共查询到20条相似文献,搜索用时 250 毫秒
1.
Chen G Kierzek R Yildirim I Krugh TR Turner DH Kennedy SD 《The journal of physical chemistry. B》2007,111(24):6718-6727
The Watson-Crick-like isoG-isoC (iGiC) pair, with the amino and carbonyl groups transposed relative to the Watson-Crick GC pair, provides an expanded alphabet for understanding interactions that shape nucleic acid structure. Here, thermodynamic stabilities of tandem GA pairs flanked by iGiC pairs are reported along with the NMR structures of the RNA self-complementary duplexes (GCiGGAiCGCA)2 and (GGiCGAiGCCA)2. A sheared GA pairing forms in (GCiGGAiCGCA)2, and an imino GA pairing forms in (GGiCGAiGCCA)2. The structures contrast with the formation of tandem imino and sheared GA pairs flanked by GC pairs in the RNA self-complementary duplexes (GCGGACGC)2 and (GGCGAGCC)2, respectively. In both iGiC duplexes, Watson-Crick-like hydrogen bonds are formed between iG and iC, and iGiC substitutions result in less favorable loop stability. The results provide benchmarks for testing computations of molecular interactions that shape RNA three-dimensional structure. 相似文献
2.
Yildirim I Kennedy SD Stern HA Hart JM Kierzek R Turner DH 《Journal of chemical theory and computation》2012,8(1):172-181
All-atom force fields are important for predicting thermodynamic, structural, and dynamic properties of RNA. In this paper, results are reported for thermodynamic integration calculations of free energy differences of duplex formation when CG pairs in the RNA duplexes r(CCGG)(2), r(GGCC)(2), r(GCGC)(2), and r(CGCG)(2) are replaced by isocytidine-isoguanosine (iCiG) pairs. Agreement with experiment was improved when ε/ζ, α/γ, β, and χ torsional parameters in the AMBER99 force field were revised on the basis of quantum mechanical calculations. The revised force field, AMBER99TOR, brings free energy difference predictions to within 1.3, 1.4, 2.3, and 2.6 kcal/mol at 300 K, respectively, compared to experimental results for the thermodynamic cycles of CCGG → iCiCiGiG, GGCC → iGiGiCiC, GCGC → iGiCiGiC, and CGCG → iCiGiCiG. In contrast, unmodified AMBER99 predictions for GGCC → iGiGiCiC and GCGC → iGiCiGiC differ from experiment by 11.7 and 12.6 kcal/mol, respectively. In order to test the dynamic stability of the above duplexes with AMBER99TOR, four individual 50 ns molecular dynamics (MD) simulations in explicit solvent were run. All except r(CCGG)(2) retained A-form conformation for ≥82% of the time. This is consistent with NMR spectra of r(iGiGiCiC)(2), which reveal an A-form conformation. In MD simulations, r(CCGG)(2) retained A-form conformation 52% of the time, suggesting that its terminal base pairs may fray. The results indicate that revised backbone parameters improve predictions of RNA properties and that comparisons to measured sequence dependent thermodynamics provide useful benchmarks for testing force fields and computational methods. 相似文献
3.
A heptamer composed of C5-(1-propynyl) pyrimidines (Y(p)'s) is a potent and specific antisense agent against the mRNA of SV40 large T antigen (Wagner, R. W.; Matteucci, M. D.; Grant, D.; Huang, T.; Froehler, B. C. Nat. Biotechnol. 1996, 14, 840-844). To characterize the role of the propynyl groups in molecular recognition, thermodynamic increments associated with substitutions in DNA:RNA duplexes, such as 5'-dCCUCCUU-3':3'-rGAGGAGGAAAU-5', have been measured by UV melting experiments. For nucleotides tested, an unpaired dangling end stabilizes unmodified and propynylated duplexes similarly, except that addition of a 5' unpaired rA is 1.4 kcal/mol more stabilizing on the propynylated, PODN:RNA, duplex than on the DNA:RNA duplex. Free energy increments for addition of single propynyl groups range from 0 to -4.0 kcal/mol, depending on the final number and locations of substitutions. A preliminary model for predicting the stabilities of Y(p)-containing hybrid duplexes is presented. Eliminating one amino group, and therefore a hydrogen bond, by substituting inosine (I) for guanosine (G), to give 5'-dC(p)C(p)U(p)C(p)C(p)U(p)U(p)-3':3'-rGAGIAGGAAAU-5', destabilizes the duplex by 3.9 kcal/mol, compared to 1.7 kcal/mol for the same change within the unpropynylated duplex. This 2.2 kcal/mol difference is eliminated by removing a single propynyl group three base pairs away. CD spectra suggest that single propynyl deletions within the PODN:RNA duplex have position-dependent effects on helix geometry. The results suggest long-range cooperativity between propynyl groups and provide insights for rationally programming oligonucleotides with enhanced binding and specificity. This can be exploited in developing technologies that are dependent upon nucleic acid-based molecular recognition. 相似文献
4.
