Role of hydrogen migration in the mechanism of acetic acid elimination from MH(+) ions of acetates on chemical ionization and collision-induced dissociation

The elimination of acetic acid from the MH(+) ions of acetates of stereoisomeric 2-methyl-1-cyclohexanols and 1-hydroxy-trans-decalins exhibits a significant degree of stereospecificity under isobutane chemical ionization and collision-induced dissociation (CID) conditions, resulting in more abundant [MH - AcOH](+) ions in the cis-isomers 4c and 5tc than in their trans-counterparts 4t and 5tt. These findings suggest the involvement of a 1,2-hydride shift from the beta- to the alpha-position in the course of the acetic acid elimination from the MH(+) ions of the above cis-acetates, resulting in tertiary carbocation structures. The proposed mechanism of the elimination is supported by a considerable deuterium isotope effect detected in beta-deuterium-labeled cis-2-methyl-1-acetoxycyclohexane and by a CID study of the structures of the [MH - AcOH](+) ions obtained from cis- and trans-1,2-diacetoxycyclohexanes. Copyright 1999 John Wiley & Sons, Ltd.     

Ion-molecule reactions of 2-methoxyethanol with some amines, carboxylic acids and amino acids under chemical ionization conditions

2-Methoxyethanol chemical ionization of amines, carboxylic acids and amino acids has been found to produce numerous adduct ions. The most intense adduct ions for amines are [M + H](+) and [M + 77](+), for carboxylic acids [M + 27](+), [M + 59](+) and [M + 77](+), and for amino acids [M + H](+), [M + 13](+), [M + 27](+) and [M + 77](+). Either the adduct ion [M + H](+) or [M + 77](+) was the most abundant ion found for amino acids. The proton affinities of amino acids are noticed to control the formation of the [M + H](+) and [M + 77](+) ions. The relative abundance of [M + 13](+) and [M + 27](+) ions varied for different amino acids being most intense for phenylalanine and aspartic acid. Copyright 1999 John Wiley & Sons, Ltd.     

TOF-SIMS study of cystine and cholesterol stones

Two different human stones, cystine and cholesterol from the kidney and gall bladder, were examined by time-of-flight secondary ion mass spectrometry using Ga(+) primary ions as bombarding particles. The mass spectra of kidney stone were compared with those measured for the standard compounds, cystine and cysteine. Similar spectra were obtained for the stone and cystine. The most important identification was based on the existence of the protonated molecules [M + H](+) and deprotonated molecules [M-H](-). The presence of cystine salt was also revealed in the stone through the sodiated cystine [M + Na](+) and the associated fragments, which might be due to the patient treatment history. In the gallstone, the deprotonated molecules [M-H](+) of cholesterol along with relatively intense characteristic fragments [M-OH](+) were detected.     

Electrospray ionization multiple-stage tandem mass spectrometric analysis of diglycosyldiacylglycerol glycolipids from the bacteria Bacillus pumilus

Electrospray ionization (ESI) combined with multiple-stage tandem mass spectrometry (MS(n)) was used to directly analyze the glycolipid mixture from bacteria Bacillus pumilus without preliminary separation. Full scan ESI-MS revealed the composition of picomole quantities of glycerolglycolipid species containing C(14)-C(19) fatty acids, some of which were monounsaturated. Two main components were identified from their molecular masses and fragmentation pathways. The fragmentation pathway of the known compound compared with the investigated compound verified the proposed structure as 1(3)-acyl-2-pentadecanoyl-3(1)-O-[beta-D-glucopyranosyl-(1-->6)-O-beta-D-glucopyranosyl]-sn-glycerols. A comparison of the multiple tandem mass spectra of the different alkali-metal cation adducts indicates that the intensity of fragments and the dissociation pathways are dependent on the alkali-metal type. The basic structures of glycerolglycolipids were reflected clearly from the fragmentation patterns of the sodium cations. The intense fragments of the sugar residue from the precursor ions were obtained from the lithiated adduct ions. ESI-MS(n) spectra of [M + K](+) ions did not provide as much fragmentation as [M + Na](+) and [M + Li](+) adducts, but their spectra allow the position of glycerol acylation to be determined. On the basis of MS(2) spectra of [M + K](+) ions, it was established that all components have a C(15:0) fatty acid at the sn-2 position of the glycerol backbone and C(14)-C(19) acids at the sn-1 position of the glycerol backbone. Copyright 1999 John Wiley & Sons, Ltd.     

