共查询到20条相似文献,搜索用时 31 毫秒
1.
BasedonthecrystalstructuredatafromXrayanalysis[1,2]andthespectralpropertiesofeachchromophoreofCPC[3,4],Sauerandcoworkers[5,6]expectedthatthedynamicsofenergytransferprocessesshouldtakeplacewithin10—30pstimescalebetweentwotrimersofCPChexamer.Furthermore,Zhaoandco… 相似文献
2.
Clarifying and illustrating the electronic energy transfer pathways in trimeric and hexameric aggregation state of cyanobacteria allophycocyanin within the framework of Förster theory 下载免费PDF全文
Bo Chi Xinya Han Hao Zhu Lingling Feng Jian Wan Xin Xu 《Journal of computational chemistry》2015,36(3):137-145
Within the framework of the Förster theory, the electronic excitation energy transfer pathways in the cyanobacteria allophycocyanin (APC) trimer and hexamer were studied. The associated physical quantities (i.e., excitation energy, oscillator strength, and transition dipole moments) of the phycocyanobilins (PCBs) located in APC were calculated at time‐dependent density functional theory (TDDFT) level of theory. To estimate the influence of protein environment on the preceding calculated physical quantities, the long‐range interactions were approximately considered with the polarizable continuum model at the TDDFT level of theory, and the short‐range interaction caused by surrounding aspartate residue of PCBs were taken into account as well. The shortest energy transfer time calculated in the framework of the Förster model at TDDFT/B3LYP/6–31+G* level of theory are about 0.10 ps in the APC trimer and about 170 ps in the APC monomer, which are in qualitative agreement with the experimental finding that a very fast lifetime of 0.43–0.44 ps in APC trimers, whereas its monomers lacked any corresponding lifetime. These results suggest that the lifetime of 0.43–0.44 ps in the APC trimers determined by Sharkov et al. was most likely attributed to the energy transfer of α1‐84 ? β3‐84 (0.23 ps), β1‐84 ? α2‐84 (0.11 ps) or β2‐84 ? α3‐84 (0.10 ps). So far, no experimental or theoretical energy transfer rates between two APC trimmers were reported, our calculations predict that the predominate energy transfer pathway between APC trimers is likely to occur from α3‐84 in one trimer to α5‐84 in an adjacent trimer with a rate of 32.51 ps. © 2014 Wiley Periodicals, Inc. 相似文献
3.
Phycobiliproteinsarethelightharvestingpigmentsforphotosynthesisinalgaeandincludephycoerythrin,phycocyaninandallophycocyanin.Inredandbluealgae,differentkindsofphycobiliproteinsaswellaslinkerpolypeptidesformawellorgnizedsystemwithefficientfunctionsoflig… 相似文献
4.
Abstract—Energy migration has been studied in C-phycocyanin (C-PC) rods with traps located in the terminal trimer disc, using the Monte Carlo method and the system of differential equations. It has been found that jump time statistics can be described by the function F = C(t/0 >)exp(-t/ < to >), where C is the constant, t and < t0 > are, respectively, the exciton jump time and its averaged value for chromophores of the corresponding spectral types (α 84 , β84 or β155). The values < t0 > were calculated for the cases of C-PC monomers, trimers and higher associates.
The C-PC model, which consists of three hexamers with traps located in the β84 chromophores of the peripheral trimer, was examined. It was found that the total efficiency of excitation capturing, øtr , exceeds 90%, provided "local" quantum yield of energy trapping ø0 > 10%. The ø0 value influences both the excitation lifetime (τ) and the mean number of excitation jumps (Niump ) before its conversion. For the ø0 = 100% and 10%, the corresponding lifetimes and numbers of jumps were calculated to be τ= 75 and 155 ps and Njump = 105 and 222 jumps, respectively.
