Synthesis of 2'-O-[2-[(N,N-dimethylamino)oxy]ethyl] modified nucleosides and oligonucleotides.

A versatile synthetic route has been developed for the synthesis of 2'-O-[2-[(N,N-dimethylamino)oxy]ethyl] (abbreviated as 2'-O-DMAOE) modified purine and pyrimidine nucleosides and their corresponding nucleoside phosphoramidites and solid supports. To synthesize 2'-O-DMAOE purine nucleosides, the key intermediate B (Scheme 1) was obtained from the 2'-O-allyl purine nucleosides (13a and 15) via oxidative cleavage of the carbon-carbon bond to the corresponding aldehydes followed by reduction. To synthesize pyrimidine nucleosides, opening the 2,2'-anhydro-5-methyluridine 5 with the borate ester of ethylene glycol gave the key intermediate B. The 2'-O-(2-hydroxyethyl) nucleosides were converted, in excellent yield, by a regioselective Mitsunobu reaction, to the corresponding 2'-O-[2-[(1,3-dihydro-1,3-dioxo-2H-isoindol-2-yl)oxy]ethyl] nucleosides (18, 19, and 20). These compounds were subsequently deprotected and converted into the 2'-O-[2-[(methyleneamino)oxy]ethyl] derivatives (22, 23, and 24). Reduction and a second reductive amination with formaldehyde yielded the corresponding 2'-O-[2-[(N,N-dimethylamino)oxy]ethyl] nucleosides (25, 26, and 27). These nucleosides were converted to their 3'-O-phosphoramidites and controlled-pore glass solid supports in excellent overall yield. Using these monomers, modified oligonucleotides containing pyrimidine and purine bases were synthesized with phosphodiester, phosphorothioate, and both linkages (phosphorothioate and phosphodiester) present in the same oligonucleotide as a chimera in high yields. The oligonucleotides were characterized by HPLC, capillary gel electrophoresis, and ESMS. The effect of this modification on the affinity of the oligonucleotides for complementary RNA and on nuclease stability was evaluated. The 2'-O-DMAOE modification enhanced the binding affinity of the oligonucleotides for the complementary RNA (and not for DNA). The modified oligonucleotides that possessed the phosphodiester backbone demonstrated excellent resistance to nuclease with t(1/2) > 24 h.     

Assessment of 4-nitrogenated benzyloxymethyl groups for 2'-hydroxyl protection in solid-phase RNA synthesis

The search for a 2'-OH protecting group that would impart ribonucleoside phosphoramidites with coupling kinetics and coupling efficiencies comparable to those of deoxyribonucleoside phosphoramidites led to an assessment of 2'-O-(4-nitrogenated benzyloxy)methyl groups through solid-phase RNA synthesis using phosphoramidites 2a-d, 12a, and 14a. These phosphoramidites exhibited rapid and efficient coupling properties. Particularly noteworthy is the cleavage of the 2'-O-[4-(N-methylamino)benzyloxy]methyl groups in 0.1 M AcOH, which led to U19dT within 15 min at 90 degrees C. [reaction: see text]     

The 3-(N-tert-butylcarboxamido)-1-propyl group as an attractive phosphate/thiophosphate protecting group for solid-phase oligodeoxyribonucleotide synthesis

Among the various phosphate/thiophosphate protecting groups suitable for solid-phase oligonucleotide synthesis, the 3-(N-tert-butylcarboxamido)-1-propyl group is one of the most convenient, as it can be readily removed, as needed, under thermolytic conditions at neutral pH. The deprotection reaction proceeds rapidly (t(1/2) approximately 100 s) through an intramolecular cyclodeesterification reaction involving the amide function and the release of the phosphate/thiophosphate group as a 2-(tert-butylimino)tetrahydrofuran salt. Incorporation of the 3-(N-tert-butylcarboxamido)-1-propyl group into the deoxyribonucleoside phosphoramidites 1a-d is achieved using inexpensive raw materials. The coupling efficiency of 1a-d in the solid-phase synthesis of d(ATCCGTAGCTAAGGTCATGC) and its phosphorothioate analogue is comparable to that of commercial 2-cyanoethyl deoxyribonucleoside phosphoramidites. These oligonucleotides were phosphate/thiophosphate-deprotected within 30 min upon heating at 90 degrees C in Phosphate-Buffered Saline (PBS buffer, pH 7.2). Since no detectable nucleobase modification or significant phosphorothioate desulfurization occurs, the 3-(N-tert-butylcarboxamido)-1-propyl group represents an attractive alternative to the 2-cyanoethyl group toward the large-scale preparation of therapeutic oligonucleotides.     