Morgado CA Svozil D Turner DH Sponer J 《Physical chemistry chemical physics : PCCP》2012,14(36):12580-12591
Preceding NMR experiments show that the conformation of tandem GA base pairs, an important recurrent non-canonical building block in RNA duplexes, is context dependent. The GA base pairs adopt "sheared" N3(G)-N6(A), N2(G)-N7(A) geometry in the r(CGAG)(2) and r(iGGAiC)(2) contexts while switching to "imino" N1(G)-N1(A), O6(G)-N6(A) geometry in the r(GGAC)(2) and r(iCGAiG)(2) contexts (iC and iG stand for isocytosine and isoguanine, respectively). As base stacking is likely to be one of the key sources of the context dependence of the conformation of GA base pairs, we calculated base stacking energies in duplexes containing such base pairs, to see if this dependence can be predicted by stacking energy calculations. When investigating the context dependence of the GA geometry two different conformations of the same duplex were compared (imino vs. sheared). The geometries were generated via explicit solvent MD simulations of the respective RNA duplexes, while the subsequent QM energy calculations focused on base stacking interactions of the four internal base pairs. Geometrical relaxation of nucleobase atoms prior to the stacking energy computations has a non-negligible effect on the results. The stacking energies were derived at the DFT-D/6-311++G(3df,3pd) level. We show a rather good correspondence between the intrinsic gas-phase stacking energies and the NMR-determined GA geometries. The conformation with more favorable gas-phase stacking is in most cases the one observed in experiments. This correlation is not improved when including solvent effects via the COSMO method. On the other side, the stacking calculations do not predict the relative thermodynamic stability of duplex formation for different sequences. 相似文献
5.
A dimeric neomycin-neomycin conjugate 3 with a flexible linker, 2,2'-(ethylenedioxy)bis(ethylamine), has been synthesized and characterized. Dimer 3 can selectively bind to AT-rich DNA duplexes with high affinity. Biophysical studies have been performed between 3 and different nucleic acids with varying base composition and conformation by using ITC (isothermal calorimetry), CD (circular dichroism), FID (fluorescent intercalator displacement), and UV (ultraviolet) thermal denaturation experiments. A few conclusions can be drawn from this study: (1) FID assay with 3 and polynucleotides demonstrates the preference of 3 toward AT-rich sequences over GC-rich sequences. (2) FID assay and UV thermal denaturation experiments show that 3 has a higher affinity for the poly(dA)·poly(dT) DNA duplex than for the poly(dA)·2poly(dT) DNA triplex. Contrary to neomycin, 3 destabilizes poly(dA)·2poly(dT) triplex but stabilizes poly(dA)·poly(dT) duplex, suggesting the major groove as the binding site. (3) UV thermal denaturation studies and ITC experiments show that 3 stabilizes continuous AT-tract DNA better than DNA duplexes with alternating AT bases. (4) CD and FID titration studies show a DNA binding site size of 10-12 base pairs/drug, depending upon the structure/sequence of the duplex for AT-rich DNA duplexes. (5) FID and ITC titration between 3 and an intramolecular DNA duplex [d(5'-A(12)-x-T(12)-3'), x = hexaethylene glycol linker] results in a binding stoichiometry of 1:1 with a binding constant ~10(8) M(-1) at 100 mM KCl. (6) FID assay using 3 and 512 hairpin DNA sequences that vary in their AT base content and placement also show a higher binding selectivity of 3 toward continuous AT-rich than toward DNA duplexes with alternate AT base pairs. (7) Salt-dependent studies indicate the formation of three ion pairs during binding of the DNA duplex d[5'-A(12)-x-T(12)-3'] and 3. (8) ITC-derived binding constants between 3 and DNA duplexes have the following order: AT continuous, d[5'-G(3)A(5)T(5)C(3)-3'] > AT alternate, d[5'-G(3)(AT)(5)C(3)-3'] > GC-rich d[5'-A(3)G(5)C(5)T(3)-3']. (9) 3 binds to the AT-tract-containing DNA duplex (B* DNA, d[5'-G(3)A(5)T(5)C(3)-3']) with 1 order of magnitude higher affinity than to a DNA duplex with alternating AT base pairs (B DNA, d[5'-G(3)(AT)(5)C(3)-3']) and with almost 3 orders of magnitude higher affinity than a GC-rich DNA (A-form, d[5'-A(3)G(5)C(5)T(3)-3']). 相似文献
6.
