What can polymer crystal structure tell about polymer crystallization processes?

Contrary to most or all other materials, crystallization of chiral but racemic polymers such as isotactic polypropylene is accompanied by a conformational rearrangement which leads to helical geometries: the building units of the crystal are helical stems, -20nm long, which can be either right-handed or left-handed. Helical hand cannot be reversed within the crystal structure: it is therefore a permanent marker and an indicator of molecular processes (in particular segregation/selection of helical hands) which take place during crystal growth, and more precisely during the crucial step of “efficient” helical stem deposition. The issue of proper helical hand selection during polymer crystal growth is mainly illustrated with isotactic polypropylene. Its various crystalline polymorphs (, , and smectic) display virtually all possible combinations of helical hands, azimuthal settings and even non-parallel orientation of helix axes in space. Furthermore, a specific homoepitaxy which generates a lamellar branching in the phase “quadrites” and composite structures makes it possible a) to determine the helical hand and associated azimuthal setting of every stem in the crystalline entities and b) to determine the impact on the crystal structure and morphology of “mistakes” in helical hand of the depositing stem. Analysis of these morphologies demonstrates that the crystallization of isotactic polypropylene (and by implication of other achiral, helical polymers) is a highly sequential and “substrate-determined” process, i.e. that the depositing stem probes the topography of the growth face prior to attachment. These observations appear difficult to reconcile with crystallization schemes in which molecules (helical segments) are prearranged in a kind of pseudo-crystalline bundle (and as such, are not subjected to the high constraints of crystal symmetry) before deposition as a preassembled entity on the substrate. Received: 5 May 2000     

Preparation of titania hollow spheres by catalyst-free hydrothermal method and their high thermal stabilities

TiO₂ hollow spheres have been prepared by hydrothermal method using carbon spheres as hard templates based on template-directed deposition and calcination in order to remove templates. The morphology and structure of samples were systematically characterized by using various techniques, including XRD, zeta analyzer, SEM, TEM, DRS and FTIR. In this approach, the anatase phase was retained for temperatures up to 900 °C. Moreover, negative charged titania is deposited onto the negative charged surface of carbon spheres, which is proved by nanoparticle size analyzer. Therefore, a possible formation mechanism of TiO₂ hollow spheres was proposed. TiO₂ hollow spheres calcined at 550 °C exhibited the superior photocatalytic activity for the degradation of Rhodamine B, 2.9 times greater than that of Degussa P25. Furthermore, thermal stability of TiO₂ hollow spheres was examined. Fortunately, we found that hollow structures could still be visible distinctly after calcining at 900 °C.     

A new study of associating inhomogeneous fluids with classical density functional theory

ABSTRACT

A new density functional for the study of associating inhomogeneous fluids based on Wertheim's first-order thermodynamic perturbation theory is presented and compared to the most currently used associating density functionals. This functional is developed using the weighted density approximation in the range of association of hard spheres. We implement this functional within the framework of classical density functional theory together with modified fundamental measure theory to account for volume exclusion of hard spheres. This approach is tested against molecular simulations from literature of pure associating hard spheres and mixtures of non-associationg and associating hard spheres with different number of bonding sites close to a hard uniform wall. Furthermore, we compare and review our results with the performance of associating functionals from literature, one based on fundamental measure theory and the inhomogeneous version of Wertheim's perturbation theory. Results obtained with classical DFT and the three functionals show excellent agreement with molecular simulations in systems with one hard wall. For the cases of small pores where only one or two layers of fluid are allowed discrepancies between results with classical DFT and molecular simulations were found.     

Self-assembly of particles for densest packing by mechanical vibration

It is shown that by properly controlling vibrational and charging conditions, the transition from disordered to ordered, densest packing of particles can be obtained consistently. The method applies to both spherical and nonspherical particles. For spheres, face centered cubic packing with different orientations can be achieved by monitoring the vibration amplitude and frequency, and the structure of the bottom layer, in particular. The resultant force structures are ordered but do not necessarily correspond to the packing structures fully. The implications of the findings are also discussed.     

Entropically driven colloidal crystallization on patterned surfaces

We investigate the self-assembly of colloidal spheres on periodically patterned templates. The surface potentials and the surface phases are induced entropically by the presence of dissolved, nonadsorbing polymers. A rich variety of two-dimensional fluidlike and solidlike phases was observed to form on template potentials with both one- and two-dimensional symmetry. The same methodology was then used to nucleate an oriented single fcc crystal more than 30 layers thick. The general approach provides a new route for directed self-assembly of novel mesoscopic structures.     

