Absolute thermodynamic measurements of alkali metal cation interactions with a simple dipeptide and tripeptide

Absolute bond dissociation energies (BDEs) of glycylglycine (GG) and glycylglycylglycine (GGG) to sodium and potassium cations and sequential bond energies of glycine (G) in Na+G2 were determined experimentally by threshold collision-induced dissociation (TCID) in a guided ion beam tandem mass spectrometer. Experimental results showed that the binding energies follow the order of Na+ > K+ and M+GGG > M+GG > M+G. Theoretical calculations at the B3LYP/6-311+G(d) level show that all complexes had charge-solvated structures (nonzwitterionic) with either [CO,CO] bidentate or [N,CO,CO] tridentate coordination for M+GG complexes, [CO,CO,CO] tridentate or [N,CO,CO,CO] tetradentate coordination for M+GGG complexes, and [N,CO,N,CO] tetradentate coordination for Na+G2. Ab initio calculations at three different levels of theory (B3LYP, B3P86, and MP2(full) using the 6-311+G(2d,2p) basis set with geometries and zero-point energies calculated at the B3LYP/6-311+G(d) level) show good agreement with the experimental bond energies. This study demonstrates for the first time that TCID measurements of absolute BDEs can be successfully extended to biological molecules as complex as a tripeptide.     

Are the radical centers in peptide radical cations mobile? The generation, tautomerism, and dissociation of isomeric alpha-carbon-centered triglycine radical cations in the gas phase

The mobility of the radical center in three isomeric triglycine radical cations[G(*)GG](+), [GG(*)G](+), and [GGG(*)](+) has been investigated theoretically via density functional theory (DFT) and experimentally via tandem mass spectrometry. These radical cations were generated by collision-induced dissociations (CIDs) of Cu(II)-containing ternary complexes that contain the tripeptides YGG, GYG, and GGY, respectively (G and Y are the glycine and tyrosine residues, respectively). Dissociative electron transfer within the complexes led to observation of [Y(*)GG](+), [GY(*)G](+), and [GGY(*)](+); CID resulted in cleavage of the tyrosine side chain as p-quinomethide, yielding [G(*)GG](+), [GG(*)G](+), and [GGG(*)](+), respectively. Interconversions between these isomeric triglycine radical cations have relatively high barriers (> or = 44.7 kcal/mol), in support of the thesis that isomerically pure [G(*)GG](+), [GG(*)G](+), and [GGG(*)](+) can be experimentally produced. This is to be contrasted with barriers < 17 kcal/mol that were encountered in the tautomerism of protonated triglycine [Rodriquez C. F. et al. J. Am. Chem. Soc. 2001, 123, 3006-3012]. The CID spectra of [G(*)GG](+), [GG(*)G](+), and [GGG(*)](+) were substantially different, providing experimental proof that initially these ions have distinct structures. DFT calculations showed that direct dissociations are competitive with interconversions followed by dissociation.     

Internal versus terminal metalation of double-helical oligodeoxyribonucleotides

The formation of adducts between cis-[Pt(NH(3))(2)Cl(2)], Zn(II), and Mn(II) and double-stranded oligodeoxynucleotides was studied by 1D and 2D (1)H, (31)P, and (15)N NMR spectroscopy. For labile adducts involving Zn(II) and Mn(II), both (1)H chemical shifts (Zn(II)) and (1)H line-broadening effects (Mn(II)) showed that in the hexamer [d(GGCGCC)](2) I, the terminal G(1)-N7 is the exclusive binding site, while for the dodecamer [d(GGTACCGGTACC)](2) II, which contains both a terminal and internal GG pair, the preference for metal binding is the internal guanine G(7). Zn(II) binding to II was confirmed by natural-abundance 2D [(1)H,(15)N] HMBC NMR spectroscopy, which unambiguously showed that G(7)-N7 is the preferred binding site. The long duplex [d(GGTATATATACCGGTATATATACC)](2) III was expected to have a more pronounced accumulation of electrostatic potential towards the central part of the sequence (vs the terminal part) than does II. However, the Zn(II) titration of III showed no increase in coordination with the internal Gs (vs the terminal Gs), compared with what was observed for II. The reaction between the nonlabile metal complex cis-[PtCl(2)((15)NH(3))(2)] (cisplatin) and II showed a slight preference for the internal GG pair over the terminal GG pair. However, when the diaqua form of cisplatin cis-[Pt((15)NH(3))(2)(H(2)O)(2)] was reacted with II a more pronounced binding preference for the internal GG pair was observed.     

