Stable Copper(I)‐Mediated Base Pairing in DNA

A GNA (glycol nucleic acid) functionalized nucleoside analogue containing the artificial nucleobase 1H‐imidazo[4,5‐f][1,10]phenanthroline (P) was used to form a copper(I)‐mediated base pair within a DNA duplex. The geometrical constraints imposed by the artificial nucleobase play a pivotal role in this unprecedented stabilization of copper(I) in aqueous medium via metal‐mediated base pairing. The formation of the copper(I)‐mediated base pair was investigated by temperature‐dependent UV spectroscopy and CD spectroscopy. The metal‐mediated base pair stabilizes the DNA oligonucleotide duplex by 23 °C. A redox chemistry approach confirmed that this base pair formation was due to the incorporation of copper(I) into the duplex. This first report of a copper(I)‐mediated base pair adds metal‐based diversity to the field and consequently opens up the range of possible applications of metal‐modified nucleic acids.     

Binding of metal ions by pyrimidine base pairs in DNA duplexes

Pyrimidine base pairs in DNA duplexes selectively capture metal ions to form metal ion-mediated base pairs, which can be evaluated by thermal denaturation, isothermal titration calorimetry, and nuclear magnetic resonance spectroscopy. In this critical review, we discuss the metal ion binding of pyrimidine bases (thymine, cytosine, 4-thiothymine, 2-thiothymine, 5-fluorouracil) in DNA duplexes. Thymine-thymine (T-T) and cytosine-cytosine (C-C) base pairs selectively capture Hg(II) and Ag(I) ions, respectively, and the metallo-base pairs, T-Hg(II)-T and C-Ag(I)-C, are formed in DNA duplexes. The metal ion binding properties of the pyrimidine-pyrimidine pairs can be changed by small chemical modifications. The binding selectivity of a metal ion to a 5-fluorouracil-5-fluorouracil pair in a DNA duplex can be switched by changing the pH of the solution. Two silver ions bind to each thiopyrimidine-thiopyrimidine pair in the duplexes, and the duplexes are largely stabilized. Oligonucleotides containing these bases are commercially available and can readily be applied in many scientific fields (86 references).     

Electronic properties of metal-modified DNA base pairs

The electronic properties of several metal-modified Watson-Crick guanine-cytosine base pairs are investigated by means of first-principle density functional theory calculations. Focus is placed on a new structure recently proposed as a plausible model for building an antiparallel duplex with Zn-guanine-cytosine pairs, but we also inspect several other conformations and the incorporation of Ag and Cu ions. We analyze the effects induced by the incorporation of one metal cation per base pair by comparing the structures and the electronic properties of the metalated pairs to those of the natural guanine-cytosine pair, particularly for what concerns the modifications of energy levels and charge density distributions of the frontier orbitals. Our results reveal the establishment of covalent bonding between the metal cation and the nucleobases, identified in the presence of hybrid metal-guanine and metal-cytosine orbitals. Attachment of the cation can occur either at the N1 or the N7 site of guanine and is compatible with altering or not altering the H-bond pattern of the natural pair. Cu(II) strongly contributes to the hybridization of the orbitals around the band gap, whereas Ag(I) and Zn(II) give hybrid states farther from the band gap. Most metalated pairs have smaller band gaps than the natural guanine-cytosine pair. The band gap shrinking along with the metal-base coupling suggests interesting consequences for electron transfer through DNA double helices.     

Solid-phase synthesis of positively charged deoxynucleic guanidine (DNG) tethering a Hoechst 33258 analogue: triplex and duplex stabilization by simultaneous minor groove binding