The dynamics of excitation redistribution along the C-PC rods and the fluorescence kinetics for various ø0 values were calculated for C-PC chromophores excited by a +, and the correlation between these processes and ø 0 , was disclosed. The transient processes of excitation redistribution were shown to proceed within a time period t < 30 ps. 相似文献
The C-PC model, which consists of three hexamers with traps located in the β84 chromophores of the peripheral trimer, was examined. It was found that the total efficiency of excitation capturing, ø
The dynamics of excitation redistribution along the C-PC rods and the fluorescence kinetics for various ø
5.
Jing-min Zhang Xi-guang Zheng Jian-ping Zhang Fu-li Zhao Jie Xie He-zhou Wang Jing-quan Zhao Li-jin Jiang 《Photochemistry and photobiology》1998,68(6):777-784
Abstract— The excitation energy transfer processes in the allophycocyanin (APC) monomer and trimer from phycobilisomes of Polysiphonia urceolata were studied using picosecond time-resolved fluorescence isotropic and anisotropic spectroscopy. Based on our experimental results, conclusions could be drawn as follows: (1) After the processes of exciton localization are finished, the localized excitation energy on any chromophore can be transferred to the other chromophores due to the weak couplings between them, and the processes among three p84-phycocyaninbilin (PCB) chromophores in the center of the ring shape of the APC trimer are more important than those of between a84- and p84-PCB chromophores in the same monomer. (2) The decay time constants of 95 ± 5 ps and 40 ± 5 ps components, observed by us in this work, were assigned to the excitation energy transfer or redistribution between α84- and β84-PCB chromophores in the same monomer of the APC trimer and among three β84-PCB chromophores in the center of the ring shape of the APC trimer, respectively. Specifically, the assignment of the decay constants for the 40 ± 5 ps component was different from those of previous results. (3) Based on the model of Debreczeny, and using the fluorescence residual anisotropy r(∞) with a probing wavelength of 650 nm, the angles between the C3 symmetry axis and transition dipoles of α84- and -PCB chromophores were found to be φa84= 67° and φβ84= 148°, respectively, which are in agreement with the prediction of the X-ray crystal structure of APC. (4) The results show that anisotropy decays, observed with the APC trimer, did exhibit a strongly probing wavelength dependence that did not show up in the monomer. 相似文献
6.
Abstract— The current work concerns investigation of the polarization properties of complex molecular ensembles exhibiting threefold (C3) rotational symmetry, particularly with regard to the interplay between their structure and dynamics of internal energy transfer. We assume that the molecules or chromophores in such complexes possess strongly overlapped spectra both for absorption and fluorescence. Such trimeric structures are widely found in biological preparations, as for example the trimer of C-phycocyanin (C-PC). Higher order aggregates, e.g. hex-amers and three-hexamer rods, are also investigated and compared with the trimer case. The theory addresses both steady-state and 8-pulse excitation and establishes some links between them. Monochromophoric, bichro-mophoric and trichromophoric molecular complexes are individually examined. For steady-state excitation, analytical formulas are reported for the degree of fluorescence polarization and absorption anisotropy. It is shown that the polarization is dependent on the chromophore inclination relative to the symmetry axis, the relative efficiencies of absorption and fluorescence by chromophores of different spectral types, and the rates of energy equilibration. To assess the validity of the theory, it has been applied to C-PC aggregates. Here it was found that different C-PC aggregates provide practically identical polarization response. For S-pulse excitation we give analytical formulas for determination of the fluorescence depolarization, and also the depolarization associated with absorption recovery, both for a monochromophoric trimer and some particular cases of bichromophoric trimer. More complicated systems are analyzed by computer modeling. Thus it transpires that the initial polarization anisotropy r(t = 0) takes the value 0.4 for all considered aggregates; the long-time limit r(t →∞) has about the same value as is associated with steady-state excitation. We also show that with steady-state excitation the degree of fluorescence polarization is practically equal for various C3 aggregates of C-PC, and that the major factor determining the polarization is the chromophore orientation relative to the symmetry axis. 相似文献
7.