Comparison of CID, ETD and metastable atom-activated dissociation (MAD) of doubly and triply charged phosphorylated tau peptides

The fragmentation behavior of the 2+ and 3+ charge states of eleven different phosphorylated tau peptides was studied using collision-induced dissociation (CID), electron transfer dissociation (ETD) and metastable atom-activated dissociation (MAD). The synthetic peptides studied contain up to two known phosphorylation sites on serine or threonine residues, at least two basic residues, and between four and eight potential sites of phosphorylation. CID produced mainly b-/y-type ions with abundant neutral losses of the phosphorylation modification. ETD produced c-/z-type ions in highest abundance but also showed numerous y-type ions at a frequency about 50% that of the z-type ions. The major peaks observed in the ETD spectra correspond to the charge-reduced product ions and small neutral losses from the charge-reduced peaks. ETD of the 2+ charge state of each peptide generally produced fewer backbone cleavages than the 3+ charge state, consistent with previous reports. Regardless of charge state, MAD achieved more extensive backbone cleavage than CID or ETD, while retaining the modification(s) in most cases. In all but one case, unambiguous modification site determination was achieved with MAD. MAD produced 15-20% better sequence coverage than CID and ETD for both the 2+ and 3+ charge states and very different fragmentation products indicating that the mechanism of fragmentation in MAD is unique and complementary to CID and ETD.     

Elaborating the excited state behavior of 2‐(4′‐N,N‐dimethylaminophenyl)‐imidazo[4,5‐c]pyridine coupling with methanol solvent

We present a theoretical investigation about the excited state dynamical mechanism of 2‐(4′‐N,N‐dimethylaminophenyl)‐imidazo[4,5‐c]pyridine (DMAPIP‐c). Within the framework of density functional theory and time‐dependent density functional theory methods, we reasonably repeat the experimental electronic spectra, which further confirm the theoretical level used in this work is feasible. Given the best complex model, 3 methanol (MeOH) solvent molecules should be connected with DMAPIP‐c forming DMAPIP‐c‐MeOH complex in both ground state and excited state. Exploring the changes about bond lengths and bond angles involved in hydrogen bond wires, we find the O7‐H8···N9 one should be largely strengthened in the S₁ state, which plays an important role in facilitating the excited state intermolecular proton transfer (ESIPT) process. In addition, the analyses about infrared vibrational spectra also confirm this conclusion. The redistribution about charges distinguished via frontier molecular orbitals based on the photoexcitation, we do find tendency of ESIPT reaction due to the most charges located around N9 atom in the lowest unoccupied molecular orbital. Based on constructing the potential energy curves of both S₀ and S₁ states, we not only confirm that the ESIPT process should firstly occur along with hydrogen bond wire O7‐H8···N9, but also find a low potential energy barrier 8.898 kcal/mol supports the ESIPT reaction in the S₁ state forming DMAPIP‐c‐MeOH‐PT configuration. Subsequently, DMAPIP‐c‐MeOH‐PT could twist its dimethylamino moiety with a lower barrier 3.475 kcal/mol forming DMAPIP‐c‐MeOH‐PT‐TICT structure. Our work not only successfully explains previous experimental work but also paves the way for the further applications about DMAPIP‐c sensor in future.     

High-resolution mass spectrometry and hydrogen/deuterium exchange study of mitorubrin azaphilones and nitrogenized analogues

Azaphilones represent numerous groups of wild fungal secondary metabolites that exhibit exceptional tendency to bind to nitrogen atoms in various molecules, especially those containing the amine group. Nitrogenized analogues of mitorubrin azaphilones, natural secondary metabolites of Hypoxylon fragiforme fungus, have been detected in the fungal methanol extract in very low concentrations. Positive electrospray ionization interfaced with high-resolution mass spectrometry was applied for confirmation of the elemental composition of protonated species. Collision-induced dissociation (CID) experiments have been performed, and fragmentation mechanisms have been proposed. Additional information regarding both secondary metabolite analogue families has been reached by application of gas-phase proton/deuterium (H/D) exchanges performed in the collision cell of a triple quadrupole mass spectrometer. An incomplete H/D exchange with one proton less than expected was observed for both protonated mitorubrin azaphilones and their nitrogenized analogues. By means of the density functional theory, an appropriate explanation of this behavior was provided, and it revealed some information concerning gas-phase H/D exchange mechanism and protonation sites. Copyright ? 2012 John Wiley & Sons, Ltd.     

