Selective formation of stable triplexes including a TA or a CG interrupting site with new bicyclic nucleoside analogues (WNA)

Triplex-forming oligonucleotides (TFOs) are potential DNA-targeting molecules and would become powerful tools for genomic research. As the stabilization of the TFO is partially provided by hydrogen bonds to purine bases, the most stable triplexes form with homopurine/homopyrimidine sequences, and a pyrimidine base in the purine strand of the duplex interrupts triplex formation. If a TFO can recognize sequences including such an interrupting site, the target regions in the genome would be expanded to a greater extent. However, this problem has not been generally solved despite extensive studies. We have previously reported a new base analogue (WNA) constructed of three parts, a benzene ring, a heterocyclic ring, and a bicyclic skeleton to hold these two parts. In this study, we have further investigated modification of WNA systematically and determined two useful WNA analogues, WNA-beta T and WNA-beta C, for selective stabilization of triplexes at a TA and a CG interrupting site, respectively. The triplexes with WNA analogues have exhibited an interesting property in that they are more stable than natural-type triplexes even at low Mg(2+) concentration. From comparison of the results with H-WNA-beta T lacking benzene and those with WNA-H without thymine, it has been suggested that benzene is a major contributor for triplex stability and thymine provides selectivity. Thus, it has been successfully demonstrated that WNA-beta T/TA and WNA-beta C/CG combinations may expand triplex recognition codes in addition to the natural A/AT and G/GC base triplet codes. The results of this study will provide useful information for the design of new WNA analogues to overcome inherent problems for further expansion of triplex recognition codes.     

Theoretical and experimental study on a self-assembling polysaccharide forming nanochannels: static and dynamic effects induced by a soft confinement

It is well-known that the polysaccharide scleroglucan (Sclg) exhibits a triple-helix conformation (triplex) and it is able to form hydrogels in water solution. Furthermore, these hydrogels are influenced by the presence of borax, in terms of rheological and drug release properties. In previous works, we showed that the presence of borax stabilizes the intertriplex interactions and that the property variations, induced by borax, can be fully explained, considering that the Sclg triplexes can form nanochannel-like structures. In this paper, the stability of these aggregates has been experimentally studied by means of atomic force microscopy (AFM) and theoretically investigated by means of molecular dynamics (MD) simulations. The simulations indicate that the borax stabilizes nanochannel-like structures when seven triplexes are considered. The simultaneous presence of different Sclg triplexes in a narrow space strongly influences the properties of confined water molecules in a way similar, in many aspects, to that of water molecules located in the inner part of well-defined nanochannels (e.g., diffusion inside carbon nanotubes). As a consequence, also the conformational properties of flanking regions of Sclg triplexes are influenced. Furthermore, differential scanning calorimetry (DSC) data show that the well-known conformational transition occurring at 280 K for Sclg does not take place in the presence of borax. The MD simulations suggest that such lack of transition is a direct consequence of the presence of borax. The role of Na+ counterions in the hydrogel structure is also investigated.     

Synergistic stabilization of nucleic acid assembly by oligo-N3'-->P5' phosphoramidate modification and additions of comb-type cationic copolymers

Synergic stabilization of DNA triplexes by oligo-N3'-->P5' phosphoramidate (PN) modification and additions of comb-type cationic copolymers was demonstrated. The combination of the copolymer and the PN modification increased triplex K(a) about 4 orders of magnitude. Kinetic analysis revealed that observed stabilization resulted from kinetic complimentarity between increased association rates by the copolymer and decreased dissociation rates by the PN modification of triplex forming oligonucleotides. No countering interference between these stabilizing effects was observed. We propose that kinetic analyses of stabilizing effects permit selection of a rational combination of stabilizing methods for successful synergy in stabilizing complex formation.     

Energetic contributions for the formation of TAT/TAT,TAT/CGC(+), and CGC(+)/CGC(+) base triplet stacks