D. Wong F. Pellegrino R. R. Alfano B. A. Zilinskas 《Photochemistry and photobiology》1981,33(5):651-662
Abstract— Phycobilisomes from the blue-green alga Nostoc sp. are known to contain the phycobiliproteins: c-phycoerythrin (c-PE), c-phycocyanin (c-PC) and four forms of allophycocyanin (APC I, II, III, and B). We have made a detailed study of the effects of the intensity of a single 6 ps excitation pulse on the decay kinetics and the yield of fluorescence in the individual isolated phycobiliproteins at pH 7 and 23°C. The risetime of the fluorescence of c-PE, c-PC and APC was > 12 ps. We found that the decay of the fluorescence was exponential at intensities of 1014 photons/cm2 in all the phycobiliproteins; the lifetimes being 1552 ± 31ps for c-PE, 2111 ± 83ps for c-PC, 1932 ± 165ps for APC I, 1870 ± 90ps for APC II, 1816 ± 88ps for APC III, (1869 ± 62ps for the averaged APC's I, II, and III), and 2667 ± 233 ps for APC B. We also found that the fluorescence decay became non-exponential in c-PE at excitation intensities < 1014 photons/cm2, but was exponential for all the other phycobiliproteins even at a pulse intensity of 1015 photons/cm2. The relaxation times of c-PE and c-PC decreased with excitation intensity above 1014 photons/cm2. For c-PE and c-PC the relative fluorescence vs excitation intensity was readily described by a relationship derived for a model in which exciton–exciton annihilation occurs. In APC the fluorescence yield and relaxation time were only slightly dependent on the excitation intensity. The results are interpreted to indicate the occurrence of singlet–singlet annihilation intramolecularly among the several phycobilin chromophores within the individual phycobiliprotein molecules in solution. The s to f transfer time is less than 12ps in c-PC. 相似文献
8.
Yanliang Ren Bo Chi Osama Melhem Ke Wei Lingling Feng Yongjian Li Xinya Han Ding Li Ying Zhang Jian Wan Xin Xu Minghui Yang 《Journal of computational chemistry》2013,34(12):1005-1012
In the present study, the electronic energy transfer pathways in trimeric and hexameric aggregation state of cyanobacteria C‐phycocyanin (C‐PC) were investigated in term of the Förster theory. The corresponding excited states and transition dipole moments of phycocyanobilins (PCBs) located into C‐PC were examined by model chemistry in gas phase at time‐dependent density functional theory (TDDFT), configuration interaction‐singles (CIS), and Zerner's intermediate neglect of differential overlap (ZINDO) levels, respectively. Then, the long‐range pigment‐protein interactions were approximately taken into account by using polarizable continuum model (PCM) at TDDFT level to estimate the influence of protein environment on the preceding calculated physical quantities. The influence of the short‐range interaction caused by aspartate residue nearby PCBs was examined as well. Only when the protonation of PCBs and its long‐ and short‐range interactions were properly taken into account, the calculated energy transfer rates (1/K) in the framework of Förster model at TDDFT/B3LYP/6‐31+G* level were in good agreement with the experimental results of C‐PC monomer and trimer. Furthermore, the present calculated results suggested that the energy transfer pathway in C‐PC monomer is predominant from β‐155 to β‐84 (1/K = 13.4 ps), however, from α‐84 of one monomer to β‐84 (1/K = 0.3–0.4 ps) in a neighbor monomer in C‐PC trimer. In C‐PC hexamer, an additional energy flow was predicted to be from β‐155 (or α‐84) in top trimer to adjacent β‐155 (or α‐84) (1/K = 0.5–2.7 ps) in bottom trimer. © 2013 Wiley Periodicals, Inc. 相似文献
9.
Exciton transfers in the two-dimensional and spin-canted antiferromagnet (C2H5NH3)2MnCl4 were studied by investigating the absorption spectra 6A1g → 4T2g(4D) of Mn2+. A magnon side band (exciton–magnon simultaneous excitation) which has an anomalous shape with the cutoffs at the low-energy as well as the high-energy sides was observed. This anomalous shape could be reproduced in calculation as magnon side band, considering both the intersublattice and intrasublattice exciton transfers. From the analysis of this band shape, the magnitudes of the intersublattice and intrasublattice exciton transfers are estimated to be 10.2 and 6.8 cm?1, respectively. In the case of simple antiferromagnets without spin canting, the intersublattice exciton transfer process is forbidden because of the spin angular momentum. However, in the case of (C2H5NH3)2MnCl4, the prohibition of the intersublattice exciton transfer is removed by the canted-spin arrangement. 相似文献
10.
