Specific adenine alkylation by pyrrole-imidazole CBI conjugates

We examined DNA alkylation by pyrrole (Py)-imidazole (Im) hairpin polyamides, which possess 1,2,9,9a-tetrahydrocyclopropa[1,2-c]benz[1,2-e]indol-4-one (CBI) or cyclopropapyrroloindole (CPI) as DNA alkylating moieties. High-resolution denaturing gel electrophoresis revealed that alkylation by CBI conjugates 2 and 4 occurred specifically at adenines (A) in matched sequences, whereas CPI conjugates 1 and 3 alkylated both A and guanines (G) in matched sequences. The origin of the different reactivity of CBI and CPI conjugates is discussed in relation to the electrophilicity of the cyclopropane moiety. The high selectivity of the CBI conjugate gives additional sequence specificity relative to CPI conjugates that would be useful for the biological applications.     

Sequence‐Specific DNA Alkylation Targeting for Kras Codon 13 Mutation by Pyrrole–Imidazole Polyamide seco‐CBI Conjugates

Hairpin N‐methylpyrrole‐N‐methylimidazole polyamide seco‐CBI conjugates 2 – 6 were designed for synthesis by Fmoc solid‐phase synthesis, and their DNA‐alkylating activities against the Kras codon 13 mutation were compared by high‐resolution denaturing gel electrophoresis with 225 base pair (bp) DNA fragments. Conjugate 5 had high reactivity towards the Kras codon 13 mutation site, with alkylation occurring at the A of the sequence 5′‐ACGTCACC A ‐3′ (site 2), including minor 1 bp‐mismatch alkylation against wild type 5′‐ACG C CACC A ‐3′ (site 3). Conjugate 6 , which differs from conjugate 5 by exchanging one Py unit with a β unit, showed high selectivity but only weakly alkylated the A of 5′‐ACGTCACC A ‐3′ (site 2). The hairpin polyamide seco‐CBI conjugate 5 thus alkylates according to Dervan′s pairing rule with the pairing recognition which β/β pair targets T–A and A–T pairs. SPR and a computer‐minimized model suggest that 5 binds to the target sequence with high affinity in a hairpin conformation, allowing for efficient DNA alkylation.     

DNA alkylation by pyrrole-imidazole seco-CBI conjugates with an indole linker: sequence-specific DNA alkylation with 10-base-pair recognition through heterodimer formation

The sequence-specific DNA alkylation by conjugates 4 and 5, which consist of N-methylpyrrole (Py)-N-methylimidazole (Im) polyamides and 1-(chloromethyl)-5-hydroxy-1,2-dihydro-3H-benz[e]indole (seco-CBI) linked with an indole linker, was investigated in the absence or presence of partner Py-Im polyamide 6. High-resolution denaturing polyacrylamide gel electrophoresis revealed that conjugate 4 alkylates DNA at the sequences 5'-(A/T)GCCTA-3' through hairpin formation, and alkylates 5'-GGAAAGAAAA-3' through an extended binding mode. However, in the presence of partner Py-Im polyamide 6, conjugate 4 alkylates DNA at a completely different sequence, 5'-AGGTTGTCCA-3'. Alkylation of 4 in the presence of 6 was effectively inhibited by a competitor 7. Surface plasmon resonance (SPR) results indicated that conjugate 4 does not bind to 5'-AGGTTGTCCA-3', whereas 6 binds tightly to this sequence. The results suggest that alkylation proceeds through heterodimer formation, indicating that this is a general way to expand the recognition sequence for DNA alkylation by Py-Im seco-CBI conjugates.     

Sequence-specific alkylation by Y-shaped and tandem hairpin pyrrole-imidazole polyamides

To extend the target DNA sequence length of the hairpin pyrrole-imidazole (Py-Im) polyamide 1, we designed and synthesized Y-shaped and tandem hairpin Py-Im polyamides 2 and 3, which possess 1-(chloromethyl)-5-hydroxy-1,2-dihydro-3H-benz[e]indole (seco-CBI) as DNA-alkylating moieties. High-resolution denaturing polyacrylamide gel electrophoresis by using 5'-Texas-Red-labeled 465 base pair (bp) DNA fragments revealed that conjugates 2 and 3 alkylated the adenine of the target DNA sequences at nanomolar concentrations. Conjugate 2 alkylated adenine N3 at the 3' end of two 8 bp match sequences, 5'-AATAACCA-3' (site A) and 5'-AAATTCCA-3' (site C), while conjugate 3 recognized one 10 bp match sequence, 5'-AGAATAACCA-3' (site A) in the 465 bp DNA fragments. These results demonstrate that seco-CBI conjugates of Y-shaped and tandem hairpin polyamides have extended their target alkylation sequences.     