Analysis of cyclic boronated and trimethylsilylated phenolalkylamines by gas chromatography and electron impact mass spectrometry

The side chain of phenolalkylamines containing a bifunctional group was derivatized as the cyclic boronate, and then the residual phenolic group was trimethylsilylated. The resulting derivatives were single reaction products in each case, with good gas chromatographic properties and informative mass spectra to afford prominent molecular ions by gas chromatography with electron impact mass spectrometry (GC/EI-MS). The cyclic boronated-trimethylsilylated derivatives yielded the isotope pattern for boron ((10)B:(11)B =-1:4.2) and characteristic ions [M](+), [M - H](+), [M - CH(3)](+), [M - RBO](+), [M - TMSO](+), and [M - TMSO - C(6)H(5)](+) ions in the mass spectra. In order to distinguish between m- and p-phenolalkylamines, the mass spectra of the cyclic phenylboronated-trimethylsilylated (PBA-TMS) derivatives were compared with those of the trimethylsilylated (TMS) derivatives. The TMS derivatives of octopamine (p-) and norfenefrine (m-) showed identical mass spectra, while the PBA-TMS derivatives had mass spectra sufficiently different from one other to distinguish between the isomers. The most prominent ion of the PBA-TMS derivative is the [M - H](+) ion (m/z 310) for octopamine and the [M](+) ion (m/z 311) for norfenefrine. Copyright 1999 John Wiley & Sons, Ltd.     

Substituent effects on the gas-phase fragmentation reactions of protonated peptides containing benzylamine-derivatized lysyl residues

Motivated by the need for chemical strategies designed to tune peptide fragmentation to selective cleavage reactions, benzyl ring substituent influence on the relative formation of carbocation elimination (CCE) products from peptides with benzylamine-derivatized lysyl residues has been examined using collision-induced dissociation (CID) tandem mass spectrometry. Unsubstituted benzylamine-derivatized peptides yield a mixture of products derived from amide backbone cleavage and CCE. The latter involves side-chain cleavage of the derivatized lysyl residue to form a benzylic carbocation [C(7)H(7)](+) and an intact peptide product ion [(MH(n))(n+) - (C(7)H(7))(+)]((n-1)+). The CCE pathway is contingent upon protonation of the secondary ε-amino group (N(ε)) of the derivatized lysyl residue. Using the Hammett methodology to evaluate the electronic contributions of benzyl ring substituents on chemical reactivity, a direct correlation was observed between changes in the CCE product ion intensity ratios (relative to backbone fragmentation) and the Hammett substituent constants, σ, of the corresponding substituents. There was no correlation between the substituent-influenced gas-phase proton affinity of N(ε) and the relative ratios of CCE product ions. However, a strong correlation was observed between the π orbital interaction energies (ΔE(int)) of the eliminated benzylic carbocation and the logarithm of the relative ratios, indicating the predominant factor in the CCE pathway is the substituent effect on the level of hyperconjugation and resonance stability of the eliminated benzylic carbocation. This work effectively demonstrates the applicability of σ (and ΔE(int)) as substituent selection parameters for the design of benzyl-based peptide-reactive reagents which tune CCE product formation as desired for specific applications.     

Structurally homogeneous and heterogeneous synthetic combinatorial libraries

Summary We have designed and synthesized structurally homogeneous and heterogeneous nonpeptide libraries. Structurally homogeneous libraries are characterized by the presence of one common structural unit, a scaffold, in all library compounds (e.g. cyclopentane, cyclohexane, diketopiperazine, thiazolidine). In structurally heterogeneous libraries different organic reactions (acylation, etherification, reductive amination, nucleophilic displacement) were applied to connect bifunctional building blocks unrelated in structure (aromatic hydroxy acids, aromatic hydroxy aldehydes, amino alcohols, diamines, and amino acids). The focus of this communication is to document the use of bifunctional building blocks for the design and synthesis of structurally heterogeneous libraries ofN-(alkoxy acyl)amino acids, N,N-bis-(alkoxy acyl)diamino acids,N-acylamino ethers,N-(alkoxy acyl)amino alcohols,N-alkylamino ethers, andN-(alkoxy aryl)diamines.Abbreviations AcOH acetic acid - DCE dichloroethane - DCM dichloromethane - DEAD diethyl azodicarboxylate - DIAD diisopropyl azodicarboxylate - DIC diisopropyl carbodiimide - DIEA diisopropylethylamine - DMAP dimethylaminopyridine - DMF dimethylformamide - Fmoc fluorenylmethyloxycarbonyl - HOBt N-hydroxybenzotriazole - MeCN acetonitrile - MeOH methanol - NaOH sodium hydroxide - PEG/PS polyethylene-grafted copolystyrene - PPh₃ triphenylphosphine - t-Bu tert- butyl - TFA trifluoroacetic acid - TG TentaGel - THE tetrahydrofuran     