Chao‐Han Cheng Dr. Ruei‐Ding Hung Wen‐Zhen Wang Dr. Shie‐Ming Peng Prof. I‐Chia Chen Prof. 《Chemphyschem》2010,11(2):466-473
Transient absorption spectroscopy is used to study the excited‐state dynamics of Co3(dpa)4(NCS)2, where dpa is the ligand di(2‐pyridyl)amido. The ππ*, charge‐transfer, and d–d transition states are excited upon irradiation at wavelengths of 330, 400 and 600 nm, respectively. Similar transient spectra are observed under the experimental temporal resolution and the transient species show weak absorption. We thus propose that a low‐lying metal‐centered d–d state is accessed immediately after excitation. Analyses of the experimental kinetic traces reveal rapid conversion from the ligand‐centered ππ* and the charge‐transfer states to this metal‐centered d‐d state within 100 fs. The excited molecule then crosses to a second d–d state within the ligand‐field manifold, with a time coefficient of 0.6–1.4 ps. Because the ground‐state bleaching band recovers with a time coefficient of 10–23 ps, we propose that an excited molecule crosses from the low‐lying d–d state either directly within the same spin system or with spin crossing via the state 2B to the ground state 2A2 (symmetry group C4). In this trimetal string complex, relaxation to the ground electronic surface after excitation is thus rapid. 相似文献
11.
Azobenzene‐Bridged Porphyrin Nanorings: Syntheses,Structures, and Photophysical Properties 下载免费PDF全文
Weiming Huang Seung‐Kyu Lee Young Mo Sung Fulei Peng Dr. Bangshao Yin Prof. Dr. Ming Ma Prof. Dr. Bo Chen Prof. Dr. Shubin Liu Prof. Dr. Steven Robert Kirk Prof. Dr. Dongho Kim Prof. Dr. Jianxin Song 《Chemistry (Weinheim an der Bergstrasse, Germany)》2015,21(43):15328-15338
Azobenzene‐bridged β‐to‐β and meso‐to‐meso porphyrin nanorings were successfully synthesized by a palladium‐catalyzed Suzuki–Miyaura coupling reaction in a logical synthesis. The dimeric structure was confirmed by XRD analysis. The azo linkages in di‐ and tetramers are in the all‐trans conformation, whereas in the trimers one azo linkage can be interconverted between cis and trans under external stimulation. When trimeric isomers are heated to 333 K or higher, the azo linkages will be in the all‐trans configurations: the pure all‐trans trimer can be kept in the dark for several months. Fluorescence anisotropy and pump‐power‐dependent decay results revealed excitation energy transfer for azobenzene‐bridged zinc–porphyrin nanorings. The distances between porphyrin units of these azobenzene‐bridged porphyrin arrays are almost the same, but the exciton energy hopping (EEH) times for each wheel are markedly different. The dimer and meso‐to‐meso tetramer possess relatively short excitation energy transfer (EET) times (1.28 and 2.48 ps, respectively) due to their good planarity and rigidity. In contrast, the EET time for the trimeric zinc(II)–porphyrin array (6.9 ps) is relatively long due to its nonradiative decay pathway (i.e., cis/trans isomerization of azobenzene). Both di‐ and tetramers exhibit relatively high fluorescence quantum yields, whereas the trimers show weak emission because of structural differences. 相似文献
12.