Deoxynucleic guanidine (DNG), a DNA analogue in which positively charged guanidine replaces the phosphodiester linkages, tethering to Hoechst 33258 fluorophore by varying lengths has been synthesized. A pentameric thymidine DNG was synthesized on solid phase in the 3' --> 5' direction that allowed stepwise incorporation of straight chain amino acid linkers and a bis-benzimidazole (Hoechst 33258) ligand at the 5'-terminus using PyBOP/HOBt chemistry. The stability of (DNA)(2).DNG-H triplexes and DNA.DNG-H duplexes formed by DNG and DNG-Hoechst 33258 (DNG-H) conjugates with 30-mer double-strand (ds) DNA, d(CGCCGCGCGCGCGAAAAACCCGGCGCGCGC)/d(GCGGCGCGCGCGCTTTTTGGGCCGCGCGCG), and single-strand (ss) DNA, 5'-CGCCGCGCGCGCGAAAAACCCGGCGCGCGC-3', respectively, has been evaluated by thermal melting and fluorescence emission experiments. The presence of tethered Hoechst ligand in the 5'-terminus of the DNG enhances the (DNA)(2).DNG-H triplex stability by a DeltaT(m) of 13 degrees C. The fluorescence emission studies of (DNA)(2).DNG-H triplex complexes show that the DNG moiety of the conjugates bind in the major groove while the Hoechst ligand resides in the A:T rich minor groove of dsDNA. A single G:C base pair mismatch in the target site decreases the (DNA)(2).DNG triplex stability by 11 degrees C, whereas (DNA)(2).DNG-H triplex stability was decreased by 23 degrees C. Inversion of A:T base pair into T:A base pair in the center of the binding site, which provides a mismatch selectively for DNG moiety, decreases the triplex stability by only 5-6 degrees C. Upon hybridization of DNG-Hoechst conjugates with the 30-mer ssDNA, the DNA.DNG-H duplex exhibited significant increase in the fluorescence emission due to the binding of the tethered Hoechst ligand in the generated DNA.DNG minor groove, and the duplex stability was enhanced by DeltaT(m) of 7 degrees C. The stability of (DNA)(2).DNG triplexes and DNA.DNG duplexes is independent of pH, whereas the stability of (DNA)(2).DNG-H triplexes decreases with increase in pH.     

Hg(II) ion specifically binds with T:T mismatched base pair in duplex DNA

Metal-mediated base pair formation, resulting from the interaction between metal ions and artificial bases in oligonucleotides, has been developed for its potential application in nanotechnology. We have recently found that the T:T mismatched base pair binds with Hg(II) ions to generate a novel metal-mediated base pair in duplex DNA. The thermal stability of the duplex with the T-Hg-T base pair was comparable to that of the corresponding T:A or A:T. The novel T-Hg-T base pair involving the natural base thymine is more convenient than the metal-mediated base pairs involving artificial bases due to the lack of time-consuming synthesis. Here, we examine the specificity and thermodynamic properties of the binding between Hg(II) ions and the T:T mismatched base pair. Only the melting temperature of the duplex with T:T and not of the perfectly matched or other mismatched base pairs was found to specifically increase in the presence of Hg(II) ions. Hg(II) specifically bound with the T:T mismatched base pair at a molar ratio of 1:1 with a binding constant of 10(6) M(-1), which is significantly higher than that for nonspecific metal ion-DNA interactions. Furthermore, the higher-order structure of the duplex was not significantly distorted by the Hg(II) ion binding. Our results support the idea that the T-Hg-T base pair could eventually lead to progress in potential applications of metal-mediated base pairs in nanotechnology.     

Ligand binding mode to duplex and triplex dna assessed by combining electrospray tandem mass spectrometry and molecular modeling

In this paper, we report the analysis of seven benzopyridoindole and benzopyridoquinoxaline drugs binding to different duplex DNA and triple helical DNA, using an approach combining electrospray ionization mass spectrometry (ESI-MS), tandem mass spectrometry (MS/MS), and molecular modeling. The ligands were ranked according to the collision energy (CE(50)) necessary to dissociate 50% of the complex with the duplex or the triplex in tandem MS. To determine the probable ligand binding site and binding mode, molecular modeling was used to calculate relative ligand binding energies in different binding sites and binding modes. For duplex DNA binding, the ligand-DNA interaction energies are roughly correlated with the experimental CE(50), with the two benzopyridoindole ligands more tightly bound than the benzopyridoquinoxaline ligands. There is, however, no marked AT versus GC base preference in binding, as supported both by the ESI-MS and the calculated ligand binding energies. Product ion spectra of the complexes with triplex DNA show only loss of neutral ligand for the benzopyridoquinoxalines, and loss of the third strand for the benzopyridoindoles, the ligand remaining on the duplex part. This indicates a higher binding energy of the benzopyridoindoles, and also shows that the ligands interact with the triplex via the duplex. The ranking of the ligand interaction energies compared with the CE(50) values obtained by MS/MS on the complexes with the triplex clearly indicates that the ligands intercalate via the minor groove of the Watson-Crick duplex. Regarding triplex versus duplex selectivity, our experiments have demonstrated that the most selective drugs for triplex share the same heteroaromatic core.     

Structure of a copper-mediated base pair in DNA.