Kanony C Fabiano-Tixier AS Ravanat JL Vicendo P Paillous N 《Photochemistry and photobiology》2003,77(6):659-667
Pyropheophorbides are red-absorbing porphyrin-like photosensitizers that may interact with DNA either by intercalation or by external binding with self-stacking according to the value of the nucleotide to chromophore molar ratio (N/C). This article reports on the nature and sequence selectivity of the DNA damage photoinduced by a water-soluble chlorhydrate of aminopyropheophorbide. First, this pyropheophorbide is shown to induce on irradiation the cleavage of phiX174 DNA by both Type-I and -II mechanisms, suggested by scavengers and D2O effects. These conclusions are then improved by sequencing experiments performed on a 20-mer oligodeoxynucleotide (ODN) irradiated at wavelengths >345 nm in the presence of the dye, N/C varying from 2.5 to 0.5. Oxidation of all guanine residues to the same extent is observed after piperidine treatment on both single- and double-stranded ODN. Moreover, unexpectedly, a remarkable sequence-selective cleavage occurring at a 5'-CG-3' site is detected before alkali treatment. This frank break is clearly predominant for a low nucleotide to chromophore molar ratio, corresponding to a self-stacking of the dye along the DNA helix. The electrophoretic properties of the band suggest that this lesion results from a sugar oxidation, which leads via a base release to a ribonolactone residue. The proposal is supported by high-performance liquid chromatography-matrix-assisted laser desorption-ionization mass spectrometry experiments that also reveal other sequence-selective frank scissions of lower intensity at 5'-GC-3' or other 5'-CG-3' sites. This sequence selectivity is discussed with regard to the binding selectivity of cationic porphyrins. 相似文献
7.
The kinetics of DNA duplex formation was affected by the addition of PEGs with different masses (MW = 200-8000) to an aqueous solution; for each condition, two duplexes (5'-TAGGTTATAA-3'/5'-TTATAACCTA-3' and 5'-CAGGTCACAG-3'/5'-CTGTGACCTG-3') with different stabilities were formed after overcoming the same association activation energy barrier, suggesting that the formation of consecutive GC base pairs in the helices rather than the helix terminus is the initiation nucleus for DNA duplex formation not only in the absence, but also in the presence of PEGs. 相似文献
8.
J F Trempe C J Wilds A Y Denisov R T Pon M J Damha K Gehring 《Journal of the American Chemical Society》2001,123(21):4896-4903
The first structure of a 2'-deoxy-2'-fluoro-D-arabinose nucleic acid (2'F-ANA)/RNA duplex is presented. We report the structural characterization by NMR spectroscopy of a small hybrid hairpin, r(GGAC)d(TTCG)2'F-a(GTCC), containing a 2'F-ANA/RNA stem and a four-residue DNA loop. Complete (1)H, (13)C, (19)F, and (31)P resonance assignments, scalar coupling constants, and NOE constraints were obtained from homonuclear and heteronuclear 2D spectra. In the chimeric duplex, the RNA strand adopts a classic A-form structure having C3' endo sugar puckers. The 2'F-ANA strand is neither A-form nor B-form and contains O4' endo sugar puckers. This contrasts strongly with the dynamic sugar conformations previously observed in the DNA strands of DNA/RNA hybrid duplexes. Structural parameters for the duplex, such as minor groove width, x-displacement, and inclination, were intermediate between those of A-form and B-form duplexes and similar to those of DNA/RNA duplexes. These results rationalize the enhanced stability of 2'F-ANA/RNA duplexes and their ability to elicit RNase H activity. The results are relevant for the design of new antisense drugs based on sugar-modified nucleic acids. 相似文献
9.