Enantioselective DNA alkylation by a pyrrole-imidazole S-CBI conjugate

Conjugates 12S and 12R of N-methylpyrrole (Py)-N-methylimidazole (Im) seven-ringed hairpin polyamide with both enantiomers of 1,2,9,9a-tetrahydrocyclopropa[1,2-c]benz[1,2-e]indol-4-one (CBI) were synthesized, and their DNA alkylating activity was examined. High-resolution denaturing gel electrophoresis revealed that 12S selectively and efficiently alkylated at one match sequence, 5'-TGACCA-3', in 450-bp DNA fragments. The selectivity and efficiency of the DNA alkylation by 12S were higher than those of the corresponding cyclopropapyrroloindole (CPI) conjugate, 11. In sharp contrast, another enantiomer, 12R, showed very weak DNA alkylating activity. Product analysis of the synthetic decanucleotide confirmed that the alkylating activity of 12S was comparable with 11 and that 12S had a significantly higher reactivity than 12R. The enantioselective reactivity of 12S and 12R is assumed to be due to the location of the alkylating cyclopropane ring of the CBI unit in the minor groove of the DNA duplex. Since the CBI unit can be synthesized from commercially available 1,3-naphthalenediol, the present results open up the possibility of large-scale synthesis of alkylating Py-Im polyamides for facilitating their use in future animal studies.     

Sequence‐Specific DNA Alkylation by Tandem Py–Im Polyamide Conjugates

Tandem N‐methylpyrrole? N‐methylimidazole (Py? Im) polyamides with good sequence‐specific DNA‐alkylating activities have been designed and synthesized. Three alkylating tandem Py? Im polyamides with different linkers, which each contained the same moiety for the recognition of a 10 bp DNA sequence, were evaluated for their reactivity and selectivity by DNA alkylation, using high‐resolution denaturing gel electrophoresis. All three conjugates displayed high reactivities for the target sequence. In particular, polyamide 1 , which contained a β‐alanine linker, displayed the most‐selective sequence‐specific alkylation towards the target 10 bp DNA sequence. The tandem Py? Im polyamide conjugates displayed greater sequence‐specific DNA alkylation than conventional hairpin Py? Im polyamide conjugates ( 4 and 5 ). For further research, the design of tandem Py? Im polyamide conjugates could play an important role in targeting specific gene sequences.     

Evaluation of the DNA Alkylation Properties of a Chlorambucil-Conjugated Cyclic Pyrrole-Imidazole Polyamide

Hairpin pyrrole-imidazole polyamides (hPIPs) and their chlorambucil (Chb) conjugates (hPIP-Chbs) can alkylate DNA in a sequence-specific manner, and have been studied as anticancer drugs. Here, we conjugated Chb to a cyclic PIP (cPIP), which is known to have a higher binding affinity than the corresponding hPIP, and investigated the DNA alkylation properties of the resulting cPIP-Chb using the optimized capillary electrophoresis method and conventional HPLC product analysis. cPIP-Chb conjugate 3 showed higher alkylation activity at its binding sites than did hPIP-Chb conjugates 1 and 2 . Subsequent HPLC analysis revealed that the alkylation site of conjugate 3 , which was identified by capillary electrophoresis, was reliable and that conjugate 3 alkylates the N3 position of adenine as do hPIP-Chbs. Moreover, conjugate 3 showed higher cytotoxicity against LNCaP prostate cancer cells than did conjugate 1 and cytotoxicity comparable to that of conjugate 2 . These results suggest that cPIP-Chbs could be novel DNA alkylating anticancer drugs.     