Stable and selective DNA base pairing by metal coordination was recently demonstrated with nucleotides containing complementary pyridine-2,6-dicarboxylate (Dipic) and pyridine (Py) bases (Meggers, E.; Holland, P. L.; Tolman; W. B.; Romesberg, F. E.; Schultz, P. G. J. Am. Chem. Soc. 2000, 122, 10714-10715). To understand the structural consequences of introducing this novel base pair into DNA we have solved the crystal structure of a duplex containing the metallo-base pair. The structure shows that the bases pair as designed, but in a Z-DNA conformation. The structure also provides a structural explanation for the B- to Z-DNA transition in this duplex. Further solution studies demonstrate that the metallo-base pair is compatible with Z- or B-DNA conformations, depending on the duplex sequence.     

Interactions of mitoxantrone with duplex and triplex DNA studied by electrospray ionization mass spectrometry

We have examined interactions between mitoxantrone (MXT) and DNA duplexes or triplexes with different base compositions by using electrospray ionization mass spectrometry (ESI‐MS), respectively. MXT interacts preferentially with DNA duplexes compared to the triplexes. In the mass spectrum of the duplex–MXT mixture, the complex peaks dominated in the ratios of duplex/MXT of 1:1, 1:2 and 1:3, and the 1:2 duplex/MXT peak was the most abundant. In contrast, only 1:1 triplex–MXT complexes were observed in the mass spectrum of the triplex–MXT mixture, and the most intensive peak was a free triplex ion without MXT. Moreover, no sequence selectivity of MXT to different DNA duplexes was found while MXT showed greater affinity to the triplexes that have adjacent TAT or C⁺GC sequences. In the course of sustained off‐resonance irradiation collision‐induced dissociation (SORI‐CID), the MXT‐duplex complexes generated two separated strands, and the MXT remained on the purine strand side. UV/Vis spectra showed that MXT interacted with DNA by intercalation. Compared with emodin (a duplex intercalator) and napthylquinoline (a triplex binder), we found that the side chain of MXT might play a role in the binding of MXT to the duplexes and the triplexes. ESI‐MS shows an advantage in speed and straightforwardness for the study of drug interactions with nucleic acids. Copyright © 2008 John Wiley & Sons, Ltd.     

Neomycin binding to Watson-Hoogsteen (W-H) DNA triplex groove: a model

Neomycin is the most effective aminoglycoside (groove binder) in stabilizing a DNA triple helix. It stabilizes TAT, as well as mixed base DNA triplexes, better than known DNA minor groove binders (which usually destabilize the triplex) and polyamines. Neomycin selectively stabilizes the triplex (in the presence of salt), without any effect on the DNA duplex. (1) Triplex stabilization by neomycin is salt dependent (increased KCl and MgCl(2) concentrations decrease neomycin's effectiveness, at a fixed drug concentration). (2) Triplex stabilization by neomycin is pH dependent (increased pH decreases neomycin's effectiveness, at a fixed drug concentration). (3) CD binding studies indicate approximately 5-7 base triplets/drug apparent binding site, depending upon the structure/sequence of the triplex. (4) Neomycin shows nonintercalative groove binding to the DNA triplex, as evident from viscometric studies. (5) Neomycin shows a preference for stabilization of TAT triplets but can also accommodate CGC(+) triplets. (6) Isothermal titration calorimetry (ITC) studies reveal an association constant of approximately 2 x 10(5) M(-)(1) between neomycin and an intramolecular triplex and a higher K(a) for polydA.2polydT. (7) Binding/modeling studies show a marked preference for neomycin binding to the larger W-H groove. Ring I/II amino groups and ring IV amines are proposed to be involved in the recognition process. (8) The novel selectivity of neomycin is suggested to be a function of its charge and shape complementarity to the triplex W-H groove, making neomycin the first molecule that selectively recognizes a triplex groove over a duplex groove.     

Contiguous metal-mediated base pairs comprising two Ag(I) ions

The incorporation of transition‐metal ions into nucleic acids by using metal‐mediated base pairs has proved to be a promising strategy for the site‐specific functionalization of these biomolecules. We report herein the formation of Ag⁺‐mediated Hoogsteen‐type base pairs comprising 1,3‐dideaza‐2′‐deoxyadenosine and thymidine. By defunctionalizing the Watson–Crick edge of adenine, the formation of regular base pairs is prohibited. The additional substitution of the N3 nitrogen atom of adenine by a methine moiety increases the basicity of the exocyclic amino group. Hence, 1,3‐dideazaadenine and thymine are able to incorporate two Ag⁺ ions into their Hoogsteen‐type base pair (as compared with one Ag⁺ ion in base pairs with 1‐deazaadenine and thymine). We show by using a combination of experimental techniques (UV and circular dichroism (CD) spectroscopies, dynamic light scattering, and mass spectrometry) that this type of base pair is compatible with different sequence contexts and can be used contiguously in DNA double helices. The most stable duplexes were observed when using a sequence containing alternating purine and pyrimidine nucleosides. Dispersion‐corrected density functional theory calculations have been performed to provide insight into the structure, formation and stabilization of the twofold metalated base pair. They revealed that the metal ions within a base pair are separated by an Ag???Ag distance of about 2.88 Å. The Ag–Ag interaction contributes some 16 kcal mol^?1 to the overall stability of the doubly metal‐mediated base pair, with the dominant contribution to the Ag–Ag bonding resulting from a donor–acceptor interaction between silver 4d‐type and 4s orbitals. These Hoogsteen‐type base pairs enable a higher functionalization of nucleic acids with metal ions than previously reported metal‐mediated base pairs, thereby increasing the potential of DNA‐based nanotechnology.     