The thermodynamic and structural characteristics of Al(C6F(5)3-derived vs B(C6F5)3-derived group 4 metallocenium ion pairs are quantified. Reaction of 1.0 equiv of B(C6F5)3 or 1.0 or 2.0 equiv of Al(C6F5)3 with rac-C2H4(eta5-Ind)2Zr(CH3)2 (rac-(EBI)Zr(CH3)2) yields rac-(EBI)Zr(CH3)(+)H3CB(C6)F5)(3)(-) (1a), rac-(EBI)Zr(CH3)+H3CAl(C6F5)(3)(-) (1b), and rac-(EBI)Zr2+[H3CAl(C6F5)3](-)(2) (1c), respectively. X-ray crystallographic analysis of 1b indicates the H3CAl(C6F5)(3)(-) anion coordinates to the metal center via a bridging methyl in a manner similar to B(C6F5)3-derived metallocenium ion pairs. However, the Zr-(CH3)(bridging) and Al-(CH3)(bridging) bond lengths of 1b (2.505(4) A and 2.026(4) A, respectively) indicate the methyl group is less completely abstracted in 1b than in typical B(C6F5)3-derived ion pairs. Ion pair formation enthalpies (DeltaH(ipf)) determined by isoperibol solution calorimetry in toluene from the neutral precursors are -21.9(6) kcal mol(-1) (1a), -14.0(15) kcal mol(-1) (1b), and -2.1(1) kcal mol(-1) (1b-->1c), indicating Al(C6F5)3 to have significantly less methide affinity than B(C6F5)3. Analogous experiments with Me2Si(eta5-Me4C5)(t-BuN)Ti(CH3)2 indicate a similar trend. Furthermore, kinetic parameters for ion pair epimerization by cocatalyst exchange (ce) and anion exchange (ae), determined by line-broadening in VT NMR spectra over the range 25-75 degrees C, are DeltaH++(ce) = 22(1) kcal mol(-1), DeltaS++(ce) = 8.2(4) eu, DeltaH++(ae) = 14(2) kcal mol(-1), and DeltaS++(ae) = -15(2) eu for 1a. Line broadening for 1b is not detectable until just below the temperature where decomposition becomes significant ( approximately 75-80 degrees C), but estimation of the activation parameters at 72 degrees C gives DeltaH++(ce) approximately 22 kcal mol(-1)and DeltaH++(ae) approximately 16 kcal mol(-1), consistent with the bridging methide being more strongly bound to the zirconocenium center than in 1a. 相似文献
10.
The recognition properties of DNA duplexes containing single or triple incorporations of eight different donor-modified (OMe, NH(2)) and acceptor-modified (NO(2)) biphenyl residues as base replacements in opposite positions were probed by UV-melting and by CD and fluorescence spectroscopy. We found a remarkable dependence of duplex stability on the natures of the substituents (donor vs. acceptor). The stabilities of duplexes with one biphenyl pair increase in the order donor/donor < acceptor/donor < acceptor/acceptor substitution. The most stable biphenyl pairs stabilize duplexes by up to 6 degrees C in T(m). In duplexes with three consecutive biphenyl pairs the stability increases in the inverse order (acceptor/acceptor < donor/acceptor < donor/donor) with increases in T(m), relative to an unmodified duplex, of up to 10 degrees C. A thermodynamic analysis, combined with theoretical calculations of the physical properties of the biphenyl substituents, suggests that in duplexes with single biphenyl pairs the affinity is dominated by electrostatic forces between the biphenyl/nearest neighbor natural base pairs, whereas in the triple-modified duplexes the increase in thermal stability is predominantly determined by hydrophobic interactions of the biphenyl residues with each other. Oligonucleotides containing amino biphenyl residues are fluorescent. Their fluorescence is largely quenched when they are paired with themselves or with nitrobiphenyl-containing duplex partners. 相似文献
11.
Ellis WW Raebiger JW Curtis CJ Bruno JW DuBois DL 《Journal of the American Chemical Society》2004,126(9):2738-2743
The thermodynamic hydride donor abilities of 1-benzyl-1,4-dihydronicotinamide (BzNADH, 59 +/- 2 kcal/mol), C(5)H(5)Mo(PMe(3))(CO)(2)H (55 +/- 3 kcal/mol), and C(5)Me(5)Mo(PMe(3))(CO)(2)H (58 +/- 2 kcal/mol) have been measured in acetonitrile by calorimetric and/or equilibrium methods. The hydride donor abilities of BzNADH and C(5)H(5)Mo(PMe(3))(CO)(2)H differ by 13 and 24 kcal/mol, respectively, from those reported previously for these compounds in acetonitrile. These results require significant revisions of the hydricities reported for related NADH analogues and metal hydrides. These compounds are moderate hydride donors as compared to previously determined compounds. 相似文献
12.