We used a combination of spectroscopic and calorimetric techniques to determine complete thermodynamic profiles accompanying the folding of a set of triple helices and control duplexes. Specifically, we studied the sequences: d(A(7)C(5)T(7)C(5)T(7)), d(A(6)C(5)T(6)C(5)T(6)), d(A(6)C(5)T(6)), d(AGAGAGAC(5)TCTCTCTC(5)TCTCTCT), d(AGAGAC(5)TCTCTC(5)TCTCT), d(AGAGAC(5)TCTCTC(2)), d(AAGGAC(5)TCCTTC(5)TTCCT), d(AGGAAC(5)TTCCTC(5)TCCTT), and d(GAAAGC(5)CTTTCC(5)CTTTC). Circular dichroism spectroscopy indicated that all triplexes and duplexes are in the "B" conformation. DSC melting experiments revealed that the formation of triplexes is accompanied by a favorable free energy change, which arises from the compensation of a large and favorable enthalpic contribution with an unfavorable entropic contribution. Comparison of the thermodynamic profiles of these triplexes yielded enthalpic contributions of -24 kcal/mol, -23 kcal/mol, and -22 kcal/mol for the formation of TAT/TAT, TAT/CGC(+), and CGC(+)/CGC(+) base triplet stacks, respectively. UV melts as a function of sodium concentration show sodium ions stabilize the triplexes that contain only TAT triplets but destabilize the triplexes that contain CGC(+) triplets. UV melts as a function of pH indicate that the protonation of the third strand and loop cytosines stabilizes the triplexes that contain CGC(+) and TAT triplets, respectively. Our overall results suggest that the triplex to duplex transition of triplexes that contain CGC(+) triplets is accompanied by a release of protons and an uptake of sodium, while their duplex to random coil transition is accompanied by a release of sodium ions. A consequence of this opposite sodium dependence is that their coupled transitions are nearly independent of sodium concentration but are dependent on the experimental pH.     

Calorimetric unfolding of intramolecular triplexes: length dependence and incorporation of single AT --> TA substitutions in the duplex domain

DNA triplexes have been the subject of great interest due to their ability to interfere with gene expression. The inhibition of gene expression involves the design of stable triplexes under physiological conditions; therefore, it is important to have a clear understanding of the energetic contributions controlling their stability. We have used a combination of UV spectroscopy and differential scanning calorimetric (DSC) techniques to investigate the unfolding of intramolecular triplexes, d(A(n)C5T(n)C5T(n)), where n is 5-7, 9, and 11, and related triplexes with a single AT --> TA substitution in their duplex stem. Specifically, we obtain standard thermodynamic profiles for the unfolding of each triplex in buffer solutions containing 0.1 M or 1 M NaCl. The triplexes unfold in monophasic or biphasic transitions (triplex --> duplex --> coil) depending on the concentration of salt used and position of the substitution, and their transition temperatures are independent of strand concentration. The DSC curves of the unsubstituted triplexes yielded an unfolding heat of 13.9 kcal/mol for a TAT/TAT base-triplet stack and a heat capacity of 505 cal/ degrees C.mol. The incorporation of a single substitution destabilizes triplex formation (association of the third strand) to a larger extent in 0.1 M NaCl, and the magnitude of the effects also depends on the position of the substitution. The combined results show that a single AT --> TA substitution in a homopurine/homopyrimidine duplex does not allow triplex formation of the neighboring five TAT base triplets, indicating that the in vivo formation of triplexes, such as H-DNA, is exclusive to homopurine/homopyrimidine sequences.     

DNA duplexes and triplex-forming oligodeoxynucleotides incorporating modified nucleosides forming stable and selective triplexes

We have previously reported DNA triplexes containing the unnatural base triad G-PPI·C3, in which PPI is an indole-fused cytosine derivative incorporated into DNA duplexes and C3 is an abasic site in triplex-forming oligonucleotides (TFOs) introduced by a propylene linker. In this study, we developed a new unnatural base triad A-ψ·C(R1) where ψ and C(R1) are base moieties 2'-deoxypseudouridine and 5-substituted deoxycytidine, respectively. We examined several electron-withdrawing substituents for R1 and found that 5-bromocytosine (C(Br)) could selectively recognize ψ. In addition, we developed a new PPI derivative, PPI(Me), having a methyl group on the indole ring in order to achieve selective triplex formation between DNA duplexes incorporating various Watson-Crick base pairs, such as T-A, C-G, A-ψ, and G-PPI(Me), and TFOs containing T, C, C(Br), and C3. We studied the selective triplex formation between these duplexes and TFOs using UV-melting and gel mobility shift assays.     

Selectivity and affinity of DNA triplex forming oligonucleotides containing the nucleoside analogues 2'-O-methyl-5-(3-amino-1-propynyl)uridine and 2'-O-methyl-5-propynyluridine

Triplex forming oligonucleotides (TFOs) containing the nucleoside analogues 2'-O-methyl-5-propynyluridine (1) and 2'-O-methyl-5-(3-amino-1-propynyl)uridine (2) were synthesized. The affinity and selectivity of triplex formation by these TFOs were studied by gel shift analysis, T(m) value measurement, and association rate assays. The results show that the introduction of 1 and 2 into TFOs can improve the stability of the triplexes under physiological conditions. Optimized distribution of 1 or 2 in the TFOs combined with a cluster of contiguous nucleosides with 2'-aminoethoxy sugars resulted in formation of triplexes with further enhanced stability and improved selectivity.     