Ion/molecule reactions provide new evidence for the structure and origin of

Ion/molecule reactions leading to formation of the diagnostically useful [C(3)H(4)N](+) ion (m/z 54), from acetonitrile CI plasma, have been studied using a tandem quadrupole mass spectrometer. Evidence is presented to demonstrate that [C(3)H(4)N](+) is produced from an ion/molecule reaction between [C(2)H(2)N](+) (m/z 40) and neutral acetonitrile, via a [C(4)H(5)N(2)](+) (m/z 81) intermediate. Loss of HCN, where the H atom arises from neutral acetonitrile and the CN group from [C(2)H(2)N](+) (m/z 40), leads to the production of [C(3)H(4)N](+) (m/z 54). These results are consistent with a proposed concerted elimination of HCN, generating m/z 54 as a methylene vinylidene ammonium ion. Copyright 1999 John Wiley & Sons, Ltd.     

Gas-phase deprotonation of arylalkylamines. A collision-induced dissociation study

The collision-induced dissociation (CID) of deprotonated arylalkylamines of general formula R(1)C(6)H(4)CHR(2)CH(2)NR(3)(2) (where R(1) = H, OH, F or NO(2); R(2) = H or OH; R(3) = H or CH(3)) generated by negative chemical ionization with H(2)O and D(2)O as ionizing reagents, is discussed. The negative chemical ionization mass spectra show that, in the absence of a hydroxy group in the aromatic ring, deprotonation takes place at the benzylic position whereas the proton is lost from the OH group when present. The nitro compound forms only M(-.) ions. The CID spectra of the deprotonated molecules show that fragmentations are strongly dependent on the structural features of the molecules, namely the presence or absence of substituents in the aromatic ring or aliphatic chain. Copyright 1999 John Wiley & Sons, Ltd.     

1H NMR Studies on the Methylation,Protonation, and Hydration Sites in Some Benzo[b]Naphthyridines (Azaacridines)

Abstract

The 300.13 MHz ¹H NMR spectra of the methylated and protonated 6(9)-methylbenzo[b][1,x] naphthyridines (x=5, 6, 7, 8) (5-methylazaacridines) were collected at 298 K in deuterated dimethyl sulfoxide and chloroform, respectively. The methylation and protonation sites were assigned by comparisons of these data with those of the free bases. The results were compared with similar data for related heterocycles and showed that both methylation and protonation occur at the nitrogen in the outer pyrido ring in all four series.

The hydration site in some 2-and 3-azaacridines was determined by specific line broadening in their ¹H NMR spectra to be the same nitrogen as that involved in methylation and protonation. Variable temperature ¹H NMR demonstrated that the specific line broadening results from some changes of ¹⁴N quadrupolar relaxation produced by the slow chemical exchange between unhydrated and hydrated species. Deuterium exchange experiments indicated that the direct spin-spin interaction of a water proton and the protons alpha to the hydrated nitrogen may also have some contribution.     

Application of Parahydrogen-Induced Polarization to Unprotected Dehydroamino Carboxylic Acids

One focus of current nuclear magnetic resonance (NMR) and magnetic resonance imaging (MRI) investigation is the hyperpolarization of biologically relevant substrates. In this study, the application of parahydrogen-induced polarization (PHIP) to amino carboxylic acids was enabled by protonation of the amino group as well as of the carboxylic acid. Due to the donor character of these functional groups, they usually act as ligands at the active catalytic sites. To enable parahydrogenation, blocking of the catalytic sites by the functional groups has to be avoided. In a new approach, this was realized via protonation of the starting material. For the first time PHIP spectra of allylglycine, vigabatrin and γ-amino-butyric acid (GABA) were generated. The feasibility of the hydrogenation of amino carboxylic acids without using a protection group supersedes the deprotection reaction usually required. Hence, hydrogenation after protonation of the substrate opens the class of free dehydroamino carboxylic acids to PHIP.     