F. Pellegrino D. Wong R. R. Alfano B. A. Zilinskas 《Photochemistry and photobiology》1981,34(6):691-696
Abstract— A detailed experimental study of the effect of intensity of a 6 ps excitation pulse on the decay kinetics and yield from phycobilisomes (PBsomes) is presented. The fluorescence from the c-phycoerythrin (PE) emission from PBsomes was found to decay as a single exponential with a time of 31 ± 4ps for an excitation intensity <1014 photons/cm2 per pulse. The risetime of the c-phycocyanin (PC) and allophycocyanin (APC) emission from PBsomes was found to be 34 ± 13 ps. Therefore, at low excitation intensities, the energy transfer time between the constituent phycobiliproteins, PE and PC, is measured to be 34 ± 13ps from the fluorescence decay time of PE and the fluorescence risetime of the PC and APC emission. The fluorescence yield from the PE emission component in PBsomes was found to be intensity dependent for excitation intensities >1014 photons/cm2. The decrease in yield with increased intensity in this case occurred at a higher intensity than in the isolated phycobiliprotein PE. The fluorescence yield of the PC and APC emission component was also found to decrease markedly with increasing excitation intensity. This is in contrast to the case of the isolated phycobiliprotein APC which showed only a slight quenching of the fluorescence. The higher quenching observed for the APC emission in the PBsome evidences the higher effective absorption of APC via energy transfer from PE to PC and APC. 相似文献
13.
Novoderezhkin VI Palacios MA van Amerongen H van Grondelle R 《The journal of physical chemistry. B》2005,109(20):10493-10504
We have modeled steady-state spectra and energy-transfer dynamics in the peripheral plant light-harvesting complex LHCII using new structural data. The dynamics of the chlorophyll (Chl) b-->Chl a transfer and decay of selectively excited "bottleneck" Chl a and b states have been studied by femtosecond pump-probe spectroscopy. We propose an exciton model of the LHCII trimer (with specific site energies) which allows a simultaneous quantitative fit of the absorption, linear-dichroism, steady-state fluorescence spectra, and transient absorption kinetics upon excitation at different wavelengths. In the modeling we use the experimental exciton-phonon spectral density and modified Redfield theory. We have found that fast b-->a transfer is determined by a good connection of the Chls b to strongly coupled Chl a clusters, i.e., a610-a611-a612 trimer and a602-a603 and a613-a614 dimers. Long-lived components of the energy-transfer kinetics are determined by a quick population of red-shifted Chl b605 and blue-shifted Chl a604 followed by a very slow (3 ps for b605 and 12 ps for a604) flow of energy from these monomeric bottleneck sites to the Chl a clusters. The dynamics within the Chl a region is determined by fast (with time constants down to sub-100 fs) exciton relaxation within the a610-a611-a612 trimer, slower 200-300 fs relaxation within the a602-a603 and a613-a614 dimers, even slower 300-800 fs migration between these clusters, and very slow transfer from a604 to the quasi-equilibrated a sites. The final equilibrium is characterized by predominant population of the a610-a611-a612 cluster (mostly the a610 site). The location of this cluster on the outer side of the LHCII trimer probably provides a good connection with the other subunits of PSII. 相似文献
14.
Zi-Wen Li Jia-Jia Yang Dr. Xiang-Yang Liu Prof. Wei-Hai Fang Prof. Haobin Wang Prof. Ganglong Cui 《Chemistry (Weinheim an der Bergstrasse, Germany)》2021,27(12):4159-4167
Whether chemical bonding can regulate the excited-state and optoelectronic properties of donor–acceptor dyads has been largely elusive. In this work, we used electronic structure and nonadiabatic dynamics methods to explore the excited-state properties of covalently bonded zinc phthalocyanine (ZnPc)-fullerene (C60) dyads with a 6–6 (or 5–6) bonding configuration in which ZnPc is bonded to two carbon atoms shared by the two hexagonal rings (or a pentagonal and a hexagonal ring) in C60. In both cases, the locally excited (LE) states on ZnPc are spectroscopically bright. However, their different chemical bonding differentiates the electronic interactions between ZnPc and C60. In the 5–6 bonding configuration, the LE states on ZnPc are much higher in energy than the LE states on C60. Thus, the excitation energy transfer from ZnPc to C60 is thermodynamically favorable. On the other hand, in the 6–6 bonding configuration, such a process is inhibited because the LE states on ZnPc are the lowest ones. More detailed mechanisms are elucidated from nonadiabatic dynamics simulations. In the 6–6 bonding configuration, no excitation energy transfer was observed. In contrast, in the 5–6 bonding configuration, several LE and charge-transfer (CT) excitons were shown to participate in the energy-transfer process. Further analysis reveals that the photoinduced energy transfer is mediated by a CT exciton, such that electron- and hole-transfer processes take place in a concerted but asynchronous manner in the excitation energy transfer. It is also found that high-level electronic structure methods including exciton effects are indispensable to accurately describe photoinduced energy- and electron-transfer processes. Furthermore, this work opens up new avenues for regulating the excited-state properties of molecular donor–acceptor dyads by means of chemical bonding. 相似文献
15.