Sequence selective recognition in the minor groove of dsDNA by pyrrole,imidazole-substituted bis-benzimidazole conjugates

A series of pyrrole, imidazole-substituted bis-benzimidazole conjugates, Py-Py-Im-gamma-biBenz, Py-Py-gamma-biBenz, Py-Im-gamma-biBenz, and Im-Py-gamma-biBenz (1-4), were prepared in an attempt to target dsDNA sequences possessing both A/T and G/C bps. The dsDNA interactions and sequence specificity of the conjugates have been characterized via spectrofluorometric titrations and thermal melting studies. All conjugates form 1:1 complexes with dsDNA at subnanomolar concentrations. The Im moiety selectively recognizes a G/C bp embedded in the A/T-rich binding site. This represents the first clear example of sequence selective recognition in a 1:1 motif.(1) The equilibrium association constant (K(1)) for complexation of a specific nine-bp dsDNA site, 5'-gcggTATGAAATTcgacg-3', by conjugate 1 is approximately 2.6 x 10(9) M(-1). Displacement of the G/C position or G/C-->A/T substitution within the nine-bp site decreases the K(1) by approximately 8-fold, whereas two continuous G/C bps decrease the K(1) by approximately 50-fold magnitude. The K(1) values for seven-bp dsDNA, 5'-gcggtaTGAAATTcgacg-3' and 5'-gcggtaCAAAATTcgacg-3', binding sites by conjugates Py-Im-gamma-biBenz (3) and Im-Py-gamma-biBenz (4) are approximately 2.3 x 10(9) and approximately 1.2 x 10(9) M(-1), respectively. However, the conjugates with no Im moiety, Py-Py-gamma-biBenz (2) and Py-Py-Py-gamma-biBenz (5 and 6), are specific for seven- to nine-bp A/T-rich sites and single A/T-->G/C bp substitution within the binding site decreases the K(1) values by 1-2 orders of magnitude.     

Highly efficient sequence-specific DNA interstrand cross-linking by pyrrole/imidazole CPI conjugates

We have developed a novel type of DNA interstrand cross-linking agent by synthesizing dimers of a pyrrole (Py)/imidazole (Im)-diamide-CPI conjugate, ImPyLDu86 (1), connected using seven different linkers. The tetramethylene linker compound, 7b, efficiently produces DNA interstrand cross-links at the nine-base-pair sequence, 5'-PyGGC(T/A)GCCPu-3', only in the presence of a partner triamide, ImImPy. For efficient cross-linking by 7b with ImImPy, one A.T base pair between two recognition sites was required to accommodate the linker region. Elimination of the A.T base pair and insertion of an additional A.T base pair and substitution with a G.C base pair significantly reduced the degree of cross-linking. The sequence specificity of the interstrand cross-linking by 7b was also examined in the presence of various triamides. The presence of ImImIm slightly reduced the formation of a cross-linked product compared to ImImPy. The mismatch partners, ImPyPy and PyImPy, did not produce an interstrand cross-link product with 7b, whereas ImPyPy and PyImPy induced efficient alkylation at their matching site with 7b. The interstrand cross-linking abilities of 7b were further examined using denaturing polyacrylamide gel electrophoresis with 5'-Texas Red-labeled 400- and 67-bp DNA fragments. The sequencing gel analysis of the 400-bp DNA fragment with ImImPy demonstrated that 7b alkylates several sites on the top and bottom strands, including one interstrand cross-linking match site, 5'-PyGGC(T/A)GCCPu-3'. To obtain direct evidence of interstrand cross-linkages on longer DNA fragments, a simple method using biotin-labeled complementary strands was developed, which produced a band corresponding to the interstrand cross-linked site on both top and bottom strands. Densitometric analysis indicated that the contribution of the interstrand cross-link in the observed alkylation bands was approximately 40%. This compound efficiently cross-linked both strands at the target sequence. The present system consisted of a 1:2 complex of the alkylating agent and its partner ImImPy and caused an interstrand cross-linking in a sequence-specific fashion according to the base-pair recognition rule of Py-Im polyamides.     

