucleotides, and 3'-O-(tert-butyldimethylsilyl)ribonucleoside 2'-(N,N-diisopropylphosphoramidite)s or 2'-O-(tert-butyldimethylsilyl)ribonucleoside 3'-(N,N-diisopropylphosphoramidite)s used for the formation of 2'-5' and 3'-5' internucleotide linkages between ribonucleosides, respectively. The azolium salt has allowed smooth and high-yield condensation of the nucleoside phosphoramidite and a 5'-O-free nucleoside, in which equimolar amounts of the reactants and the promoter are employed in the presence of powdery molecular sieves 3A in acetonitrile. It has been shown that some azolium salts serve as excellent promoters in the solid-phase synthesis of oligodeoxyribonucleotides and oligoribonucleotides. For example, benzimidazolium triflate and N-(phenyl)imidazolium triflate can be used as effective promoters in the synthesis of an oligodeoxyribonucleotide, (5')CGACACCCAATTCTGAAAAT(3') (20mer), via a method using O-allyl/N-allyloxycarbonyl-protected deoxyribonucleoside 3'-phosphoramidites or O-(2-cyanoethyl)/N-phenoxyacetyl-protected deoxyribonucleotide 3'-phosphoramidite as building blocks, respectively, on high-cross-linked polystyrene resins. Further, N-(phenyl)imidazolium triflate is useful for the solid-phase synthesis of oligoribonucleotides, such as (5')AGCUACGUGACUACUACUUU(3') (20mer), according to an allyl/allyloxycarbonyl-protected strategy. The utility of the azolium promoter has been also demonstrated in the liquid-phase synthesis of some biologically important substances, such as cytidine-5'-monophosphono-N-acetylneuraminic acid (CMP-Neu5Ac) and adenylyl(2'-5')adenylyl(2'-5')adenosine (2-5A core).     

Photoreaction at 5'-(G/C)AA(Br)UT-3' sequence in duplex DNA: efficient generation of uracil-5-yl radical by charge transfer

The photoreactivities of 5-halouracil-containing DNA have widely been used for analysis of protein-DNA interactions and have recently been used for probing charge-transfer processes along DNA. Despite such practical usefulness, the detailed mechanisms of the photochemistry of 5-halouracil-containing DNA are not well understood. We recently discovered that photoirradiation of BrU-substituted DNA efficiently produced 2'-deoxyribonolactone at 5'-(G/C)AABrUBrU-3' and 5'-(G/C)ABrUBrU-3' sequences in duplex DNA. Using synthetic oligonucleotides, we found that similar photoreactivities were maintained at the 5'-(G/C)AABrUT-3' sequence, providing ribonolactone as a major product with concomitant release of adenine base. In this paper, the photoreactivities of various oligonucleotides possessing the 5'-BrUT-3' sequence were examined to elucidate the essential factors of this photoreaction. HPLC product analysis indicated that the yield of 2'-deoxyribonolactone largely depends on the ionization potential of the purine derivatives located 5'-upstream of 5'-BrUT-3', as well as the electron-donating ability of their pairing cytosine derivatives. Oligonucleotides that possess G in the complementary strand provided the ribonolactone with almost the same efficiency. These results clearly suggest that the photoinduced charge transfer from the G-5' upstream of 5'-BrUT-3' sequence, in the same strand and the complementary strand, initiates the reaction. To examine the role of intervening A/T base pair(s) between the G/C and the 5'-BrUT-3' sequence, the photoreactivities of a series of oligonucleotides with different numbers of intervening A/T base pairs were examined. The results revealed that the hotspot sequence consists of the electron-donating G/C base pair, the 5'-BrUT-3' sequence as an acceptor, and an appropriate number of A/T base pairs as a bridge for the charge-transfer process.     

Model studies of DNA C5' radicals. Selective generation and reactivity of 2'-deoxyadenosin-5'-yl radical

The reaction of hydrated electrons (e(aq)(-)) with 8-bromo-2'-deoxyadenosine has been investigated by radiolytic methods coupled with product studies and addressed computationally by means of DFT-B3LYP calculations. Pulse radiolysis revealed that this reaction was complete in approximately 0.3 mus, and, at this time, no significant absorption was detected. The spectrum of a transient developed in 20 mus has an absorbance in the range 300-500 nm (epsilon(max) congruent with 9600 M(-1) cm(-1) at 360 nm), and it was assigned to aromatic aminyl radical 3. Computed vertical transitions (TD-UB3LYP/6-311+G) are in good agreement with the experimental observations. Radical 3 is obtained by the following reaction sequence: one-electron reductive cleavage of the C-Br bond that gives the C8 radical, a fast radical translocation from the C8 to C5' position, and an intramolecular attack of the C5' radical at the C8,N7 double bond of the adenine moiety. The rate constant for the cyclization is 1.6 x 10(5) s(-1). On the basis of the theoretical findings, the cyclization step is highly stereospecific. The rate constants for the reactions of C5' and aminyl 3 radicals with different oxidants were determined by pulse radiolysis methods. The respective rate constants for the reaction of 2'-deoxyadenosin-5'-yl radical with dioxygen, Fe(CN)(6)(3)(-), and MV(2+) in water at ambient temperature are 1.9 x 10(9), 4.2 x 10(9), and 2.2 x 10(8) M(-1) s(-1). The value for the reaction of aminyl radical 3 with Fe(CN)(6)(3-) is 8.3 x 10(8) M(-1) s(-1), whereas the reaction with dioxygen is reversible. Tailored experiments allowed the reaction mechanism to be defined in some detail. A synthetically useful radical cascade process has also been developed that allows in a one-pot procedure the conversion of 8-bromo-2'-deoxyadenosine to 5',8-cyclo-2'-deoxyadenosine in a diastereoisomeric ratio (5'R):(5'S) = 6:1 and in high yield, by reaction with hydrated electrons in the presence of K(4)Fe(CN)(6).     