2'-O-[2-(amino)-2-oxoethyl] oligonucleotides

[structure: see text] Oligonucleotides with novel modifications, 2'-O-[2-(amino)-2-oxoethyl] (2'-O-NAc), 2'-O-[2-(methylamino)-2-oxoethyl] (2'-O-NMAc), 2'-O-[2-(dimethylamino)-2-oxoethyl] (2'-O-DMAc), and 2'-O-[2-[[2-(dimethylamino)ethyl]amino]-2-oxoethyl] (2'-O-DMAEAc), have been synthesized. These modified oligonucleotides exhibit high binding affinity to complementary RNA (and not to DNA) and considerably enhance the nuclease stability of oligonucleotides with t(1/2) > 24 h.     

2'-O-[2-(guanidinium)ethyl]-modified oligonucleotides: stabilizing effect on duplex and triplex structures

[structure: see text] Oligonucleotides with a novel 2'-O-[2-(guanidinium)ethyl] (2'-O-GE) modification have been synthesized using a novel protecting group strategy for the guanidinium group. This modification enhances the binding affinity of oligonucleotides to RNA as well as duplex DNA (DeltaT(m) 3.2 degrees C per modification). The 2'-O-GE modified oligonucleotides exhibited exceptional resistance to nuclease degradation. The crystal structure of a palindromic duplex formed by a DNA oligonucleotide with a single 2'-O-GE modification was solved at 1.16 A resolution.     

2'-O-[2-[N,N-(dialkyl)aminooxy]ethyl]-modified antisense oligonucleotides

[structure] Oligonucleotides with two novel modifications, 2'-O-?2-[N, N-(dimethyl)aminooxy]ethyl? (2'-O-DMAOE) and 2'-O-?2-[N, N-(diethyl)aminooxy]ethyl? (2'-O-DEAOE), have been synthesized. These modifications exhibit high binding affinity to target RNA (and not to DNA) and enhance the nuclease stability of oligonucleotides considerably with t(1/2) > 24 h as a phosphodiester.     

Nucleotides. Part L. Aglycone protection by the (2-dansylethoxy)carbonyl (= {2-{[5-(dimethylamino)naphthalen-l-yl]sulfonyl}ethoxy}carbonyl; dnseoc) group a new variation in oligodeoxyribonucleotide synthesis

The (2-dansylethoxy)carbonyl (= {2-{[5-(dimethylamino)naphthalen-l-yl]sulfonyl}ethoxy}carbonyl; dnseoc) group was employed for protection of the amino functions of the aglycone residues. The lactam function of 2′-deoxyguanosine was on the one hand unprotected and on the other hand alkylated at O⁶ of the aglycone with the 2-(4-nitrophenyl)ethyl (npe) and 2-(phenylsulfonyl)ethyl (pse) group, respectively. The syntheses of monomeric building blocks, both phosphoramidites and nucleoside- functionalized supports, are described for the three common 2′-deoxynucleosides (2′-deoxycytidine, 2′-deoxyadenosine, 2′-deoxyguanosine). As kinetic studies with the tritylated nucleosides showed, the dnseoc group is more labile towards DBU cleavage than the corresponding 2-(4-nitrophenyl)ethyl-(npe) and [2-(4-nitrophenyl)ethoxy]carbonyl(npeoc)-protected analogues (see Table 2). These results were confirmed by the very fast deprotection rate of the dnseoc groups at some oligonucleotides.     

Thermolytic 4-methylthio-1-butyl group for phosphate/thiophosphate protection in solid-phase synthesis of DNA oligonucleotides

The thermolabile 4-methylthio-1-butyl phosphate/thiophosphate protecting group for DNA oligonucleotides has been investigated for its potential application to a "heat-driven" process for either oligonucleotide synthesis on diagnostic microarrays or, oppositely, to the large-scale preparation of therapeutic oligonucleotides. The preparation of phosphoramidites 10a-d is straightforward, and the incorporation of these amidites into oligonucleotides via solid-phase techniques proceeds as efficiently as that achieved with 2-cyanoethyl deoxyribonucleoside phosphoramidites. The versatility of the 4-methylthio-1-butyl phosphate/thiophosphate protecting group is exemplified by its facile removal from oligonucleotides upon heating for 30 min at 55 degrees C in an aqueous buffer under neutral conditions or within 2 h at 55 degrees C in concentrated NH(4)OH. The deprotection reaction occurs through an intramolecular cyclodeesterification mechanism leading to the formation of sulfonium salt 18. When mixed with deoxyribonucleosides and N-protected 2'-deoxyribonucleosides or with a model phosphorothioate diester under conditions approximating those of large-scale (>50 mmol) oligonucleotide deprotection reactions, the salt 18 did not significantly alter DNA nucleobases or desulfurize the phosphorothioate diester model to an appreciable extent.     