Sequence specific alkylation of DNA by hairpin pyrrole-imidazole polyamide conjugates

BACKGROUND: Pyrrole-imidazole polyamides are synthetic ligands that recognize predetermined sequences in the minor groove of DNA with affinities and specificities comparable to those of DNA-binding proteins. As a result of their DNA-binding properties, polyamides could deliver reactive moieties for covalent reaction at specific DNA sequences and thereby inhibit DNA-protein interactions. Site-specific alkylation of DNA could be a useful tool for regulating gene expression. As a minimal first step, we set out to design and synthesize a class of hairpin polyamides equipped with DNA alkylating agents and characterize the specificity and yield of covalent modification. RESULTS: Bis(dichloroethylamino)benzene derivatives of the well-characterized chlorambucil (CHL) were attached to the gamma turn of an eight-ring hairpin polyamide targeted to the HIV-1 promoter. We found that a hairpin polyamide-CHL conjugate binds and selectively alkylates predetermined sites in the HIV promoter at subnanomolar concentrations. Cleavage sites were determined on both strands of a restriction fragment containing the HIV-1 promoter, revealing good specificity and a high yield of alkylation. CONCLUSIONS: The ability of polyamide-CHL conjugates to sequence specifically alkylate double-stranded DNA in high yield and at low concentrations sets the stage for testing their use as regulators of gene expression in cell culture and ultimately in complex organisms.     

Synthesis of N3- and 2-NH2-substituted 6,7-diphenylpterins and their use as intermediates for the preparation of oligonucleotide conjugates designed to target photooxidative damage on single-stranded DNA representing the bcr-abl chimeric gene

Two 17-mer oligodeoxynucleotide-5'-linked-(6,7-diphenylpterin) conjugates, 2 and 3, were prepared as photosensitisers for targeting photooxidative damage to a 34-mer DNA oligodeoxynucleotide (ODN) fragment 1 representing the chimeric bcr-abl gene that is implicated in the pathogenesis of chronic myeloid leukaemia (CML). The base sequence in the 17-mer was 3'G G T A G T T A T T C C T T C T T5'. In the first of these ODN conjugates (2) the pterin was attached at its N3 atom, via a -(CH2)3OPO(OH)- linker, to the 5'-OH group of the ODN. Conjugate 2 was prepared from 2-amino-3-(3-hydroxypropyl)-6,7-diphenyl-4(3H)-pteridinone 10, using phosphoramidite methodology. Starting material 10 was prepared from 5-amino-7-methylthiofurazano[3,4-d]pyrimidine 4 via an unusual highly resonance stabilised cation 8, incorporating the rare 2H,6H-pyrimido[6,1-b][1,3]oxazine ring system. In the characterisation of 10 two pteridine phosphazenes, 15 and 29, were obtained, as well as new products containing two uncommon tricyclic ring systems, namely pyrimido[2,1-b]pteridine (20 and 24) and pyrimido[1,2-c]pteridine (27). In the second ODN conjugate the linker was -(CH2)5CONH(CH2)6OPO(OH)- and was attached to the 2-amino group of the pterin. In the preparation of 3, the N-hydroxysuccinimide ester 37 of 2-(5-carboxypentylamino)-6,7-diphenyl-4(3H)-pteridinone was condensed with the hexylamino-modified 17-mer. Excitation of 36 with near UV light in the presence of the single-stranded target 34-mer, 5'T G A C C A T C A A T A A G14 G A A G18 A A G21 C C C T T C A G C G G C C3' 1 caused oxidative damage at guanine bases, leading to alkali-labile sites which were monitored by polyacrylamide gel electrophoresis. Cleavage was observed at all guanine sites with a marked preference for cleavage at G14. In contrast, excitation of ODN-pteridine conjugate 2 in the presence of 1 caused oxidation of the latter predominantly at G18, with a smaller extent of cleavage at G15 and G14 (in the double-stranded portion) and G21. These results contrast with our previous observation of specific cleavage at G21 with ruthenium polypyridyl sensitisers, and suggest that a different mechanism, probably one involving Type 1 photochemical electron transfer, is operative. Much lower yields were found with the ODN-pteridine conjugate 3, perhaps as a consequence of the longer linker between the ODN and the pteridine in this case.     

Sequence-specific alkylation of double-strand human telomere repeat sequence by pyrrole-imidazole polyamides with indole linkers

We designed and synthesized pyrrole (Py)-imidazole (Im) hairpin polyamide 1-(chloromethyl)-5-hydroxy-1,2-dihydro-3H-benz[e]indole (seco-CBI) conjugates 1 and 2, which target both strands of the double-stranded region of the human telomere repeat sequences, 5'-d(TTAGGG)(n)-3'/5'-d(CCCTAA)(n)-3'. High-resolution denaturing polyacrylamide gel electrophoresis demonstrated that conjugates 1 and 2 alkylated DNA at the 3' A of 5'-ACCCTA-3' and 5'-AGGGTTA-3', respectively. Cytotoxicities of conjugates 1 and 2 were evaluated using 39 human cancer cell lines; averages of log IC(50) values for conjugates 1 and 2 were -6.96 (110 nM) and -7.24 (57.5 nM), respectively. Conjugates 1 and 2 have potential as antitumor drugs capable of targeting telomere repeat sequence.     