Theoretical investigation of fluorescence changes caused bymethanol bridge based on ESIPT reaction

The different fluorescence behavior caused by the excited state proton transfer in 3-hydroxy-4-pyridylisoquinoline (2a) compound has been theoretically investigated. Our calculation results illustrate that the 2a monomer in tetrahydrofuran solvent would not occur proton transfer spontaneously, while the 2a complex in methanol (MeOH) solvent can undergo an asynchronous excited state intramolecular proton transfer (ESIPT) process. The result was confirmed by analyzing the related structural parameters, infrared vibration spectrum and reduced density gradient isosurfaces. Moreover, the potential curves revealed that with the bridging of single MeOH molecular the energy barrier of ESIPT was modulated effectively. It was distinctly reduced to 4.80 kcal/mol in 2a-MeOH complex from 25.01 kcal/mol in 2a monomer. Accordingly, the ESIPT process induced a fluorochromic phenomenon with the assistant of proton-bridge. The elucidation of the mechanism of solvent discoloration will contribute to the design and synthesis of fluorogenic dyes as environment-sensitive probes.     

14N NMR relaxation times of several protein amino acids in aqueous solution--comparison with 17O NMR data and estimation of the relative hydration numbers in the cationic and zwitterionic forms

The 14N nuclear magnetic resonance (NMR) linewidths of the alpha-amino groups of several protein amino acids were measured in aqueous solution, with and without composite proton decoupling, to estimate the effect of proton exchange and molecular weight on the linewidths. It is shown that, contrary to earlier claims, the increase in the linewidth at low pH is not exclusively due to the effect of proton exchange broadening. The 14N linewidths, under composite proton decoupling, increase with the bulk of the amino acid, and increase at low pH. Statistical treatment of the experimental 14N and literature 17O NMR data was performed assuming two models: (i) an isotropic molecular reorientation of a rigid sphere in a medium of viscosity eta, (ii) a stochastic diffusion of the amino and carboxyl groups comprising contributions from internal (tauint) and overall (taumol) motions. Assuming a single correlation time from overall molecular reorientation (taumol), then, a linear correlation was found between the linewidths and the molecular weights of the protein amino acids at the pH values 0.5 and 6.0, which are characteristic of the cationic and zwitterionic forms, respectively. The slopes of the straight-lines were found to be dependent of pH for 14N, contrary to the 17O linear correlations whose slopes were found to be independent of pH. Assuming effective correlation times of the amino and carboxyl groups, which comprise contributions from the internal (tauint) and overall (taumol) motions, then, a significant improvement of the statistics of the regression analysis was observed. The 14N relaxation data, in conjunction with 17O NMR linewidths, can be interpreted by assuming that the 14N quadrupole coupling constants (NQCCs) are influenced by the protonation state of the carboxyl group, the 17O NQCCs remain constant, and the cationic form of the amino acids is hydrated by an excess of 1-3 molecules of water relative to the zwitterionic state.     

The influence of divalent metal ions on low pH induced LacDNA structural changes as probed with UV resonance Raman spectroscopy

UV (275 nm) resonance Raman spectra of LacDNA 22‐mer duplex [d(TAATGTGAGTTAGCTCACTCAT) · d(ATGAGTGAGCTAACTCACATTA)], which contain protein binding sites within the E. coli lac promoter, were measured at two pH values (6.4 and 3.45) in the absence and presence of Mn²⁺ and Ca²⁺ metal ions, respectively. Also, the UV (275 nm) resonance Raman markers of the corresponding oligonucleotide d(TAATGTGAGTTAGCTCACTCAT) and of its complementary anti‐sense strand d(ATGAGTGAGCTAACTCACATTA) were established and tentatively assigned. Large changes in the UV (275 nm) resonance Raman spectra of LacDNA duplex were observed at pH 3.45 as compared with the corresponding spectrum at pH 6.4, in the absence of divalent metal ions and at low concentrations of Ca²⁺ ions, respectively. Major changes comprise: adenine protonation, GC base pair protonation, DNA bases unstacking and changes in the hydrogen bonding strength between the strands of different LacDNA complexes, respectively. Divalent metal ions (Mn²⁺ and Ca²⁺) were found to inhibit LacDNA protonation even at low concentrations. Manganese(II) ions are much more effective in this regard, as compared with calcium(II) ions. Binding of Mn²⁺ ions to N7 of guanine and, possibly, in a lesser extent to adenine was observed as judging from the difference Raman bands at 1315, 1354 and 1493 cm⁻¹. Copyright © 2013 John Wiley & Sons, Ltd.     