Fluorescently Sensing of DNA Triplex Assembly Using an Isoquinoline Alkaloid as Selector,Stabilizer, Inducer,and Switch‐On Emitter

DNA triplex assembly has attracted a variety of interest in the regulation of genetic expression, drug screening, molecular switches, and sensors. However, these achievements are essentially dependent on the formation and stability of the triplex assembly. Herein, the recognition of DNA triplex assembly with various isoquinoline alkaloids was investigated. We found that natural chelerythrine (CHE) exhibits the highest selectivity in recognizing the triplex structure. The DNA triplex stability is substantially increased upon CHE binding, as opposed to the invariance in the stability of the duplex counterpart. CHE also favors the assembly of the triplex‐forming oligonucleotide (TFO) with its duplex counterpart. The triplex binding switches CHE to a strong fluorescent emitter, which suggests CHE as a useful probe in following triplex assembly. As a unique triplex selector, inducer, and emitter, CHE successfully reports the wide pH‐ and metal‐ion‐dependent tunability of the triplex nanoswitch in a label‐free manner.     

Evaluation of effects of bivalent cations on the formation of purine-rich triple-helix DNA by ESI-FT-MS

The GGA triplet repeats are widely dispersed throughout eukaryotic genomes. (GGA)n or (GGT)n oligonucleotides can interact with double-stranded DNA containing (GGA:CCT)n to form triple-stranded DNA. The effects of 8 divalent metal ions (3 alkaline-earth metals and 5 transition metals) on formation of these purine-rich triple-helix DNA were investigated by electrospray ionization Fourier transform ion cyclotron resonance mass spectrometry (ESI-FT-MS). In the absence of metal ions, no triplex but single-strand, duplex, and purine homodimer ions were observed in mass spectra. The triple-helix DNA complexes were observed only in the presence of certain divalent ions. The effects of different divalent cations on the formation of purine-rich triplexes were compared. Transition-metal ions, especially Co²⁺ and Ni²⁺, significantly boost the formation of triple-helix DNA, whereas alkaline-earth metal ions have no positive effects on triplex formation. In addition, Ba²⁺ is notably beneficial to the formation of homodimer instead of triplex.     

Intercalation of ethidium into triple-strand poly(rA).2poly(rU): a thermodynamic and kinetic study

The kinetics and equilibria of the interaction of ethidium bromide (EB) with the triple-stranded RNA, poly(rA).2poly(rU), have been investigated by stopped-flow, absorption, fluorescence, and circular dichroism methods; to properly assess the effect of the third strand on the polymer molar properties, molar volumes, adiabatic compressibilities, and heats of melting have also been measured for both poly(rA).2poly(rU) and poly(rA).poly(rU). The melting experiments reveal that ethidium tends to destabilize the triplex, whereas it stabilizes the duplex; however, the triplex/ethidium system in 0.1 M NaCl is stable below 37 degrees C. The static titrations reveal that one ethidium ion binds every three base triplets of the polymer; on the basis of the excluded-site model, this feature suggests intercalation, as in the duplex, but the binding affinity for the triplex is weaker compared to that for the duplex. The kinetic experiments displayed a two-phase behavior, which was rationalized assuming the sequence D + S right arrow over left arrow DS(I), DS(I) + S right arrow over left arrow DS(II) + S (D = drug, S = site), the second step involving direct transfer of the drug between strands. Comparison with the duplex/EB system reveals that the additional strand of poly(U), present in the triplex, hinders the formation of the intermediate complex DS(I), while stabilizing the structure of the final DS(II) complex by hampering the partial slipping out of the dye from the triplex cavity.     

Reactivity of ferrocenylcarbodiimide with DNA duplex containing single-mismatched base pairs.