Acid-base and metal ion binding properties of guanylyl(3'-->5')guanosine (GpG-) and 2'-deoxyguanylyl(3'-->5')-2'-deoxyguanosine [d(GpG)-] in aqueous solution

The acidity constants of guanylyl(3'-->5')guanosine (GpG(-)) and 2'-deoxyguanylyl(3'-->5')-2'-deoxyguanosine [d(GpG)(-)] for the deprotonation of their (N1)H sites were measured by potentiometric pH titrations in aqueous solution (25 degrees C; I = 0.1 M, NaNO(3)). The same method was used for the determination of the stability constants of the 1:1 complexes formed between Mg(2+), Ni(2+), or Cd(2+) (= M(2+)) and (GG-H)(2-), and in the case of Mg(2+) also of (GG-2H)(3-), where GG(-) = GpG(-) or d(GpG)(-). The stability constants of the M(GG)(+) complexes were estimated. The acidity constants of the H(dGuo)(+) and dGuo species (dGuo = 2'-deoxyguanosine) and the stability constants of the corresponding M(dGuo)(2+) and M(dGuo-H)(+) complexes were also measured. Comparison of these and related data allows the conclusion that N7 of the 5'G unit in GG(-) is somewhat more basic than the one in the 3'G moiety; the same holds for the (N1)(-) sites. On the basis of comparisons with the stability constants measured for the dGuo complexes, it is concluded that M(2+) binding of the GG dinucleoside monophosphates occurs predominantly in a mono-site fashion, meaning that macrochelate formation is not very pronounced. Indeed, it was a surprise to find that the stabilities of the complexes of dGuo or (dGuo-H)(-) and the corresponding ones derived from GG(-) are so similar. Consequently, it is suggested that in the M(GG)(+) and M(GG-H) complexes the metal ion is mainly located at N7 of the 5'G unit since this is the more basic site allowing also an outer-sphere interaction with the C6 carbonyl oxygen and because this coordination mode is also favorable for an electrostatic interaction with the negatively charged phosphodiester bridge. It is further suggested that Mg(2+) binding (which is rather weak compared to that of Ni(2+) and Cd(2+)) occurs mainly in an outer-sphere mode, and on the basis of the so-called Stability Ruler it is concluded that the binding properties of Zn(2+) to the GG species are similar to those of Ni(2+) and Cd(2+).     

Site-specific probing of oxidative reactivity and telomerase function using 7,8-dihydro-8-oxoguanine in telomeric DNA