Znosko BM Barnes TW Krugh TR Turner DH 《Journal of the American Chemical Society》2003,125(20):6090-6097
The 1-propynylation at C5 of consecutive pyrimidines in DNA can enhance DNA:RNA hybrid stability at 37 degrees C by over 1 kcal/mol of substitution [Barnes, T. W., III; Turner, D. H. J. Am. Chem. Soc.2001, 123, 4107-4118]. To provide information on the structural consequences of propynylation, two-dimensional NMR spectroscopy was used to study the structures of several oligonucleotides. Intraresidue nuclear Overhauser effect spectroscopy cross peaks were observed at 30 degrees C and a 200 ms mixing time in the H6-H1' region for 5'(dC(P)C(P)U(P)C(P)C(P)U(P)U(P)) (ssPrODN) but not for 5'(dCCUCCUU) (ssODN), suggesting preorganization of the propynylated single strand. NMR structures of the duplexes 5'(dC(P)C(P)U(P)C(P)C(P)U(P)U(P))3':3'(rGAGGAGGAAAU)5' (PrODN:RNA), 5'(dCC(P)U(P)C(P)C(P)U(P)U(P))3':3'(rGAGGAGGAAAU)5' (sPrODN1:RNA), and 5'(dCCUCCUU)3':3'(rGAGGAGGAAAU)5' (ODN:RNA) indicate that their global structures are almost identical. The NMR data, however, suggest that the 5'-end of sPrODN1:RNA is more dynamic than that of PrODN:RNA. In the propynylated duplexes, the propyne group stacks on the aromatic ring of the 5'-base and extends into the major groove. The results suggest that the increased stability of the propynylated duplexes is caused by preorganization of the propynylated single strand and different interactions in the double strand. The propynyl group provides volume exclusion, enhanced stacking, and possibly different solvation. 相似文献
13.
Minakawa N Kojima N Hikishima S Sasaki T Kiyosue A Atsumi N Ueno Y Matsuda A 《Journal of the American Chemical Society》2003,125(33):9970-9982
The synthesis and thermal stability of oligodeoxynucleotides (ODNs) containing imidazo[5',4':4,5]pyrido[2,3-d]pyrimidine nucleosides 1-4 (N(N), O(O), N(O), and O(N), respectively) with the aim of developing two sets of new base pairing motifs consisting of four hydrogen bonds (H-bonds) is described. The proposed four tricyclic nucleosides 1-4 were synthesized through the Stille coupling reaction of a 5-iodoimidazole nucleoside with an appropriate 5-stannylpyrimidine derivative, followed by an intramolecular cyclization. These nucleosides were incorporated into ODNs to investigate the H-bonding ability. When one molecule of the tricyclic nucleosides was incorporated into the center of each ODN (ODN I and II, each 17mer), no apparent specificity of base pairing was observed, and all duplexes were less stable than the duplexes containing natural G:C and A:T pairs. On the other hand, when three molecules of the tricyclic nucleosides were consecutively incorporated into the center of each ODN (ODN III and IV, each 17mer), thermal and thermodynamic stabilization of the duplexes due to the specific base pairings was observed. The melting temperature (T(m)) of the duplex containing the N(O):O(N) pairs showed the highest T(m) of 84.0 degrees C, which was 18.2 and 23.5 degrees C higher than that of the duplexes containing G:C and A:T pairs, respectively. This result implies that N(O)and O(N) form base pairs with four H-bonds when they are incorporated into ODNs. The duplex containing N(O):O(N) pairs was markedly stabilized by the assistance of the stacking ability of the imidazopyridopyrimidine bases. Thus, we developed a thermally stable new base pairing motif, which should be useful for the stabilization and regulation of a variety of DNA structures. 相似文献
14.
15.