Electronic Excitations in G‐quadruplexes Formed by the Human Telomeric Sequence: A Time‐Resolved Fluorescence Study 下载免费PDF全文
Pascale Changenet‐Barret Ying Hua Thomas Gustavsson Dimitra Markovitsi 《Photochemistry and photobiology》2015,91(3):759-765
The present study deals with G‐quadruplexes formed by folding of the human telomeric sequence d(GGGTTAGGGTTAGGGTTAGGG), in presence of K+ cations, noted Tel21/K+. Fluorescence decays and fluorescence anisotropy decays, obtained upon excitation at 267 nm, are probed from femtosecond to nanosecond domains using two different detection techniques, fluorescence upconversion and time‐correlated single photon counting. The results are discussed in light of recent theoretical studies. It is shown that efficient energy transfer takes place among the bases on the femtosecond time scale, possible only via exciton states. The major part of the fluorescence originates from bright excited states having weak charge transfer character and decaying between 1 and 100 ps. Charge transfer states involving guanines in different tetrads decay mainly after 100 ps and emit at the red wing of the spectrum. The persistence of electronic excitations in Tel21/K+ is longer and the contribution of charge transfer states is more pronounced than what is observed for G‐quadruplexes formed by association of four d(TGGGT) strands and containing the same number of tetrads. This difference is due to the increased structural rigidity of monomolecular structures which reduces nonradiative deactivation pathways and favors collective effects. 相似文献
16.
Dr. Hua‐Wei Jiang Sujin Ham Dr. Naoki Aratani Prof. Dr. Dongho Kim Prof. Dr. Atsuhiro Osuka 《Chemistry (Weinheim an der Bergstrasse, Germany)》2013,19(40):13328-13336
A 1,3‐phenylene‐bridged hexameric ZnII porphyrin wheel was synthesized by a Suzuki–Miyaura coupling reaction through a one‐pot or a stepwise route. The hexameric wheel structure was revealed by using X‐ray diffraction analysis. The porphyrin wheel exhibits a split Soret band due to effective exciton coupling and displays efficient excitation energy transfer along the wheel. Measurements of fluorescence anisotropy decay and pump‐power‐dependent decay reveal a rapid excitation energy hopping along the wheel with a rate of 1.4 ps. 相似文献
17.
The chemical species of silica in NaCl solutions of different concentrations were identified by FAB-MS (fast atom bombardment mass spectrometry). The basic structures of silica species, such as cyclic pentamer (Si5¶(OH)9O6 –), linear pentamer (Si5(OH)11O5 –), cyclic hexamer (Si6(OH)9O8 –, Si6(OH)11O7 –) and linear hexamer (Si6(OH)14O6 –), were identified, in addition to dimer (Si2(OH)5O2 –), trimer (Si3(OH)7O3 –) and cyclic tetramer (Si4(OH)7O5 –). The patterns of changes of the peak intensities of the silicate complexes relative to the dimer with increasing NaCl concentration were classified into two types: that represented by linear silicate complexes and the other by cyclic silicate complexes. The differences in the type of chemical species and their changes according to the NaCl concentration reflect the number of bonds necessary for polymerization and hydrolysis of the silica complexes. The differences between the linear and the cyclic silicate type have some implications on the dissolution mechanism of silicate complexes, the hydration of the molecules and the equilibrium between solubility, hydrolysis, polymerization and the salting-out effect in NaCl solution. 相似文献
18.