Telomeres at the ends of human chromosomes contain the repeating sequence 5'-d[(TTAGGG)(n)]-3'. Oxidative damage of guanine in DNAs that contain telomeric and nontelomeric sequence generates 7,8-dihydro-8-oxoguanine (8OG) preferentially in the telomeric segment, because GGG sequences are more reactive in duplex DNA. We have developed a general strategy for probing site-specific oxidation reactivity in diverse biological structures through substitution of minimally modified building blocks that are more reactive than the parent residue, but preserve the parent structure. In this study, 8OG was substituted for guanine at G(8), G(9), G(14), or G(15) in the human telomeric oligonucleotide 5'-d[AGGGTTAG(8)G(9)GTT AG(14)G(15)GTTAGGGTGT]-3'. Replacement of G by 8OG in telomeric DNA can affect the formation of intramolecular G quadruplexes, depending on the position of substitution. When 8OG was incorporated in the 5'-position of a GGG triplet, G quadruplex formation was observed; however, substitution of 8OG in the middle of a GGG triplet produced multiple structures. A clear correspondence between structure and reactivity was observed when oligonucleotides containing 8OG in the 5'-position of a GGG triplet were prepared in the quadruplex or duplex forms and interrogated by mediated electrocatalytic oxidation with Os(bpy)(3)(2+) (bpy = 2,2'-bipyridine). The rate constant for one-electron oxidation of a single 8OG in the 5'-position of a GGG triplet was (6.2 +/- 1.7) x 10(4) M(-1) s(-1) in the G quadruplex form. The rate constant was 2-fold lower for the same telomeric sequence in the duplex form ((3.0 +/- 1.3) x 10(4) M(-1) s(-1)). The position of 8OG in the GGG triplet affects telomerase activity and synthesis of telomeric repeat products. Telomerase activity was decreased significantly when 8OG was substituted in the 5'-position of the GGG triplet, but not when 8OG was substituted in the middle of the triplet. Thus, biological oxidation of G to 8OG in telomeres has the potential to modulate telomerase activity. Further, small molecules that inhibit telomerase by stabilizing telomeric G quadruplexes may not be as effective under oxidative stress.     

Hole traps in DNA.

Sequences of guanines, GG and GGG, are known to be readily oxidized, forming radical cations, i.e., hole traps, on DNA. The trapping probability of GG is less than that of GGG. Lewis et al. (J. Am. Chem. Soc. 2000, 122, 12037) have used measurements on synthetic hairpins to determine the free energy liberated when a hole goes from the radical cation G(+) to GG or to GGG. They find these free energies to be of the order of thermal energy at room temperature, in contradiction to the expectation by many of much greater trap depths. We have calculated the wave function of a hole on G, on GG, and on GGG surrounded by adenines, as in the Lewis et al. experiments, using a simple tight-binding model. We find that to account for the shallow traps found by them it is necessary that the difference in ionization potentials of contiguous guanine and adenine be smaller by about 0.2 eV than the 0.4 eV found for isolated bases. Using this value and taking into account polaron formation, we find the wave functions of holes trapped on G, GG, or GGG to extend over approximately 6 sites (bases) and with energy level differences in good agreement with the values found by Lewis et al.     

Identification of the metal ion binding site on an RNA motif from hammerhead ribozymes using (15)N NMR spectroscopy

An RNA oligomer, r(GGACGAGUCC), which mimics the metal ion-binding motif of hammerhead ribozymes, was shown to fold by itself into a conformation possessing a metal ion binding property which is similar to that of the intact ribozyme (Tanaka, et al. J. Am. Chem. Soc. 2000, 122, 11303-11310). To determine the metal ion-binding site of this motif at an atomic level, we synthesized a series of RNA oligomers which were selectively labeled with a (15)N-labeled guanosine at each of the four guanosine residues. The (15)N-chemical shift perturbation with Cd(II) ions by one-dimensional (1D) (15)N NMR spectra showed that the chemical shift of the N7 of the G7 residue, N7/G7, in the metal ion-binding motif was specifically perturbed. This is the first experimental evidence to prove that the N7/G7 binds with a Cd(II) ion.     

Site-selective DNA alkylation of GG steps by naphthaldiimide derivatives possessing enantiomeric epoxide

We have synthesized an enantiomeric pair of novel DNA alkylating agents consisting of a naphthaldiimide intercalator and a chiral epoxy side chain. These naphthaldiimide derivatives have high DNA binding affinity and selectively alkylate 5'G of the GG steps for (S)-epoxide and 3'G for (R)-epoxide.     

Kinetic analysis of the stepwise formation of a long-range DNA interstrand cross-link by a dinuclear platinum antitumor complex: evidence for aquated intermediates and formation of both kinetically and thermodynamically controlled conformers.