Structures and energetics of base flipping of the thymine dimer depend on DNA sequence 总被引:1,自引:0,他引:1
The cis,syn-cyclobutane pyrimidine dimer (CPD) is a photoinduced DNA lesion leading to a significant distortion of the DNA structure. Its repair by DNA photolyase requires a flip of the damaged base into an extrahelical position. This base flip is expected to be sequence-dependent, but the structures and energetics as a function of the bases 3' and 5' to the CPD lesion are unknown. Eight-nanosecond MD simulations of four different hexadecamer duplexes with the CPD were performed for the flipped-in and flipped-out structures. Analysis of these results indicates clear sequence-dependent differences. Significant disruptions of the base pairs to the 3' side of the CPD are observed for the flipped-out structures with adjacent A-T pairs, whereas those with G-C pairs adjacent show no such distortions. The conformational spaces occupied by these two duplexes are significantly different. The structural differences correlate well with the free energy differences for base flipping calculated using the previously established 2D potential of mean force (PMF) method. The energy differences for base flipping in duplexes containing A, T, G, and C pairs adjacent to the CPD were found to be 6.25-6.5, 5.25-5.5, 7.25-7.5, and 6.5-6.75 kcal/mol, respectively. These energy differences of up to 2 kcal/mol should be large enough to be detected experimentally using sensitive probes. 相似文献
16.
Measurement of nucleobase pKa values in model mononucleotides shows RNA-RNA duplexes to be more stable than DNA-DNA duplexes 总被引:1,自引:0,他引:1
Acharya P Cheruku P Chatterjee S Acharya S Chattopadhyaya J 《Journal of the American Chemical Society》2004,126(9):2862-2869
To understand why the RNA-RNA duplexes in general has a higher thermodynamic stability over the corresponding DNA-DNA duplexes, we have measured the pK(a) values of both nucleoside 3',5'-bis-ethyl phosphates [Etp(d/rN)pEt] and nucleoside 3'-ethyl phosphates [(d/rN)pEt] (N = A, G, C, or T/U), modeling as donors and acceptors of base pairs in duplexes. While the 3',5'-bis-phosphates, Etp(d/rN)pEt, mimic the internucleotidic monomeric units of DNA and RNA, in which the stacking contribution is completely absent, the 3'-ethyl phosphates, (d/rN)pEt, mimic the nucleotide at the 5'-end. The pK(a) values of the nucleobase in each of these model nucleoside phosphates have been determined with low pK(a) error (sigma = +/-0.01 to 0.02) by (1)H NMR (at 500 MHz) with 20-33 different pH measurements for each compound. This study has led us to show the following: (1) All monomeric DNA nucleobases are more basic than the corresponding RNA nucleobases in their respective Etp(d/rN)pEt and (d/rN)pEt. (2) The pK(a) values of the monomeric nucleotide blocks as well as Delta pK(a) values between the donor and acceptor can be used to understand the relative base-pairing strength in the oligomeric duplexes in the RNA and DNA series. (3) The Delta G*(pKa) of the donor and acceptor of the base pair in duplexes enables a qualitative dissection of the relative strength of the base-pairing and stacking in the RNA-RNA over the DNA-DNA duplexes. (4) It is also found that the relative contribution of base-pairing strength and nucleobase stacking in RNA-RNA over DNA-DNA is mutually compensating as the % A-T/U content increases or decreases. This interdependency of stacking and hydrogen bonding can be potentially important in the molecular design of the base-pair mimics to expand the alphabet of the genetic code. 相似文献
17.
B-DNA is the most common DNA helix conformation under physiological conditions. However, when the amount of water in a DNA solution is decreased, B-to-A helix transitions have been observed. To understand what type of helix conformations exist in a solvent-free environment, a series of poly d(CG)(n) and mixed sequence DNA duplexes from 18 to 30 bp were examined with circular dichroism (CD), ESI-MS, ion mobility, and molecular dynamics. From the CD spectra, it was observed that all sequences had B-form helices in solution. However, the solvent-free results were more complex. For the poly d(CG)(n) series, the 18 bp duplex had an A-form helix conformation, both A- and B-helices were present for the 22 bp duplex, and only B-helices were observed for the 26 and 30 bp duplexes. Since these sequences were all present as B-DNA in solution, the observed solvent-free structures illustrate that smaller helices with fewer base pairs convert to A-DNA more easily than larger helices in the absence of solvent. A similar trend was observed for the mixed sequence duplexes where both an A- and B-helix were present for the 18 bp duplex, while only B-helices occur for the larger 22, 26, and 30 bp duplexes. Since the solvent-free B-helices appear at smaller sizes for the mixed sequences than for the pure d(CG)(n) duplexes, the pure d(CG)(n) duplexes have a greater A-philicity. 相似文献
18.