Fragmentation Study of Globularin Through Positive and Negative ESI/MS,CID/MS,and Tandem MS/MS

Abstract

The structure of globularin was studied by a mass spectrometric methodology based on the combined use of positive and negative electrospray ionization, collision‐induced dissociation (CID), and tandem mass spectrometry. The mass spectrometry investigation was achieved through in‐source fragmentation of the deprotonated [M?H]^?, protonated [M+H]⁺, lithiated [M+Li]⁺, sodiated [M+Na]⁺, and potassium‐cationized [M+K]⁺ ions. This allowed collision‐induced dissociation spectra of the ionized molecular ions to be obtained to give valuable structural information regarding the nature of both the glycoside and the aglycone moieties and the effect of metal cationization on the CID spectra. Glycosidic fission and ring cleavages of both aglycone and sugar moieties were the major fragmentation pathways observed during collision‐induced dissociation, where the losses of small molecules, the cinnamoyl and the cinnamate parts were also observed. Alkali metal cationization offers additional fragmentation pathways involving cross rings cleavage under CID conditions. Unlike the dissociation of protonated molecular ions, that of metal‐cationized molecules also provides sugar fragments where the C₀ ⁺ fragment corresponding with the glucose ion was obtained as a major daughter peak for all the studied compounds. Even with low abundance, fragment ions coordinated to K⁺ were also observed from [M+K]⁺.     

A solid-state 14N magic-angle spinning NMR study of some amino acids

Experimental strategies for the acquisition of high-quality 14N magic-angle spinning (MAS) NMR spectra of the simple amino acids, which exhibit 14N quadrupole coupling constants (C(Q)) on the order of 1.2 MHz, are devised. These are the first useful 14N MAS spectra reported for nitrogen compounds having a C(Q)(14N) value in excess of 1 MHz. The complete manifolds of spinning sidebands (ssbs), i.e., about 300 ssbs for a spinning frequency of 6.0 kHz, have been observed in the 14N MAS NMR spectra of a series of amino acids. In their crystal structure these amino acids all exhibit the zwitterionic form and thus the 14N MAS NMR spectra represent those of a rotating -NH(3)(+) group and not of an amino (-NH(2)) group. Computer simulations combined with fitting of simulated to the experimental ssb intensities result in the determination of precise values for the 14N quadrupole coupling (C(Q)) and its associated asymmetry parameter (eta(Q)) for the nitrogen sites in these molecules. For some of the amino acids the 14N MAS NMR spectra exhibit overlap between the manifolds of ssbs from two different nitrogen sites in accordance with their crystal structures. Computer analysis of these spectra results in two different sets of (C(Q), eta(Q)) values which mainly differ in the magnitudes for eta(Q).     

A solid-state N magic-angle spinning NMR study of some amino acids

Experimental strategies for the acquisition of high-quality 14N magic-angle spinning (MAS) NMR spectra of the simple amino acids, which exhibit 14N quadrupole coupling constants (C(Q)) on the order of 1.2 MHz, are devised. These are the first useful 14N MAS spectra reported for nitrogen compounds having a C(Q)(14N) value in excess of 1 MHz. The complete manifolds of spinning sidebands (ssbs), i.e., about 300 ssbs for a spinning frequency of 6.0 kHz, have been observed in the 14N MAS NMR spectra of a series of amino acids. In their crystal structure these amino acids all exhibit the zwitterionic form and thus the 14N MAS NMR spectra represent those of a rotating -NH(3)(+) group and not of an amino (-NH(2)) group. Computer simulations combined with fitting of simulated to the experimental ssb intensities result in the determination of precise values for the 14N quadrupole coupling (C(Q)) and its associated asymmetry parameter (eta(Q)) for the nitrogen sites in these molecules. For some of the amino acids the 14N MAS NMR spectra exhibit overlap between the manifolds of ssbs from two different nitrogen sites in accordance with their crystal structures. Computer analysis of these spectra results in two different sets of (C(Q), eta(Q)) values which mainly differ in the magnitudes for eta(Q).