Reported here is a detailed study of the kinetics and mechanism of formation of a 1,4 GG interstrand cross-link by [(trans-PtCl(NH(3))(2))(2)(mu-NH(2)(CH(2))(n)NH(2))](2+) (1,1/t,t (n = 6), 1), the prototype of a novel class of platinum antitumor complexes. The reaction of the self-complementary 12-mer duplex 5'-[d(ATATGTACATAT)(2)] with (15)N-1 has been studied at 298 K, pH 5.4, by [(1)H,(15)N] HSQC 2D NMR spectroscopy. Initial electrostatic interactions with the duplex are observed for 1 and the monoaqua monochloro species (2). Aquation of 1 to yield 2 occurs with a pseudo-first-order rate constant of (4.15 +/- 0.04) x 10(-5) s(-1). 2 then undergoes monofunctional binding to the guanine N7 of the duplex to form 3 (G/Cl) with a rate constant of 0.47 +/- 0.06 M(-(1) s(-1). There is an electrostatic interaction between the unbound [PtN(3)Cl] group of 3 and the duplex, which is consistent with H-bonding interactions observed in the molecular model of the monofunctional (G/Cl) adduct. Closure of 3 to form the 1,4 GG interstrand cross-link (5) most likely proceeds via the aquated (G/H(2)O) intermediate (4) (pseudo-first-order rate constant = (3.62 +/- 0.04) x 10(-5) s(-1)) followed by closure of 4 to form 5 (rate constant = (2.7 +/- 1.5) x 10(-3) s(-1)). When closure is treated as direct from 3 (G/Cl) the rate constant is (3.39 +/- 0.04) x 10(-5) s(-1). Closure is ca. 10-55-fold faster than that found for 1,2 GG intrastrand cross-link formation by the diaqua form of cisplatin. Changes in the (1)H and (15)N shifts of the interstrand cross-link 5 indicate that the initially formed conformer (5(i)) converts irreversibly into other product conformer(s) 5(f). The NMR data for 5(i) are consistent with a molecular model of the 1,4 GG interstrand cross-link on B-form DNA, which shows that the NH(2) protons have no contacts except with solvent. The NMR data for 5(f) show several distinct NH(2) environments indicative of interactions between the NH(2) protons and the DNA. HPLC characterization of the final product showed only one major product peak that was confirmed by ESI-FTICR mass spectroscopy to be a cross-linked adduct of (15)N-1 and the duplex. The potential significance of these findings to the antitumor activity of dinuclear platinum complexes is discussed.     

RNA GG x UU motif binds K+ but not Mg2+

A hairpin model of the group I intron P5b loop was synthesized with [8-13C-7-15N]-guanosine in the GG.UU metal binding site, [7-15N]-guanosine at a nonbinding site, and [3-15N]-uridine. 15N NMR showed specific binding for Co(NH3)63+ and K+, but not for Zn2+, Cd2+, or Mg2+.     

Ruthenation of duplex and single-stranded d(CGGCCG) by organometallic anticancer complexes

We have studied the interaction of the organometallic anticancer ruthenium(II) complexes [(eta(6)-p-cymene)Ru(en)Cl][PF(6)] (1) and [(eta(6)-biphenyl)Ru(en)Cl][PF(6)] (2) (en=ethylenediamine) with the single-stranded (ss) DNA hexamer d(CGGCCG) (I) and the duplex d(CGGCCG)(2) (II) by HPLC, ESI-MS, and one- and two-dimensional (1)H and (15)N NMR spectroscopy. For ss-DNA, all three G's are readily ruthenated with [(eta(6)-arene)Ru(en)](2+), but for duplex DNA there is preferential ruthenation of G3 and G6, and no binding to G2 was detected. For monoruthenated duplexes, N7 ruthenation of G is accompanied by strong hydrogen bonding between G-O6 and en-NH for the p-cymene adducts. Intercalation of the non-coordinated phenyl ring between G3 and C4 or G6 and C5 was detected in the biphenyl adducts of mono- and diruthenated duplexes, together with weakening of the G-O6NH-en hydrogen bonding. The arene ligand plays a major role in distorting the duplex either through steric interactions (p-cymene) or through intercalation (biphenyl).     