Correlation Between Structural and Dynamic‐Mechanical Transitions of Different Syndiotactic Polypropylene Polymorphs

Abstract

We prepared several well‐characterized syndiotactic polypropylene (sPP) polymorphs so as to correlate their thermal and dynamic‐mechanical behaviors. A sample was crystallized in pure form I at 100°C; a second sample containing only the trans‐planar mesophase was prepared by directly drawing a quenched sample at 0°C; a third sample, drawn at room temperature, contained both the trans‐planar mesophase and a fraction of the helical form II. By annealing this sample at increasing temperatures, we obtained a series of samples containing either trans‐planar mesophase, or form II and form I crystallinities.

In the dynamic‐mechanical analysis, the sample containing form I crystallinity showed only the amorphous glass transition, at 19°C, before melting at a high temperature. The trans‐planar mesophase transformed, at temperatures higher than 50°C, into the helical forms, and this transition was completed at 80°C. The dynamic mechanical curve of the sample containing only the mesophase showed a peak, centered at 50°C, which could be clearly associated to this transition. The sample containing the trans‐planar mesophase and the helical form II, showed in the dynamic‐mechanical curve a third peak that can be associated with the melting recrystallization of form II into the most stable form I. These results are important, because it was possible to directly correlate the structural transitions of the sPP polymorphs to the dynamic‐mechanical behavior. Moreover, a dynamic‐mechanical analysis could help recognize the presence of the trans‐planar mesophase or of the helical form II in more complex structural organizations.     

Phyllotactic description of hard sphere packing in cylindrical channels

We develop a simple analytical theory that relates dense sphere packings in a cylinder to corresponding disk packings on its surface. It applies for ratios R=D/d (where d and D are the diameters of the hard spheres and the bounding cylinder, respectively) up to R=1+1/sin(π/5). Within this range the densest packings are such that all spheres are in contact with the cylindrical boundary. The detailed results elucidate extensive numerical simulations by ourselves and others by identifying the nature of various competing phases.     

Analysis of G‐quadruplex conformations using Raman and polarized Raman spectroscopy

G‐quadruplexes (G4s) are four‐stranded DNA structures formed within nucleic acid sequences that are rich in guanines. G4 formation within DNA strands is believed to have significant biological relevance for the control of cell replication and gene expression. Therefore, the development and validation of experimental techniques that can easily and reliably characterize G4 structures under biologically relevant measurement conditions, like Raman spectroscopy, are desirable for G4‐targeted structure based drug design. Here we report Raman and polarized Raman studies of solutions of three oligonucleotides, thrombin binding aptamer (TBA) 5′‐GGTTGGTGTGGTTGG‐3′, human telomeric (HT) 5′‐(TTAGGG)₄‐3′, and a modified c‐Myc NHE‐III₁ sequence (MycL1) 5′‐TGAGGGTGGGTAGGGTGGGTAA‐3′, which were previously reported to form four distinct intramolecular G4 structures in the presence of Na⁺ or K⁺, as determined by NMR. Our results support the previously proposed antiparallel (TBA), antiparallel and hybrid (HT), and parallel with double‐chain reversal (DCR) loop (MycL1) structures. Large sample‐dependent variations in the intensity of bands associated with deoxyribose backbone modes in the 840–930 cm⁻¹ and 1420–1460 cm⁻¹ spectral regions were observed. Most notably, a highly polarized deoxyribose ring symmetric stretch (~930 cm⁻¹) appeared strongly in the solution spectra for HT and TBA, but was very weak or absent in the solution spectrum for MycL1 and the drop deposition (dried sample) spectra for all three oligonucleotides. It is hypothesized that the intensity of this band is likely controlled by furanose ring structure uniformity and/or solvent accessibility to certain nucleotide binding sites. Raman depolarization ratios measured for the G4s in solution were generally very similar to those previously reported for canonical B DNA, with the possible exception of base ring modes that consistently yielded slightly lower depolarization ratios for G4s compared to B DNA. The results further underscore the utility of Raman and polarized Raman spectroscopy for G4 structure elucidation under biologically relevant solution conditions. Copyright © 2015 John Wiley & Sons, Ltd.     