Selective intercalation of charge neutral intercalators into GG and CG steps: implication of HOMO-LUMO interaction for sequence-selective drug intercalation into DNA

We have synthesized naphthopyranone epoxide 4 from D-isoascorbic acid together with its three diastereoisomers. DNA alkylation of ODNs containing 5'XGT3' and 5'TGY3' by 4 (11R, 13R), where X and Y are any nucleotide bases, occurred at all G residues except at G of the 5'TGC3' sequence. In contrast, the three other diastereoisomers of 4 showed only weak G alkylation activity. Differential (1)H NMR NOE of the 4-G adduct confirmed the G-N7 alkylation at the epoxide carbon of 4 with concomitant S(N)2 ring opening of the epoxide. Quantitative HPLC analysis of G alkylation efficiency for 4 showed the order of G alkylation susceptibility as TGGT approximately CGT > TGA > AGT > TGT > TGC. The order was fully consistent with those reported for aflatoxin B(1) oxide and kapurimycin A(3), suggesting that the sequence selectivity observed for these DNA alkylating agents is not structure dependent but most likely due to the intrinsic property of DNA sequences. We found that the order of G alkylation susceptibility obtained for 4 completely matched the calculated HOMO energy level of G-containing sequences. These results underscore that 4 is a unique molecular probe for ranking the HOMO level of G-containing sequences by well-known G alkylation chemistry and suggests that the intercalation of charge neutral intercalators is a HOMO-controlled process.     

C-H to N substitution dramatically alters the sequence-specific DNA alkylation, cytotoxicity, and expression of human cancer cell lines

We designed and synthesized sequence-specific alkylating conjugates 1 and 2, which selectively alkylate matched sequences at nanomolar concentrations. Conjugates 1 and 2 differ only in that the C-H is substituted by an N in the second ring, which precisely recognizes and effectively alkylates DNA according to the recognition rule of Py-Im polyamides. We investigated sequence-specific DNA alkylation, cytotoxicity in 39 human cancer cell lines, and the effect on expression levels in cancer cell lines by Py-Im conjugates 1 and 2. The COMPARE analysis of the mean graphs showed that conjugates 1 and 2 did not correlate well with each other (r = 0.65) despite having a common DNA alkylating mechanism (purine N3 alkylation). Array-based gene expression analysis demonstrated that there are several oppositely regulated genes. The results suggest the intriguing possibility that DNA alkylating agents recognizing longer base-pair sequences may provide a promising approach for developing new types of antigene agents.     

Effect of loop distortion on the stability and structural dynamics of DNA hairpin and dumbbell conjugates

The thermal stability and conformational dynamics of DNA hairpin and dumbbell conjugates having short A-tract base pair domains connected by tri- or hexa(ethylene glycol) linkers is reported. The formation of stable base-paired A-tract hairpins having oligo(ethylene glycol) linkers requires a minimum of four or five A-T base pairs. The formation of base-paired dumbbells having oligo(ethylene glycol) linkers by means of chemical ligation of nicked dumbbells requires a minimum of two A-T base pairs on either side of the nick. Molecular modeling indicates that the hexa(ethylene glycol) linker is sufficiently long to permit formation of strain-free loop regions and B-DNA base pair domains. In contrast, the tri(ethylene glycol) is too short to permit Watson-Crick base pairing between the bases attached to the linker. The shorter linker distorts the duplex, resulting in fluxional behavior in which the base pairs adjacent to the linker and at the open end of the hairpin dissociate on the nanosecond time scale. The loss of interstrand binding energy caused by these fluctuations leads to a difference of approximately 5 degrees C in melting temperature between EG3 and EG6 hairpins. An analysis of the fluxional behavior of the EG3 adjacent base-pair has been used to study the pathways for base flipping and base stacking, including the identification of rotated base (partially flipped) intermediates that have not been described previously for A-T base pairs.     