Cisplatin Adducts on a GGG Sequence within a DNA Duplex Studied by NMR Spectroscopy and Molecular Dynamics Simulations

The antitumor drug cisplatin (cis‐[PtCl₂(NH₃)₂]) reacts with cellular DNA to form GG intrastrand adducts between adjacent guanines as predominant lesions. GGG sites have been shown to be hotspots of platination. To study the structural perturbation induced by binding of cisplatin to two adjacent guanines of a GGG trinucleotide, we examined here the decanucleotide duplex d[(G₁C₂C₃ G₆T₇‐ C₈G₉C₁₀) ? d(G₁₁C₁₂G₁₃A₁₄C₁₅C₁₆C₁₇G₁₈‐ G₁₉C₂₀)] ( dsCG*G*G ) intrastrand cross‐linked at the G* guanines by cis‐{Pt(NH₃)₂}²⁺ using NMR spectroscopy and molecular dynamics (MD) simulations. The NMR spectra of dsCG*G*G were found to be similar to those of previously characterized DNA duplexes cross‐linked by cisplatin at a pyG*G*X site (py=pyrimidine; X=C, T, A). This similarity of NMR spectra indicates that the base at the 3′‐side of the G*G*–Pt cross‐link does not affect the structure to a large extent. An unprecedented reversible isomerization between the duplex dsCG*G*G (bearing a –Pt chelate) and duplex dsGG*G*T (bearing a –Pt chelate) was observed, which yielded a 40:60 equilibrium between the two intrastrand GG–Pt cross‐links. No formation of interstrand cross‐links was observed. NMR spectroscopic data of dsCG*G*G indicated that the deoxyribose of the 5′‐G* adopts an N‐type conformation, and the cytidines C₃, C₁₅, and C₁₆ have average phase angles intermediate between S and N. The NMR spectroscopic chemical shifts of dsGG*G*T showed some fundamental differences to those of pyG*G*–platinum adducts but were in agreement with the NMR spectra reported previously for the DNA duplexes cross‐linked at an AG*G*C sequence by cisplatin or oxaliplatin. The presence of a purine instead of a pyrimidine at the 5′‐side of the G*G* cross‐link seems therefore to affect the structure of the XG* step significantly.     

Competitive reactions of interstrand and intrastrand DNA-Pt adducts: A dinuclear-platinum complex preferentially forms a 1,4-interstrand cross-link rather than a 1,2 intrastrand cross-link on binding to a GG 14-mer duplex

A study of the kinetics and mechanism of the reaction between the dinuclear Pt complex [(trans-PtCl(NH(3))(2))(2)(mu-NH(2)(CH(2))(6)NH(2))](2+) (1) and the 14-mer duplex 5'-d(ATACATG(7)G(8)TACATA)-3'.5'-d(TATG(25)TACCATG(18)TAT)-3' is reported. [(1)H,(15)N]-HSQC NMR was used to follow the reaction at 298 K, pH 5.4. The product is primarily the 5'-5' 1,4-interstrand cross-link between G(8) and G(18) bases and exists in two conformational forms. No evidence for the possible 1,2-intrastrand G(7)G(8) adduct was seen, confirming the preferential formation of interstrand cross-links by these dinuclear complexes. An initial electrostatic association of (15)N-1 with the duplex is indicated by changes in its (1)H/(15)N chemical shifts, followed by aquation of 1 to form the monoaqua monochloro species 2, with a rate constant of 4.00+/-0.03x10(-5) s(-1). Monofunctional binding to the duplex occurs primarily at G(8), the 3' base of the nucleophilic GG grouping, with a rate constant of 1.5+/-0.7 M(-1) s(-1). Changes in the (1)H/(15)N shifts indicate there is an electrostatic interaction between the unbound (PtN(3)Cl) group of the monofunctional adduct and the duplex. No peaks for a transient aquated monofunctional species are seen and closure of 3 to form the 1,4-G(8)G(18) interstrand cross-link (5) was treated as direct, with a rate constant of 4.47+/-0.06x10(-5) s(-1). The G(8)G(18) cross-link was confirmed from analysis of the NOESY NMR spectrum of the final product. Structural perturbations for the 1,4-interstrand cross-link extend over approximately four base-pairs and are similar to those found for a 1,4-interstrand cross-link with a shorter 8-mer -GTAC- sequence. A major distortion was evident for the 5'T (T(17)) adjacent to the platinated G(18), consistent with the findings from the use of chemical probes to investigate the conformation of 1,4-interstrand cross-links.     