Ferrocenylcarbodiimide (1), which is known to react with a guanine (G) or thymine (T) base of single stranded DNA, was allowed to react with DNA duplex having a single mismatched base pair of G-T, T-T, or T-cytosine (C). Electrophoreograms of the reaction mixture showed that 1 could react with G or T base of the mismatched sites on the DNA duplex. However, 1 also reacted with the G base of the terminal site on the DNA duplex. This showed that 1 can react with an unpaired base or unstable base pair such as a terminal or mismatched base on the DNA duplex. Electrochemical mismatch detection could be achieved after hybridization of the ferrocenylated mismatched DNA duplex with a selected DNA probe-immobilized electrode. These results revealed that 1 has a potentiality of serving as a labeling reagent of mismatched bases on the DNA duplex, which is important in the search for heterozygous single nucleotide polymorphisms (SNPs).     

Synthesis and DNA triplex formation of an oligonucleotide containing an urocanamide

An urocanamide nucleoside designed and previously tested as its protected ribose derivative in aprotic solvents for binding a cytosine-guanine (CG) Watson-Crick base pair was successfully incorporated into a triplex forming oligonucleotide. Binding affinity and specificity of this nonnatural nucleoside were studied in a triple helix with duplex targets containing all four possible Watson-Crick base pairs opposite the nucleoside analog in the third strand. UV melting experiments indicate the formation of a well-defined triplex with specific binding of the urocanamide analog to a CG inversion of the homopurine-homopyrimidine target. However, binding affinities in the triplex are weak and much lower when compared to the canonical base triads.     

Efficient incorporation of a copper hydroxypyridone base pair in DNA

Recently, we reported the first artificial nucleoside for alternative DNA base pairing through metal complexation (J. Org. Chem. 1999, 64, 5002-5003). In this regard, we report here the synthesis of a hydroxypyridone-bearing nucleoside and the incorporation of a neutral Cu(2+)-mediated base pair of hydroxypyridone nucleobases (H-Cu-H) in a DNA duplex. When the hydroxypyridone bases are incorporated into the middle of a 15 nucleotide duplex, the duplex displays high thermal stabilization in the presence of equimolar Cu(2+) ions in comparison with a duplex containing an A-T pair in place of the H-H pair. Monitoring temperature dependence of UV-absorption changes verified that a Cu(2+)-mediated base pair is stoichiometrically formed inside the duplex and dissociates upon thermal denaturation at elevated temperature. In addition, EPR and CD studies suggested that the radical site of a Cu(2+) center is formed within the right-handed double-strand structure of the oligonucleotide. The present strategy could be developed for controlled and periodic spacing of neutral metallobase pairs along the helix axis of DNA.     

Ag(I) ion mediated formation of a C-A mispair by DNA polymerases

Silver turns up the A-C: In the presence of Ag(I) ions, a DNA polymerase incorporated deoxyadenosine (from dATP) at the site opposite cytosine in the template strand to afford the full-length product (see scheme), meaning that DNA polymerases prefer a C-Ag(I)-A base pair to the more thermodynamically stable C-Ag(I)-C base pair.     

Combining the best in triplex recognition: synthesis and nucleic acid binding of a BQQ-neomycin conjugate

Synthesis of a BQQ-neomycin conjugate is reported. The conjugate combines two ligands, one known to intercalate triplexes (BQQ) and another known to bind in the triplex groove (neomycin). The conjugate stabilizes T.A.T, as well as mixed base DNA triplex, better than neomycin, BQQ, or a combination of both. The conjugate selectively stabilizes the triplex (in the presence of physiological salt concentrations), with as little as 4 muM of the ligand leading to a DeltaTm of >60 degrees C. Competition dialysis studies show a clear preference for the drug binding to triplex DNA/RNA over the duplex/single strand structures. Modeling studies suggest a structure of neomycin bound to the larger W-H (Watson-Hoogsteen) groove with BQQ intercalated between the triplex bases.     

Formation and stability of a Janus-Wedge type of DNA triplex

A new type of DNA targeting with the formation of a Janus-Wedge (J-W) triple helix is described. The "wedge" residue (W) attached to a PNA backbone is designed to insert itself into double-stranded DNA and base pair with both Watson-Crick faces. To study the stability of such an assembly, we have examined the formation of the J-W triplex with dC8 - T8 target sequence. The use of this target sequence permits the study of this new helix form without competing Watson-Crick interactions between the two target residues. Studies indicate that the W strand binds to both target strands, with defined polarity and a stability (-15.2 kcal/mol) that is roughly the sum of the two independent duplex interactions.