Nucleotides. Part XLIV. Synthesis,characterization, and biological activity of monomeric and trimeric cordycepin-cholesterol conjugates and inhibition of HIV-1 replication

The antivirally active 3′-deoxyadenylyl-(2′–5′)-3′-deoxyadenylyl-(2′–5′)-3′-deoxyadenosine (cordycepin trimer core) was modified at the 2′- or 5′-terminus, by attachment of cholesterol via a carbonate bond (→ 15 ) or a succinate linker (→ 16 and 27 ) to improve cell permeability. The corresponding monomeric conjugates 4 , 7 , and 21 of cordycepin were prepared as model substances to study the applicability of the anticipated protecting groups – the monomethoxytrityl (MeOTr), the (tert-butyl)dimethylsilyl (tbds), and the β -eliminating 2-(4-nitrophenyl)ethyl (npe) and 2-(4-nitrophenyl)ethoxycarbonyl (npeoc) groups – for the final deblocking steps without harming the ester bonds of the conjugate trimers. The syntheses were performed in solution using phosphoramidite chemistry. The fully protected trimer conjugates 13 , 14 , and 26 as well as all intermediates were characterized by elemental analyses, UV and ¹H-NMR spectra. The deblocked conjugates 15 , 16 , and 27 were pure according to HPLC and showed the correct compositions by mass spectra. Comparative biological studies indicated that cordycepincholesterol conjugate trimers 16 and 27 were 333- and 1000-fold, respectively, more potent inhibitors of HIV-1-induced syncytia formation than cordycepin trimer core.     

Fast switching immobilized photochromic dyes

A novel photochromic dye conjugate architecture is described, which allows both covalent tethering to a polymeric host matrix and fast photochromic switching. The new conjugates consist of a photochromic dye covalently bound to two different substituents via a Y‐branching linker (hetero Y‐branching), one being a polymerizable methacrylate moiety and the other a soft (low T_g) poly(dimethylsiloxane) oligomer. The novel conjugates gave faster photochromic decoloration in the host lens matrix compared with the electronically equivalent nonmatrix‐bound and unconjugated parent control dyes. In addition, further acceleration of fade speed kinetics was observed with a longer linker between photochromic dye and methacrylate moiety. © 2010 Wiley Periodicals, Inc. J Polym Sci Part A: Polym Chem, 2011     

Solid-phase synthesis of positively charged deoxynucleic guanidine (DNG) tethering a Hoechst 33258 analogue: triplex and duplex stabilization by simultaneous minor groove binding

Deoxynucleic guanidine (DNG), a DNA analogue in which positively charged guanidine replaces the phosphodiester linkages, tethering to Hoechst 33258 fluorophore by varying lengths has been synthesized. A pentameric thymidine DNG was synthesized on solid phase in the 3' --> 5' direction that allowed stepwise incorporation of straight chain amino acid linkers and a bis-benzimidazole (Hoechst 33258) ligand at the 5'-terminus using PyBOP/HOBt chemistry. The stability of (DNA)(2).DNG-H triplexes and DNA.DNG-H duplexes formed by DNG and DNG-Hoechst 33258 (DNG-H) conjugates with 30-mer double-strand (ds) DNA, d(CGCCGCGCGCGCGAAAAACCCGGCGCGCGC)/d(GCGGCGCGCGCGCTTTTTGGGCCGCGCGCG), and single-strand (ss) DNA, 5'-CGCCGCGCGCGCGAAAAACCCGGCGCGCGC-3', respectively, has been evaluated by thermal melting and fluorescence emission experiments. The presence of tethered Hoechst ligand in the 5'-terminus of the DNG enhances the (DNA)(2).DNG-H triplex stability by a DeltaT(m) of 13 degrees C. The fluorescence emission studies of (DNA)(2).DNG-H triplex complexes show that the DNG moiety of the conjugates bind in the major groove while the Hoechst ligand resides in the A:T rich minor groove of dsDNA. A single G:C base pair mismatch in the target site decreases the (DNA)(2).DNG triplex stability by 11 degrees C, whereas (DNA)(2).DNG-H triplex stability was decreased by 23 degrees C. Inversion of A:T base pair into T:A base pair in the center of the binding site, which provides a mismatch selectively for DNG moiety, decreases the triplex stability by only 5-6 degrees C. Upon hybridization of DNG-Hoechst conjugates with the 30-mer ssDNA, the DNA.DNG-H duplex exhibited significant increase in the fluorescence emission due to the binding of the tethered Hoechst ligand in the generated DNA.DNG minor groove, and the duplex stability was enhanced by DeltaT(m) of 7 degrees C. The stability of (DNA)(2).DNG triplexes and DNA.DNG duplexes is independent of pH, whereas the stability of (DNA)(2).DNG-H triplexes decreases with increase in pH.     