Determination of quercetin and its glucosides in onion by electrochemical methods

Quercetin (Q), quercetin-3,4'-diO-beta-glucoside (Q3,4'G), quercetin-3-O-beta-glucoside (Q3G) and quercetin-4'-O-beta-glucoside (Q4'G) were determined in onion bulbs (Allium cepa) by HPLC with amperometric detection after analysis of the hydrodynamic voltammograms of flavonoid standards within the potential range of 50-1000 mV and by cyclic voltammetry (CV) method. The hydrodynamic voltammetric profiles of flavonoids showed that the peak current of Q, Q3G, Q4'G and Q3,4'G increased rapidly when the applied potential exceeded +450 mV (vs. SCE). High sensitivity and low background current were observed at the applied potential of +950 mV (vs. SCE). The lower limits of detection (LOD) were determined at signal-to-noise ratio of 3 and showed the following values: 8.05x10(-8)M (Q), 1.08x10(-7) M (Q3G), 1.22x10(-7) M (Q4'G) and 2.6x10(-7) M (Q3,4'G). The data provided by HPLC-UV-MS confirmed the presence of Q, Q3G, Q4'G and Q3,4'G in 80% methanol extracts of lyophilised onion bulbs. The CV method was applied for the qualitative assessment of onion flavonoids followed by the determination of anodic peak potential (E(a)) of the standards. The qualitative analysis of onion flavonoids was based on the anodic peak current (I(a)) of the extracts after external standards addition. The recorded cyclic voltammograms of the above flavonoid standards showed that all four compounds had well-defined oxidation waves with peak potentials of 310, 390, 482 and 800 mV (vs. Ag/AgCl) for Q, Q3G, Q4'G and Q3,4'G in 50 mM acetate-acetic buffer (pH 5.5) in 80% methanol, respectively. The study proved applicability of the CV method for identifying Q, Q3G, Q4'G and Q3,4'G in onion.     

Ab initio molecular orbital study on the G-selectivity of GGG triplet in copper(I)-mediated one-electron oxidation

The G-selectivity for Cu(I)-mediated one-electron oxidation of 5'-TG(1)G(2)G(3)-3' and 5'-CG(1)G(2)G(3)-3' has been examined by ab initio molecular orbital calculations. It was confirmed that G(1) is selectively damaged by Cu(I) ion for both 5'-TG(1)G(2)G(3)-3' and 5'-CG(1)G(2)G(3)-3', being good agreement with experimental results. The Cu(I)-mediated G(1)-selectivity is primarily due to the stability of the Cu(I)-coordinated complex, [-XG(1)G(2)G(3)-,-Cu(I)(H(2)O)(3)](+). The Cu(I) ion coordinates selectively to N7 of G(2) of 5'-G(1)G(2)G(3)-3' rather than N7 of G(1). The G(2)-selective coordination induces the G(1)-selective trap of a hole that is created by one-electron oxidation and migrates to GGG triplet. Therefore, the radical cation of G(1) is selectively created in both 5'-TG(1)G(2)G(3)-3' and 5'-CG(1)G(2)G(3)-3', giving the G(1)-selective damage of 5'-G(1)G(2)G(3)-3'.     