FLUORESCENCE QUANTUM YIELD DETERMINATION OF PYRIMIDINE (6-4) PYRIMIDONE PHOTOADDUCTS

Abstract An extensive study of the fluorescence characteristics of pyrimidine (6-4) pyrimidone photoadducts, a major class of far-UV-induced DNA lesions, was carried out on dinucleoside monophosphate (6-4) photoadducts, including thymidylyl-(3'→ 5')-thymidine (TpT), 2'-deoxycytidylyl-(3'-5')-thymidine, thymidylyl-(3'→ 5')-2'-deoxy-cytidine, 2'-deoxyuridylyl-(3'→ 5')-thymidine, 5-methyl-2'-deoxycytidylyl-(3'-5')-thymidine (6-4) photoadducts and the corresponding base (6-4) photoadducts, 6-4'-(5'-methylpyrimidin-2'-one) thymine (TT), 5-hydroxy-6-4'-(5'-methylpyrimidin-2'-one)-5,6-dihydrothymine (CT), 5-amino-6-4'-(pyrimidin-2'-one)-5,6-dihydrothymine (UC) obtained by mild acidic hydrolysis of the former derivatives. The fluorescence quantum yield (Φ_F) of these compounds was found to depend on one hand, on the nature of the two bases involved and the base substituent and, on the other hand, on the presence of the phosphate group. The hydrolysis of the phosphodiester bond was shown to enhance Φ_F, the larger effect being observed in the case of the thymine-thymine photoadducts with a seven-fold increase of the Φ_F value in the case of TT as compared to TpT (0.21 and 0.03, respectively). These results are discussed in terms of structural considerations.     

2-aza-2'-deoxyadenosine: synthesis, base-pairing selectivity, and stacking properties of oligonucleotides

2-Aza-2'-deoxyadenosine (2, z2Ad) is synthesized via its 1,N6-etheno derivative 7 and enzymatically deaminated to 2-aza-2'-deoxyinosine (3). Compound 2 is converted into the phosphoramidite building block 10b. This is employed in solid-phase oligonucleotide synthesis. The 2-azapurine base forms a strong base pair with guanine, but a much weaker one with adenine, thymine, and cytosine. Oligonucleotide duplexes with dangling nucleotide residues, such as 2-aza-2'-deoxyadenosine and 7-deaza-2'-deoxyadenosine (4, c7Ad), either on one or both termini, are synthesized, and the thermal stability of the duplexes is correlated with the hydrophobic properties of the dangling nucleotide residues.     

Synthesis of pCpCpA-3'-NH-phenylalanine as a ribosomal substrate

[reaction: see text] The trinucleotide cytidylyl(3'-->5'phosphoryl)cytidylyl(3'-->5'phosphoryl)-3'-deoxy-3'-(L-phenylalanyl) amido adenosine (CpCpA-NH-Phe) was synthesized by phosphoramidite chemistry from 3'-amino-3'-deoxyadenosine as the ribosomal substrate. The 3'-amino-3'-deoxyadenosine was first converted to 3'-(N-tert-butyloxycarbonyl-L-phenylalanine)amido-3'-deoxy-6-N,6-N,2'-O-tribenzoyl-adenosine and then coupled with cytidine phosphoramidite to produce the fully protected CpCpA-NH-Phe-Boc. The title product was obtained after removing all protection groups and then radiolabeled with (32)P to yield pCpCpA-NH-Phe, which demonstrated high activity for the peptidyl transferase reaction in the ribosome.     

Selective generation and reactivity of 5'-adenosinyl and 2'-adenosinyl radicals

The reaction of hydrated electrons (e(-)(aq) with 8-bromoadenosine 7 has been investigated by radiolytic methods coupled with product studies. Pulse radiolysis revealed that one-electron reductive cleavage of the C-Br bond gives the C8 radical 8 followed by a fast radical translocation to the sugar moiety. The reaction is partitioned between C5' and C2' positions in a 60:40 ratio leading to 5'-adenosinyl radical 9 and 2'-adenosinyl radical 11. This radical translocation from C8 to different sites of the sugar moiety has also been addressed computationally by means of DFT B3LYP calculations. In addition, ketone 21 was prepared and photolyzed providing an independent generation of C2' radical 11. Both C5' and C2' radicals undergo unimolecular reactions. Radical 9 attacks adenine with a rate constant of 1.0 x 10(4) s(-1) and gives the aromatic aminyl radical 10, whereas C2' radical 11 liberates adenine with a rate constant of 1.1 x 10(5) s(-1).     