Polarized reflection spectra of the first singlet transition of the α-crystalline form of 9,10-dichloroanthracene are reported. Crystal faces (001), (011) and (010) were examined in spectral range 450 to 350 nm at two temperatures, 5 K and 300 K. Two systems of transitions were observed. The first system is assigned to neutral excitons. Spectral similarities with unsubstituted anthracene and arguments based on the one-dimensional stacking of molecules are used to construct a model of the exciten band structures. The M-polarized ππ* molecular transition gives rise to a four branch band with two allowed transitions. The 0-0b (Ag → Au) transition lies 50–100 cm?1 above the bottom of the exciton band and the 0-0c′ (Ag → Bu) transition lies at the top of the band. In the reflection spectrum the Davydov splitting c′b for transverse excitons is 210 cm?1. The exciton band of the 00 molecular transition is not isolated but overlaps the two-particle manifold of the 0–1 vibronic transition. As a result of the 0–1c′ transition is unexpectedly strong in the spectra of the (010) face. The second system is polarized along the stack-axis a and starts 2500 cm?1 above the first system. It is tentatively assigned as |a(Ag → Bu) charge transfer exciton transition in agreement with earlier observations. 相似文献
19.
Dr. Egmont J. Rohwer Prof. Yan Geng Dr. Maryam Akbarimoosavi Dr. Latévi M. Lawson Daku Dr. Olivier Aleveque Dr. Eric Levillain Dr. Jürg Hauser Prof. Andrea Cannizzo Prof. Robert Häner Prof. Silvio Decurtins Prof. Robert J. Stanley Prof. Thomas Feurer Priv.-Doz. Dr. Shi-Xia Liu 《Chemistry (Weinheim an der Bergstrasse, Germany)》2021,27(17):5399-5403
Ultrafast optical control of intramolecular charge flow was demonstrated, which paves the way for photocurrent modulation and switching with a highly wavelength-selective ON/OFF ratio. The system that was explored is a fac-[Re(CO)3(TTF-DPPZ)Cl] complex, where TTF-DPPZ=4’,5’-bis(propylthio)tetrathiafulvenyl[i]dipyrido[3,2-a:2’,3’-c]phenazine. DFT calculations and AC-Stark spectroscopy confirmed the presence of two distinct optically active charge-transfer processes, namely a metal-to-ligand charge transfer (MLCT) and an intra-ligand charge transfer (ILCT). Ultrafast transient absorption measurements showed that the ILCT state decays in the ps regime. Upon excitation to the MLCT state, only a long-lived 3MLCT state was observed after 80 ps. Remarkably, however, the bleaching of the ILCT absorption band remained as a result of the effective inhibition of the HOMO–LUMO transition. 相似文献
20.
Sandra Turconi Gerd Schweitzer Alfred R. Holzwarth 《Photochemistry and photobiology》1993,57(1):113-119
Picosecond time-resolved fluorescence of photosystem I particles isolated from Synechococcus sp. was recorded in the wavelength range from 680 nm to 736 nm for temperatures of 6°C to 42°C and - 100°C using the single-photon-timing technique. By global analysis of the data we found four contributing lifetime components at the higher temperatures (T1 ' 12 ps, T1= 35 ps, T3 ' 65 ps, T4 ' 1000 ps). We attribute T1 to an energy transfer between two pigment pools, T2 to the charge separation process in the reaction center, component T3 is assigned to aggregate and T4 to uncoupled chlorophyll emission. The corresponding decay-associated spectra are presented. We also applied a target analysis procedure to fit parameters of a kinetic model directly to the data. The resulting rate constants and species-associated spectra are discussed. The data indicate substantial spectral heterogeneity in the antenna with at least three substantially different chlorophyll pools. The overall exciton decay kinetics (by charge separation) is trap-limited. 相似文献