Nature of the chemical bond formed with the structural metal ion at the A9/G10.1 motif derived from hammerhead ribozymes

We have studied the interaction between metal ions and the metal ion-binding motif in hammerhead ribozymes, as well as the functions of the metal ion at the motif, with heteronuclear NMR spectroscopy. In this study, we employed model RNA systems which mimic the metal ion-binding motif and the altered motif. In Co(NH3)6(III) titrations, we observed large 1H and 31P chemical shift perturbations for the motif and found that outer-sphere complexation of Co(NH3)6(III) is possible for this motif. From the reinvestigation of our previous 15N chemical shift data for Cd(II) binding, in comparison with those of organometallic compounds, we conclude that Cd(II) can form an inner-sphere complex with the nucleobase in the motif. Therefore, the A9/G10.1 site was found to accept both inner-sphere and outer-sphere complexations. The Mg(II) titration for a slightly different motif from the A9/G10.1 site (G10.1-C11.1 to A10.1-U11.1) revealed that its affinity to Mg(II) was drastically reduced, although the ribozyme with this altered motif is known to retain enzymatic activities. This observation suggests that the metal ion at these motifs is not a catalytic center of hammerhead ribozymes.     

Oxidation of guanine in G, GG, and GGG sequence contexts by aromatic pyrenyl radical cations and carbonate radical anions: relationship between kinetics and distribution of alkali-labile lesions

Oxidatively generated DNA damage induced by the aromatic radical cation of the pyrene derivative 7,8,9,10-tetrahydroxytetrahydrobenzo[a]pyrene (BPT), and by carbonate radicals anions, was monitored from the initial one-electron transfer, or hole injection step, to the formation of hot alkali-labile chemical end-products monitored by gel electrophoresis. The fractions of BPT molecules bound to double-stranded 20-35-mer oligonucleotides with noncontiguous guanines G and grouped as contiguous GG and GGG sequences were determined by a fluorescence quenching method. Utilizing intense nanosecond 355 nm Nd:YAG laser pulses, the DNA-bound BPT molecules were photoionized to BPT*+ radicals by a consecutive two-photon ionization mechanism. The BPT*+ radicals thus generated within the duplexes selectively oxidize guanine by intraduplex electron-transfer reactions, and the rate constants of these reactions follow the trend 5'-..GGG.. > 5'-..GG.. > 5'-..G... In the case of CO3*- radicals, the oxidation of guanine occurs by intermolecular collision pathways, and the bimolecular rate constants are independent of base sequence context. However, the distributions of the end-products generated by CO3*- radicals, as well as by BPT*+, are base sequence context-dependent and are greater than those in isolated guanines at the 5'-G in 5'-...GG... sequences, and the first two 5'- guanines in the 5'-..GGG sequences. These results help to clarify the conditions that lead to a similar or different base sequence dependence of the initial hole injection step and the final distribution of oxidized, alkali-labile guanine products. In the case of the intermolecular one-electron oxidant CO3*-, the rate constant of hole injection is similar for contiguous and isolated guanines, but the subsequent equilibration of holes by hopping favors trapping and product formation at contiguous guanines, and the sequence dependence of these two phenomena are not correlated. In contrast, in the case of the DNA-bound oxidant BPT*+, the hole injection rate constants, as well as hole equilibration, exhibit a similar dependence on base sequence context, and are thus correlated to one another.     

Investigation of the adsorption behavior of glycine peptides on 12% cross-linked agarose gel media

The highly cross-linked 12% agarose gel Superose 12 10/300 GL causes retardation of glycine peptides when mobile phases containing varying concentrations of acetonitrile in water are used. An investigation has been made into the retention mechanism behind this retardation using the glycine dipeptide (GG) and tripeptide (GGG) as models. The dependence of retention times of analytical-size peaks under different experimental conditions was interpreted such that the adsorption most probably was caused by the formation of hydrogen bonds but that electrostatic interactions cannot be ruled out. Thereafter, a nonlinear adsorption study was undertaken at different acetonitrile content in the eluent, using the elution by characteristic points (ECPs) method on strongly overloaded GG and GGG peaks. With a new evaluation tool, the adsorption energy distribution (AED) could be calculated prior to the model selection. These calculations revealed that when the acetonitrile content in the eluent was varied from 0% to 20% the interactions turned from (i) being homogenous (GG) or mildly heterogeneous (GGG), (ii) via a more or less stronger degree of heterogeneity around one site to (iii) finally a typical bimodal energy interaction comprising of two sites (GG at 20% and GGG at 10% and 20%). The Langmuir, Tóth and bi-Langmuir models described these interesting adsorption trends excellently. Thus, the retardation observed for these glycine peptides is interpreted as being of mixed-mode character composed of electrostatic bonds and hydrogen bonds.     