Phosphoramidite building blocks for efficient incorporation of 2′-O-aminoethoxy(and propoxy)methyl nucleosides into oligonucleotides

A simple and efficient method for the preparation of eight phosphoramidite building blocks for incorporation of 2′-O-(2-aminoethoxymethyl)ribonucleosides and 2′-O-(3-aminopropoxymethyl)ribonucleosides into synthetic oligonucleotides has been developed. The synthetic routes are maximally convergent and provide sufficient amounts of phosphoramidites for several solid-phase synthesis coupling reactions. Using acyclic derivatives 17a,b the overall yields of phosphoramidites 2 and 3 were increased up to 50% for pyrimidine nucleosides and up to 30% for purine derivatives with substantial decrease of total reaction steps. The 2′-O-substituent was found to be stable during oligonucleotide synthesis. The resulting oligonucleotides are of particular interest for post-synthetic functionalization and conjugation.     

SYNTHESIS AND CRYSTAL STRUCTURE OF COBALT(III) COMPLEXES WITH SUBSTITUTED 2-[(BENZIMIDAZOLE-1-YL) IMINOMETHYL]PHENOLS

Journal of Structural Chemistry - Two Co(III) complexes are synthesized based on 2-{(E)-[2-(hydroxy(alkyl)amino)benzimidazole-1-yl]iminomethyl}phenol (H3L1 and H3L2, alkyl is ethyl or propyl). By...     

Synthesis of amine- and thiol-modified nucleoside phosphoramidites for site-specific introduction of biophysical probes into RNA

For studies of RNA structure, folding, and catalysis, site-specific modifications are typically introduced by solid-phase synthesis of RNA oligonucleotides using nucleoside phosphoramidites. Here, we report the preparation of two complete series of RNA nucleoside phosphoramidites; each has an appropriately protected amine or thiol functional group. The first series includes each of the four common RNA nucleotides, U, C, A, and G, with a 2'-(2-aminoethoxy)-2'-deoxy substitution (i.e., a primary amino group tethered to the 2'-oxygen by a two-carbon linker). The second series encompasses the four common RNA nucleotides, each with the analogous 2'-(2-mercaptoethoxy)-2'-deoxy substitution (i.e., a tethered 2'-thiol). The amines are useful for acylation and reductive amination reactions, and the thiols participate in displacement and oxidative cross-linking reactions, among other likely applications. The new phosphoramidites will be particularly valuable for enabling site-specific introduction of biophysical probes and constraints into RNA.     

Thermolytic properties of 3-(2-pyridyl)-1-propyl and 2-[N-methyl-N-(2-pyridyl)]aminoethyl phosphate/thiophosphate protecting groups in solid-phase synthesis of oligodeoxyribonucleotides

Thermolytic groups may serve as alternatives to the conventional 2-cyanoethyl group for phosphate/thiophosphate protection in solid-phase oligonucleotide synthesis to prevent DNA alkylation by acrylonitrile generated under the basic conditions used for oligonucleotide deprotection. Additionally, thermolytic groups are attractive in the context of engineering a "heat-driven" process for the synthesis of oligonucleotides on diagnostic microarrays. In these regards, the potential application of pyridine derivatives as thermolytic phosphate/thiophosphate protecting groups has been investigated. Specifically, 2-pyridinepropanol and 2-[N-methyl-N-(2-pyridyl)]aminoethanol were incorporated into deoxyribonucleoside phosphoramidites 7a-d and 9, which were found as efficient as 2-cyanoethyl deoxyribonucleoside phosphoramidites in solid-phase oligonucleotide synthesis. Whereas the removal of 3-(2-pyridyl)-1-propyl phosphate/thiophosphate protecting groups from oligonucleotides is effected within 30 min upon heating at 55 degrees C in concentrated NH4OH or in an aqueous buffer at pH 7.0, cleavage of 2-[N-methyl-N-(2-pyridyl)]aminoethyl groups occurs spontaneously when their phosphate or phosphorothioate esters are formed during oligonucleotide synthesis. The deprotection of these groups follows a cyclodeesterification process generating the bicyclic salts 13 and 14 as side products. These salts do not alkylate or otherwise modify any DNA nucleobases and do not desulfurize a phosphorothioate diester model under conditions mimicking large-scale oligonucleotide deprotection.     