Solid-phase synthesis of positively charged deoxynucleic guanidine (DNG) tethering a Hoechst 33258 analogue: triplex and duplex stabilization by simultaneous minor groove binding

Deoxynucleic guanidine (DNG), a DNA analogue in which positively charged guanidine replaces the phosphodiester linkages, tethering to Hoechst 33258 fluorophore by varying lengths has been synthesized. A pentameric thymidine DNG was synthesized on solid phase in the 3' --> 5' direction that allowed stepwise incorporation of straight chain amino acid linkers and a bis-benzimidazole (Hoechst 33258) ligand at the 5'-terminus using PyBOP/HOBt chemistry. The stability of (DNA)(2).DNG-H triplexes and DNA.DNG-H duplexes formed by DNG and DNG-Hoechst 33258 (DNG-H) conjugates with 30-mer double-strand (ds) DNA, d(CGCCGCGCGCGCGAAAAACCCGGCGCGCGC)/d(GCGGCGCGCGCGCTTTTTGGGCCGCGCGCG), and single-strand (ss) DNA, 5'-CGCCGCGCGCGCGAAAAACCCGGCGCGCGC-3', respectively, has been evaluated by thermal melting and fluorescence emission experiments. The presence of tethered Hoechst ligand in the 5'-terminus of the DNG enhances the (DNA)(2).DNG-H triplex stability by a DeltaT(m) of 13 degrees C. The fluorescence emission studies of (DNA)(2).DNG-H triplex complexes show that the DNG moiety of the conjugates bind in the major groove while the Hoechst ligand resides in the A:T rich minor groove of dsDNA. A single G:C base pair mismatch in the target site decreases the (DNA)(2).DNG triplex stability by 11 degrees C, whereas (DNA)(2).DNG-H triplex stability was decreased by 23 degrees C. Inversion of A:T base pair into T:A base pair in the center of the binding site, which provides a mismatch selectively for DNG moiety, decreases the triplex stability by only 5-6 degrees C. Upon hybridization of DNG-Hoechst conjugates with the 30-mer ssDNA, the DNA.DNG-H duplex exhibited significant increase in the fluorescence emission due to the binding of the tethered Hoechst ligand in the generated DNA.DNG minor groove, and the duplex stability was enhanced by DeltaT(m) of 7 degrees C. The stability of (DNA)(2).DNG triplexes and DNA.DNG duplexes is independent of pH, whereas the stability of (DNA)(2).DNG-H triplexes decreases with increase in pH.     

Stable and selective formation of hoogsteen-type triplexes and duplexes using twisted intercalating nucleic acids (TINA) prepared via postsynthetic Sonogashira solid-phase coupling reactions

Bulge insertions of (R)-1-O-[4-(1-pyrenylethynyl)phenylmethyl]glycerol (5) into the middle of homopyrimidine oligodeoxynucleotides (twisted intercalating nucleic acids, TINA) obtained via postsynthetic Sonogashira coupling reaction led to extraordinary high thermal stability of Hoogsteen-type triplexes and duplexes, whereas Watson-Crick-type duplexes of the same nucleotide content were destabilized. Modified oligonucleotides were synthesized using the phosphoramidite of (S)-1-(4,4'-dimethoxytriphenylmethyloxy)-3-(4-iodo-benzyloxy)-propan-2-ol followed by treatment of the oligonucleotide on a CPG-support with the Sonogashira-coupling reaction mixture containing different ethynylaryls. Bulged insertion of the pyrene derivative 5 into oligonucleotides was found to be the best among the tested modifications for binding to the Hoogsteen-type triplexes and duplexes. Thus, at pH 7.2 an oligonucleotide with cytidine content of 36% possessing two bulged insertions of 5 separated by three bases formed a stable triplex (T(m) = 43.0 degrees C), whereas the native oligonucleotide was unable to bind to the target duplex. The corresponding Watson-Crick-type duplex with the same oligonucleotide had T(m) of 38.0 degrees C at pH 7.2, while the T(m) of unmodified dsDNA was 47.0 degrees C. Experiments with mismatched oligonucleotides, luminescent properties, and potential applications of TINA technology is discussed.     

Stability of Hoogsteen‐Type Triplexes – Electrostatic Attraction between Duplex Backbone and Triplex‐Forming Oligonucleotide (TFO) Using an Intercalating Conjugate

Syntheses are described for two novel twisted intercalating nucleic acid (TINA) monomers where the intercalator comprises a benzene ring linked to a naphthalimide moiety via an ethynediyl bridge. The intercalators Y and Z have a 2‐(dimethylamino)ethyl and a methyl residue on the naphthalimide moiety, respectively. When used as triplex‐forming oligonucleotides (TFOs), the novel naphthalimide TINAs show extraordinary high thermal stability in Hoogsteen‐type triplexes and duplexes with high discrimination of mismatch strands. DNA Strands containing the intercalator Y show higher thermal triplex stability than DNA strands containing the intercalator Z . This observation can be explained by the ionic interaction of the protonated dimethylamino group under physiological conditions, targeting the negatively charged phosphate backbone of the duplex. This interaction leads to an extra binding mode between the TFO and the duplex, in agreement with molecular‐modeling studies. We believe that this is the first example of an intercalator linking the TFO to the phosphate backbone of the duplex by an ionic interaction, which is a promising tool to achieve a higher triplex stability.     