Proton migration and tautomerism in protonated triglycine.

Proton migration in protonated glycylglycylglycine (GGG) has been investigated by using density functional theory at the B3LYP/6-31++G(d,p) level of theory. On the protonated GGG energy hypersurface 19 critical points have been characterized, 11 as minima and 8 as first-order saddle points. Transition state structures for interconversion between eight of these minima are reported, starting from a structure in which there is protonation at the amino nitrogen of the N-terminal glycyl residue following the migration of the proton until there is fragmentation into protonated 2-aminomethyl-5-oxazolone (the b(2) ion) and glycine. Individual free energy barriers are small, ranging from 4.3 to 18.1 kcal mol(-)(1). The most favorable site of protonation on GGG is the carbonyl oxygen of the N-terminal residue. This isomer is stabilized by a hydrogen bond of the type O-H.N with the N-terminal nitrogen atom, resulting in a compact five-membered ring. Another oxygen-protonated isomer with hydrogen bonding of the type O-H.O, resulting in a seven-membered ring, is only 0.1 kcal mol(-)(1) higher in free energy. Protonation on the N-terminal nitrogen atom produces an isomer that is about 1 kcal mol(-)(1) higher in free energy than isomers resulting from protonation on the carbonyl oxygen of the N-terminal residue. The calculated energy barrier to generate the b(2) ion from protonated GGG is 32.5 kcal mol(-)(1) via TS(6-->7). The calculated basicity and proton affinity of GGG from our results are 216.3 and 223.8 kcal mol(-)(1), respectively. These values are 3-4 kcal mol(-)(1) lower than those from previous calculations and are in excellent agreement with recently revised experimental values.     

Charge hopping in DNA.

The efficiency of charge migration through stacked Watson-Crick base pairs is analyzed for coherent hole motion interrupted by localization on guanine (G) bases. Our analysis rests on recent experiments, which demonstrate the competition of hole hopping transitions between nearest neighbor G bases and a chemical reaction of the cation G(+) with water. In addition, it has been assumed that the presence of units with several adjacent stacked G bases on the same strand leads to the additional vibronic relaxation process (G(+)G...G) --> (GG...G)(+). The latter may also compete with the hole transfer from (G(+)G...G) to a single G site, depending on the relative positions of energy levels for G(+) and (G(+)G...G). A hopping model is proposed to take the competition of these three rate steps into account. It is shown that the model includes two important limits. One corresponds to the situation where the charge relaxation inside a multiple guanine unit is faster than hopping. In this case hopping is terminated by several adjacent G bases located on the same strand, as has been observed for the GGG triple. In the opposite, slow relaxation limit the GG...G unit allows a hole to migrate further in accord with experiments on strand cleavage exploiting GG pairs. We demonstrate that for base pair sequences with only the GGG triple, the fast relaxation limit of our model yields practically the same sequence- and distance dependencies as measurements, without invoking adjustable parameters. For sequences with a certain number of repeating adenine:thymine pairs between neighboring G bases, our analysis predicts that the hole transfer efficiency varies in inverse proportion to the sequence length for short sequences, with change to slow exponential decay for longer sequences. Calculations performed within the slow relaxation limit enable us to specify parameters that provide a reasonable fit of our numerical results to the hole migration efficiency deduced from experiments with sequences containing GG pairs. The relation of the results obtained to other theoretical and experimental studies of charge transfer in DNA is discussed. We propose experiments to gain a deeper insight into complicated kinetics of charge-transfer hopping in DNA.