2'-O-[2-[2-(N,N-dimethylamino)ethoxy]ethyl] modified oligonucleotides: symbiosis of charge interaction factors and stereoelectronic effects

[structure: see text] Oligonucleotides with a novel, 2'-O-[2-[2-(N,N-dimethylamino)ethoxy]ethyl] (2'-O-DMAEOE) modification have been synthesized. This modification, a cationic analogue of the 2'-O-(2-methoxyethyl) (2'-O-MOE) modification, exhibits high binding affinity to target RNA (but not to DNA) and exceptional resistance to nuclease degradation. Analysis of the crystal structure of a self-complementary oligonucleotide containing a single 2'-O-DMAEOE modification explains the importance of charge factors and gauche effects on the observed antisense properties. 2'-O-DMAEOE modified oligonucleotides are ideal candidates for antisense drugs.     

Preparation and formation mechanism of a n-butylammonium/MnO2 layered hybrid via a one-pot synthesis under moderate conditions

The preparation of organic/inorganic layered hybrids has relied on multistep processing. Thus, shortening the synthetic procedure is important for possible future applications, but only a few studies report one-pot syntheses. In this work, we established a simple one-pot solution process to synthesize layered alkyl ammonium/MnO(2) hybrids, by stirring MnCl(2) and alkyl amine/H(2)O(2) aqueous solutions at 40 °C; the reaction concept is a chemical oxidation of Mn(II) ions in the presence of alkyl amine in aqueous solution. Furthermore, the formation mechanism of the layered n-butylammonium/MnO(2) hybrid was examined by following the structural and optical changes during the reaction, revealing that the one-pot reaction includes 3 steps; formation of β-MnOOH, topotactic oxidation of β-Mn(III)OOH to form the protonated layered manganese oxide H(x)Mn(III, IV)O(2)·yH(2)O, and ion-exchange of interlayer H(+) (or H(3)O(+)) with n-butylammonium to form layered n-butylammonium/MnO(2).     

Cationic polymerization of α,β-disubstituted olefins. V. Reactivity of propenyl alkyl ethers in cationic polymerization

To elucidate the effect of the introduction of a methyl group in the β-position of a vinyl monomer, propenyl alkyl ethers were copolymerized with vinyl ethers having the same alkoxy group. Propenyl alkyl ethers with an unbranched alkoxy group (ethyl or n-butyl propenyl ether) were more reactive than the corresponding vinyl ethers. This behavior is quite different from that of β-methylstyrene derivatives. However, propenyl alkyl ethers with branched alkoxy groups at the α carbon atom (isopropyl or tert-butyl propenyl ether) were less reactive than the corresponding vinyl ethers. Also, cis- isomers were more reactive than the trans isomers, regardless of the kind of alkoxy group and the polarity of the solvent.     

Synthesis of 2′-O-[2-[(N,N-dialkylamino)oxy]ethyl]-modified oligonucleotides: hybridization affinity, resistance to nuclease, and protein binding characteristics

Synthesis of a series of 2′-O-[2-[(N,N-dialkylamino)oxy]ethyl]-modified 5-methyluridine nucleoside phosphoramidites and solid supports are described. Using these monomers, modified oligonucleotides containing phosphodiester linkages were synthesized in high yields. These modified oligonucleotides showed enhanced binding affinity to the complementary RNA (and not to DNA) and excellent nuclease stability with t_1/2>24 h. The human serum albumin binding properties of modified oligonucleotides have been evaluated to assess their transport and toxicity properties.     

Effects of methyl substituents on the proton chemical shifts in the NMR spectra of the twenty methyl and ethyl substituted hydrazines. Electronegativity values for hydrazyl groups

The C? H proton NMR spectra of the twenty conceivable methyl and ethyl substituted hydrazines are presented and analyzed with respect to effects on chemical shifts of the C? H protons caused by replacement of hydrogen by methyl and ethyl groups on the C? N? N? C chain. Thirteen different methyl substituent effects and six different ethyl substituent effects are identified and evaluated. Most of the effects are shielding and in accordance with an electron-releasing inductive effect of alkyl groups. A deshielding effect (the ‘C? C bond effect’) is observed when a methyl group replaces the hydrogen on the carbon bearing the hydrogen in focus and primary hydrogen on the carbon bearing the hydrogen in focus and primary hydrogens become secondary, as observed in other systems. On the basis of their effects on the chemical shifts of methyl protons in CH₃X, eighteen different hydrazyl groups (× = ? NR₁NR₂R₃) fall into three classes: I (R₁ = H; R₂, R₃ = H or alkyl); II (R₁ = alkyl; R₂ and/or R₃ = H); III (R₁, R₂ and R₃ = alkyl), with slightly different electronegativities: 2·94, 2·83 and 2·74, respectively.     