Ground-state properties of tubelike flexible polymers

In this work we investigate the structural properties of native states of a simple model for short flexible homopolymers, where the steric influence of monomeric side chains is effectively introduced by a thickness constraint. This geometric constraint is implemented through the concept of the global radius of curvature and affects the conformational topology of ground-state structures. A systematic analysis allows for a thickness-dependent classification of the dominant ground-state topologies. It turns out that helical structures, strands, rings, and coils are natural, intrinsic geometries of such tubelike objects.     

Ordered macroporous gold thin film with encaptured polymer spheres

A two-dimensional colloidal crystal fabricated from core-shell polystyrene spheres was employed as a template for the electrochemical deposition of gold. By partially embedding the colloidal spheres into the gold film and selectively removing the shells of the colloidal spheres, highly ordered macroporous gold thin films with captured polystyrene spheres were obtained.     

Corrected Mean-Field Model for Random Sequential Adsorption on Random Geometric Graphs

A notorious problem in mathematics and physics is to create a solvable model for random sequential adsorption of non-overlapping congruent spheres in the d-dimensional Euclidean space with \(d\ge 2\). Spheres arrive sequentially at uniformly chosen locations in space and are accepted only when there is no overlap with previously deposited spheres. Due to spatial correlations, characterizing the fraction of accepted spheres remains largely intractable. We study this fraction by taking a novel approach that compares random sequential adsorption in Euclidean space to the nearest-neighbor blocking on a sequence of clustered random graphs. This random network model can be thought of as a corrected mean-field model for the interaction graph between the attempted spheres. Using functional limit theorems, we characterize the fraction of accepted spheres and its fluctuations.     

Nonaxisymmetric energy deposition pattern on ASDEX upgrade divertor target plates during type-I edge-localized modes

In the ASDEX Upgrade tokamak, complex power deposition structures on the divertor target plates during type-I edge-localized modes (ELMs) have been discovered by fast (few microseconds), two-dimensional (40 x 40 cm(2)) infrared thermography. In addition to the usual axisymmetric power deposition line near the separatrix, there appear, statistically distributed, several laterally displaced and inclined stripes, mostly well separated from each other and from the main strike zone. These structures are interpreted as footprints of approximately field aligned, helical perturbations at the low field side of the main plasma edge related to the nonlinear ELM evolution. Based on this picture, the ELM related mode structure can be derived from the target load pattern, yielding on average toroidal mode numbers in a range of 8-24.     

Chiral single-wall gold nanotubes

Based on first-principles calculations we show that gold atoms can form both freestanding and tip-suspended chiral single-wall nanotubes composed of helical atomic strands. The freestanding, infinite (5,5) tube is found to be energetically the most favorable. While energetically less favorable, the experimentally observed (5,3) tube stretching between two tips corresponds to a local minimum in the string tension. Similarly, the (4,3) tube is predicted as a favorable structure yet to be observed experimentally. Analysis of band structure, charge density, and quantum ballistic conductance suggests that the current on these wires is less chiral than expected, and there is no direct correlation between the numbers of conduction channels and helical strands.     

Helical magnetic structures in cubic perovskites

One-dimensional helical structures with a finite Hund interaction have been considered in detail. The analytical expressions for the electron spectrum of charge carriers in simplest one-dimensional and three-dimensional helical structures in a simple cubic lattice, which simulates the manganese sublattice in the crystal structure of perovskite, have been derived in the tight-binding approximation. It has been shown that this approach can explain qualitatively the formation of the antiferromagnetic A structure in LaMnO₃.     

Characterization of a ferromagnetic porous silicon-based Ni/Si nanocomposite with a novel strong high-field anisotropy

Ferromagnetic (Ni) filaments are embedded into a porous silicon template by an electrochemical deposition process. During cathodic deposition using NiCl₂ as electrolyte the channels of the meso-/macroporous silicon structure are filled with metallic Ni. The resulting nanocomposite system consists of silicon as base material as well as of implemented Ni-structures, especially of highly oriented Ni-wires perpendicular to the surface showing an exceptionally high aspect ratio (>300) and is of interest for applications in microtechnology. The length of the Ni-wires is in the range of a few tens of micrometers. Concomitant with the growth of wires, spheres or ellipsoidally shaped particles are formed during the Ni-filling procedure, whose spatial frequency and distribution become tunable. Structural investigations of this system, using SEM and EDX as well as investigations of the magnetic behaviour using SQUID-magnetometry, demonstrate the dependency of the magnetic properties on the filling status of the samples. The hysteresis loops in the low-field regime up to 500 Oe as well as magnetization curves in the high-field range of a few tesla display a strong magnetic anisotropy due to magnetic rearrangements. At fields around 5 T, a decline of the magnetization followed by a steep increase is observed. This magnetic field-induced anisotropy depends on the detailed growth of the Ni within the pores which can be controlled by the deposition process. It is governed by yet unknown antiferromagnetic exchange between the wires, and inherently connected with the shape of the magnetic nano-objects.     