Hydroxyethylation of uracil,adenine, and cytosine with ethylene carbonate

It was established that both 1-(2-hydroxyethyl)uracil and 3-(2-hydroxyethyl)-uracil, which are converted to 1, 3-bis (2-hydroxyethyl) uracil, are formed in the first step of the reaction of uracil with ethylene carbonate. The simultaneous formation of 9- (2-hydroxyethyl) adenine and 3- (2-hydroxyethyl) adenine occurs in the reaction of adenine with ethylene carbonate. The only product of hydroxyethylation of cytosine was 1-(2-hydroxyethyl) cytosine. Methods for the analytical separation of the hydroxyethylation products and the preparative isolation of the 1- and 9-hydroxyethyl derivatives are proposed.Translated from Khimiya Geterotsiklicheskikh Soedinenii, No. 5, pp. 684–689, May, 1978.     

2-芳胺基-5-[5′-氨基-1′-(4″-氯苯基)-1′,2′,3′-三唑-4′-基]-1,3,4-噻二唑的合成~≠

1-[5’-氨基-1’-(4”-氯苯基)-1,2,3-三唑-4’-甲酰基]-4-芳基-3-氨基硫脲在浓硫酸催化下环化得到2-芳胺基-5-[5’-氨基-1’-(4”-氯苯基)-1’,2’,3’,-三唑-4’-基]-1,3,4-噻二唑2a～i,依次法合成了九个标题化合物,收率为30～74％。化合物2i的结构用X-光衍射单晶分析确证。     

Synthesis of dinucleoside (N3'-->MeP5') methanephosphonamidates

[structure: see text] Three different approaches were used for the synthesis of dinucleoside methanephosphonamidates [3'-NH-P(O)(CH3)O-5'], starting from dichloromethylphosphine or dichloromethanephosphonate as the phosphorus-containing moiety. 5'-DMT-3'-amino-3'-deoxythymidine and N(4)-benzoyl-5'-DMT-3'-amino-2',3'-dideoxycytidine were used as the aminonucleoside precursors and the respective 3'-protected nucleosides (thymidine or N(4)-benzoyl-2'-deoxycytidine) as the 5'-hydroxyl reagents.     

Matrix-assisted laser desorption/ionization detection of polymerase chain reaction products by utilizing the 5'-3' exonuclease activity of Thermus aquaticus DNA polymerase

The 5'-3' exonuclease activity of DNA polymerase was utilized in the polymerase chain reaction system to generate a specific signal concomitant with amplification. These signals were detected by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOFMS). This method obviates the need to perform extensive DNA purification of reaction products that is often necessary for detecting larger DNA molecules by mass spectrometry. Oligonucleotides complementary to the internal region of the amplicon are degraded by the 5'-3' exonuclease activity and the degradation products are analyzed by MALDI mass spectrometry. We refer to this assay as the Exo-taq assay or probe degradation assay. This method should be amenable to automation.     

Efficient light harvesting by using green Zn-porphyrin-sensitized nanocrystalline TiO2 films

A series of novel zinc metalloporphyrins, cyano-3-(2'-(5',10',15',20'-tetraphenylporphyrinato zinc(II))yl)-acrylic acid (Zn-3), 3-(trans-2'-(5',10',15',20'-tetraphenylporphyrinato zinc(II))yl)-acrylic acid (Zn-5), 2-cyano-5-(2'-(5',10',15',20'-tetraphenylporphyrinato zinc(II))yl)-penta-2,4-dienoic acid (Zn-8), 4-(trans-2'-(2' '-(5' ',10' ',15' ',20' '-tetraphenylporphyrinato zinc(II))yl)ethen-1'-yl))-1,2-benzenedicarboxylic acid (Zn-11), and 2-cyano-3-[4'-(trans-2' '-(2' '-(5' ',10' ',15' ',20' '-tetraphenylporphyrinato zinc(II))yl) ethen-1' '-yl)-phenyl]-acrylic acid (Zn-13) were synthesized and characterized by using various spectroscopic techniques. Density functional theory (DFT) and time-dependent DFT (TDDFT) calculations show that key molecular orbitals (MOs) of porphyrins Zn-5 and Zn-3 are stabilized and extended out onto the substituent by pi-conjugation, causing enhancement and red shifts of visible transitions and increasing the possibility of electron transfer from the substituent. The porphyrins were investigated for conversion of sunlight into electricity by constructing dye-sensitized TiO(2) solar cells using an I(-)/I(3)(-) electrolyte. The cells yield close to 85% incident photon-to-current efficiencies (IPCEs), and under standard AM 1.5 sunlight, the Zn-3-sensitized solar cell demonstrates a short circuit photocurrent density of 13.0 +/- 0.5 mA/cm(2), an open-circuit voltage of 610 +/- 50 mV, and a fill factor of 0.70 +/- 0.03. This corresponds to an overall conversion efficiency of 5.6%, making it the most efficient porphyrin-sensitized solar cell reported to date.