Deoxynucleic guanidine (DNG), a DNA analogue in which positively charged guanidine replaces the phosphodiester linkages, tethering to Hoechst 33258 fluorophore by varying lengths has been synthesized. A pentameric thymidine DNG was synthesized on solid phase in the 3' --> 5' direction that allowed stepwise incorporation of straight chain amino acid linkers and a bis-benzimidazole (Hoechst 33258) ligand at the 5'-terminus using PyBOP/HOBt chemistry. The stability of (DNA)(2).DNG-H triplexes and DNA.DNG-H duplexes formed by DNG and DNG-Hoechst 33258 (DNG-H) conjugates with 30-mer double-strand (ds) DNA, d(CGCCGCGCGCGCGAAAAACCCGGCGCGCGC)/d(GCGGCGCGCGCGCTTTTTGGGCCGCGCGCG), and single-strand (ss) DNA, 5'-CGCCGCGCGCGCGAAAAACCCGGCGCGCGC-3', respectively, has been evaluated by thermal melting and fluorescence emission experiments. The presence of tethered Hoechst ligand in the 5'-terminus of the DNG enhances the (DNA)(2).DNG-H triplex stability by a DeltaT(m) of 13 degrees C. The fluorescence emission studies of (DNA)(2).DNG-H triplex complexes show that the DNG moiety of the conjugates bind in the major groove while the Hoechst ligand resides in the A:T rich minor groove of dsDNA. A single G:C base pair mismatch in the target site decreases the (DNA)(2).DNG triplex stability by 11 degrees C, whereas (DNA)(2).DNG-H triplex stability was decreased by 23 degrees C. Inversion of A:T base pair into T:A base pair in the center of the binding site, which provides a mismatch selectively for DNG moiety, decreases the triplex stability by only 5-6 degrees C. Upon hybridization of DNG-Hoechst conjugates with the 30-mer ssDNA, the DNA.DNG-H duplex exhibited significant increase in the fluorescence emission due to the binding of the tethered Hoechst ligand in the generated DNA.DNG minor groove, and the duplex stability was enhanced by DeltaT(m) of 7 degrees C. The stability of (DNA)(2).DNG triplexes and DNA.DNG duplexes is independent of pH, whereas the stability of (DNA)(2).DNG-H triplexes decreases with increase in pH. 相似文献
19.
Ellis WW Ciancanelli R Miller SM Raebiger JW Rakowski DuBois M DuBois DL 《Journal of the American Chemical Society》2003,125(40):12230-12236
The thermodynamic hydride donor abilities of [HW(CO)(5)](-) (40 kcal/mol), [HW(CO)(4)P(OMe(3))](-) (37 kcal/mol), and [HW(CO)(4)(PPh(3))](-) (36 kcal/mol) have been measured in acetonitrile by either equilibrium or calorimetric methods. The hydride donor abilities of these complexes are compared with other complexes for which similar thermodynamic measurements have been made. [HW(CO)(5)](-), [HW(CO)(4)P(OMe(3))](-), and [HW(CO)(4)(PPh(3))](-) all react rapidly with [CpRe(PMe(3))(NO)(CO)](+) to form dinuclear intermediates with bridging formyl ligands. These intermediates slowly form [CpRe(PMe(3))(NO)(CHO)] and [W(CO)(4)(L)(CH(3)CN)]. The structure of cis-[HW(CO)(4)(PPh(3))](-) has been determined and has the expected octahedral structure. The hydride ligand bends away from the CO ligand trans to PPh(3) and toward PPh(3). 相似文献
20.
Ab initio calculations at the MP4(SDTQ)/6-311G//MP2/6-31G level were performed to study the structures and stabilities of the dimer of ethyl cation, (C(2)H(+)(5))(2), and related C(4)H(10)(2+) isomers. Two doubly hydrogen bridged diborane type trans 1 and cis 2 isomers were located as minima. The trans isomer was found to be more favorable than cis isomer by only 0.6 kcal/mol. Several other minima for C(4)H(10)(2+) were also located. However, the global energy minimum corresponds to C-H (C(4) position) protonated 2-butyl cation 10. Structure 10 was computed to be substantially more stable than 1 by 31.7 kcal/mol. The structure 10 was found to be lower in energy than 2-butyl cation 13 by 34.4 kcal/mol. 相似文献