Sequence-specific fluorescence detection of DNA by polyamide-thiazole orange conjugates

Fluorescent methods to detect specific double-stranded DNA sequences without the need for denaturation may be useful in the field of genetics. Three hairpin pyrrole-imidazole polyamides 2-4 that target their respective sequences 5'-WGGGWW-3', 5'-WGGCCW-3', and 5'-WGWWCW-3' (W = A or T) were conjugated to thiazole orange dye at the C-termini to examine their fluorescence properties in the presence and absence of match duplex DNA. The conjugates fluoresce weakly in the absence of DNA but showed significant enhancement (>1000-fold) upon the addition of 1 equiv of match DNA and only slight enhancement with the addition of mismatch DNA. The polyamide-dye conjugates bound specific DNA sequences with high affinity (Ka > 10(8) M(-1)) and unwound the DNA duplex through intercalation (unwinding angle, phi, approximately 8 degrees). This new class of polyamides provides a method to specifically detect DNA sequences without denaturation.     

Neomycin-neomycin dimer: an all-carbohydrate scaffold with high affinity for AT-rich DNA duplexes

A dimeric neomycin-neomycin conjugate 3 with a flexible linker, 2,2'-(ethylenedioxy)bis(ethylamine), has been synthesized and characterized. Dimer 3 can selectively bind to AT-rich DNA duplexes with high affinity. Biophysical studies have been performed between 3 and different nucleic acids with varying base composition and conformation by using ITC (isothermal calorimetry), CD (circular dichroism), FID (fluorescent intercalator displacement), and UV (ultraviolet) thermal denaturation experiments. A few conclusions can be drawn from this study: (1) FID assay with 3 and polynucleotides demonstrates the preference of 3 toward AT-rich sequences over GC-rich sequences. (2) FID assay and UV thermal denaturation experiments show that 3 has a higher affinity for the poly(dA)·poly(dT) DNA duplex than for the poly(dA)·2poly(dT) DNA triplex. Contrary to neomycin, 3 destabilizes poly(dA)·2poly(dT) triplex but stabilizes poly(dA)·poly(dT) duplex, suggesting the major groove as the binding site. (3) UV thermal denaturation studies and ITC experiments show that 3 stabilizes continuous AT-tract DNA better than DNA duplexes with alternating AT bases. (4) CD and FID titration studies show a DNA binding site size of 10-12 base pairs/drug, depending upon the structure/sequence of the duplex for AT-rich DNA duplexes. (5) FID and ITC titration between 3 and an intramolecular DNA duplex [d(5'-A(12)-x-T(12)-3'), x = hexaethylene glycol linker] results in a binding stoichiometry of 1:1 with a binding constant ～10(8) M(-1) at 100 mM KCl. (6) FID assay using 3 and 512 hairpin DNA sequences that vary in their AT base content and placement also show a higher binding selectivity of 3 toward continuous AT-rich than toward DNA duplexes with alternate AT base pairs. (7) Salt-dependent studies indicate the formation of three ion pairs during binding of the DNA duplex d[5'-A(12)-x-T(12)-3'] and 3. (8) ITC-derived binding constants between 3 and DNA duplexes have the following order: AT continuous, d[5'-G(3)A(5)T(5)C(3)-3'] > AT alternate, d[5'-G(3)(AT)(5)C(3)-3'] > GC-rich d[5'-A(3)G(5)C(5)T(3)-3']. (9) 3 binds to the AT-tract-containing DNA duplex (B* DNA, d[5'-G(3)A(5)T(5)C(3)-3']) with 1 order of magnitude higher affinity than to a DNA duplex with alternating AT base pairs (B DNA, d[5'-G(3)(AT)(5)C(3)-3']) and with almost 3 orders of magnitude higher affinity than a GC-rich DNA (A-form, d[5'-A(3)G(5)C(5)T(3)-3']).