A simple and efficient approach for the synthesis of fluorinated and nonfluorinated octaethylporphyrin-based benzochlorins with variable lipophilicity, their in vivo tumor uptake, and the preliminary in vitro photosensitizing efficacy

Starting from commercially available Ni(II)octaethylporphyrin (OEP), an efficient approach for the preparation of a series of fluorinated and nonfluorinated benzochlorins with variable lipophicity has been developed. Their spectroscopic properties, preliminary in vitro photosensitizing efficacy, and tumor selectivity were determined. Our methodology provides a facile approach for the preparation of the free-base and the related Zn(II) benzochlorins containing alkyl and alkyl ether side chains with variable carbon units. For the preparation of benzochlorins containing alkyl groups attached to the exocyclic phenyl ring, the Ni(II) meso-(2-formylvinyl)octaethyl porphyrin 2 was reacted with various reagents such as (trifluoromethyl)trimethylsilane (TMS-CF3) or the Grignard reagents of various fluorinated or nonfluorinated alkyl halides. The corresponding intermediates 3, 6a-6e, and 8 obtained via intramolecular cyclization under acidic conditions afforded the related benzochlorins 5, 7a-d, and 9 in good yields except for 7e which was obtained in poor yield (11.4%). The alcohol 10 obtained by reacting porphyrin 2 with ethynylmagnesium chloride did not produce the expected acetylenic benzochlorin; instead the corresponding acetyl derivative 11 was obtained as a major product, which under appropriate reaction conditions was converted into a series of alkyl ether derivatives 13a-13d. To obtain a benzochlorin bearing an ester functionality (15), porphyrin 2 was first reacted with ethyl acetate/LDA and the intermediate alcohol 14 was then cyclized with sulfuric acid. Unlike most of the natural and synthetic chlorins, the Zn(II) complexes of the benzochlorin analogues exhibited a significant bathochromic shift ( approximately 10 nm) in the electronic absorption spectra, and the long wavelength absorptions were observed in the range 671-677 nm (epsilon: 43270-50360). For investigating the in vitro efficacy of these analogues, Molt-4 cells were used. At a concentration of 2.5 microM, and a light dose of 4 J/cm2, all benzochlorins produced significant photosensitizing efficacy. The tumor (RIF) and muscle uptake in C3H mice of these photosensitizers was determined by in vivo reflectance spectroscopy. These results indicate that in this series increasing the length of the alkyl or alkyl ether carbon chains at the fused phenyl ring system produced a significant increase in tumor uptake.     

DNA microarray synthesis by using PDMS molecular stamp (II)

Based on the standard phosphoramidites chemistry protocol, two oligonucleotides synthetic routes were studied by contact stamping reactants to a modified glass slide. Route A was a contact coupling reaction, in which a nucleoside monomer was transferred and coupled to reactive groups (OH) on a substrate by spreading the nucleoside activated with tetrazole on a polydimethylsiloxane (PDMS) stamp. Route B was a contact detritylation, in which one nucleoside was fixed on the desired synthesis regions where dimethoxytrityl (DMT) protecting groups on the 5’-hydroxyl of the support-bound nucleoside were removed by stamping trichloroacetic acid (TCA) distributed on features on a PDMS stamp. Experiments showed that the synthetic yield and the reaction speed of route A were higher than those of route B. It was shown that 20 mer oligonucleotide arrays immobilized on the glass slide were successfully synthesized using the PDMS stamps, and the coupling efficiency showed no difference between the PDMS stamping and the conventional synthesis methods.     

DNA microarray synthesis by using PDMS molecular stamp (II) Oligonucleotide on-chip synthesis using PDMS stamp

Based on the standard phosphoramidites chemistry protocol, two oligonucleotides synthetic routes were studied by contact stamping reactants to a modified glass slide. Route A was a contact coupling reaction, in which a nucleoside monomer was transferred and coupled to reactive groups (OH) on a substrate by spreading the nucleoside activated with tetrazole on a polydimethylsiloxane (PDMS) stamp. Route B was a contact detritylation, in which one nucleoside was fixed on the desired synthesis regions where dimethoxytrityl (DMT) protecting groups on the 5’-hydroxyl of the support-bound nucleoside were removed by stamping trichloroacetic acid (TCA) distributed on features on a PDMS stamp. Experiments showed that the synthetic yield and the reaction speed of route A were higher than those of route B. It was shown that 20 mer oligonucleotide arrays immobilized on the glass slide were successfully synthesized using the PDMS stamps, and the coupling efficiency showed no difference between the PDMS stamping and the conventional synthesis methods.