Three-dimensional photonic bandgap crystals of titania hollow spheres at visible wavelengths

A non-close-packed three-dimensional photonic crystal of titania hollow spheres has been fabricated. The fabricated process is based on the silica template technique, thermal sintering, and the sol–gel process. The band-structure calculations and optical measurements both indicate that a quasi-full three-dimensional photonic bandgap located at the visible wavelength has been presented between the eighth and ninth bands. This indicates that the non-close-packed structure of titania hollow spheres was easier to open the complete photonic bandgaps than other face-centered cubic structures made by self-assembling methods at the visible region.     

Investigation of elastic modes propagating in multi-wire helical waveguides

Elastic guided waves have some potential for non-destructive inspection of civil engineering multi-wire steel cables. However, wave propagation inside such structures is not yet fully understood. This paper investigates multi-wire helical waveguides with special attention to the common seven-wire strand configuration (one straight core surrounded by one layer of six helical wires). A helical coordinate system is first proposed. Though non-orthogonal, this system preserves translational invariance along the helix centreline to explicitly perform a spatial Fourier transform. Then, it is shown that for the analysis of multi-wire helical strands a twisting system—which is a special case of helical systems—is translationally invariant. A semi-analytical finite element method is developed reducing the problem on the cross-section only. A straightforward computation of energy velocity is proposed. Dispersion curves for a single straight wire and a helical wire are first computed to verify the adequacy of the twisting system. Finally the seven-wire strand is analysed using simplified contact conditions. Theoretical dispersion curves are compared to low-frequency magnetostrictive measurements. Good agreement is found for the first compressional-like mode and its associated veering central frequency (‘notch frequency’).     

Growth of magnetic materials and structures on Si(0 0 1) substrates using Co2Si as a template layer

We report in this paper the use of Co₂Si silicide as a template layer for the integration of magnetic materials and structures on silicon substrate. By undertaking Co deposition on silicon at a temperature of about 300 °C, we show that it is possible to obtain a smooth and epitaxial Co₂Si layer, which can act as a template layer preventing the reaction between Co and other transition metals with silicon. Two examples of over-growth of magnetic materials and structures on this template layer will be presented: growth of ferromagnetic Co layers and of magnetic tunnel junctions (Co(Fe)/AlO_x/NiFe).     

Stages in tropoelastin coalescence during synthetic elastin hydrogel formation

Synthetic human tropoelastin was chemically cross-linked to form elastic hydrogel-like structures in vitro. Discrete stages were identified during elastic hydrogel formation by cross-linking tropoelastin with bis(sulfosuccinimidyl) suberate at a range of protein concentrations during this process. In the early stages of this process, particles with the same dimensions as tropoelastin were seen. As hydrogel formation progressed, monomer width fibres were also observed. Overall, four distinct stages were identified: (1) tropoelastin monomers form discrete particles in the order of 200 nm diameter, (2) these particles merge to form larger spheres, (3) spheres coalesce into open linked networks, (4) coalesced spheres consolidate to form a porous structure to give synthetic elastin hydrogels.     

Using sonochemistry for the fabrication of hollow ZnO microspheres

Hollow ZnO microspheres assembled by nanoparticles have been prepared by a sonochemical synthesis at room temperature using carbon spheres as template. The growth process of the precursor was investigated. The prepared hollow spheres were characterized by X-ray diffraction (XRD), field-emission scanning electron microscopy (FE-SEM), high-resolution transmission electron microscopy (HRTEM). The diameter of the obtained hollow spheres is about 500 nm, and the walls are composed of numerous ZnO aggregate nanocrystallines with diameters of 90 nm. A possible growth mechanism for the formation of ZnO microspheres has been proposed, in which carbon spheres play a crucial role in the formation of the wurtzite hollow ZnO microspheres. The specific structure of the hollow spheres may find applications in nanoelectronics, nanophotonics and nanomedicine.