Unfolding thermodynamics of DNA pyrimidine triplexes with different molecularities

Nucleic acid oligonucleotides (ODNs), as drugs, present an exquisite selectivity and affinity that can be used in antigene and antisense strategies for the control of gene expression. In this work we try to answer the following question: How does the molecularity of a DNA triplex affect its overall stability and melting behavior? To this end, we used a combination of temperature-dependent UV spectroscopy and calorimetric (differential scanning calorimetry) techniques to investigate the melting behavior of DNA triplexes with a similar helical stem, TC+TC+TC+T/AGAGAGA/TCTCTCT, but formed with different strand molecularity. We determined standard thermodynamic profiles and the differential binding of protons and counterions accompanying their unfolding. The formation of a triplex is accompanied by a favorable free energy term, resulting from the typical compensation of favorable enthalpy-unfavorable entropy contributions, i.e., the folding of a particular triplex is enthalpy driven. The magnitude of the favorable enthalpy contributions corresponds to the number and strength of the base-triplet stacks formed, which are helped by stacking contributions due to the incorporation of dangling ends or loops. Triplex stability is in the following order: monomolecular > bimolecular > trimolecular; this is explained in terms of additional stacking contributions due to the inclusion of loops. As expected, acidic pH stabilized all triplexes by allowing protonation of the cytosines in the third strand; however, the percentage of protonation increases as the molecularity decreases. The results help to choose adequate solution conditions for the study of triplexes containing different ratios of CGC+ and TAT base triplets and to aid in the design of oligonucleotide sequences as targeting reagents that could effectively react with mRNA sequences involved in human diseases, thereby increasing the feasibility of using the antisense strategy for therapeutic purposes.     

Stabilization of parallel triplexes by twisted intercalating nucleic acids (TINAs) incorporating 1,2,3-triazole units and prepared by microwave-accelerated click chemistry

A highly efficient method for postsynthetic modification of unprotected oligonucleotides incorporating internal insertions of (R)-1-O-(4-ethynylbenzyl)glycerol has been developed through the application of click chemistry with water-insoluble pyren-1-yl azide and water-soluble benzyl azide and acceleration by microwave irradiation. The twisted intercalating nucleic acids (TINAs) obtained in these reactions, possessing bulged insertions of (R)-3-O-{4-[1-(pyren-1-yl)-1H-1,2,3-triazol-4-yl]benzyl}glycerol (7), formed parallel triplexes with thermal stabilities of 20.0, 34.0, and 40.0 degrees C at pH 7.2 in the cases of one, two, or three insertions of 7, respectively, separated by three nucleic bases. An oligonucleotide with four insertions of 7--each between three nucleic bases in the sequence--was unable to form complexes with complementary single- or double-stranded DNAs, as a result of self-aggregation of the pyrene moieties. This assumption was supported by the formation of a very strong excimer band at 460 nm in the fluorescence spectra. Molecular modeling of the parallel triplex with bulged insertion of the monomer 7 in the triplex-forming oligonucleotide (TFO) showed that only the pyrene moiety was stacking between the bases of the dsDNA, whereas 1,2,3-triazole did not participate in the triplex stabilization. Thermal denaturation studies of the duplexes and triplexes, as well as the fluorescence properties of TINA-triazole 7, are discussed and compared with previous studies on TINA.     

pH-Independent triplex formation: hairpin DNA containing isoguanine or 9-deaza-9-propynylguanine in place of protonated cytosine

Triplex-forming oligonucleotides (TFOs) containing 2'-deoxyisoguanosine (2), 7-bromo-7-deaza-2'-deoxyisoguanosine (2) as well as the propynylated 9-deazaguanine N7-(2'-deoxyribonucleoside) were prepared. For this the phosphoramidites 9a, b of the nucleoside 1 and, the phosphoramidites 19, 20 of compound 3b were synthesized. They were employed in solid-phase oligonucleotide synthesis to yield the protected 31-mer oligonucleotides. The deblocking of the allyl-protected oligonucleotides containing 1 was carried out by Pd(0)[PPh3]4-PPh3 followed by 25% aq. NH3. Formation of the 31-mer single-stranded intramolecular triplexes was studied by UV-melting curve analysis. In the single-stranded 31-mer oligonucleotides the protonated dC in the dCH(+)-dG-dC base triad was replaced by 2'-deoxyisoguanosine (1), 7-bromo-7-deaza-2'-deoxyisoguanosine (2) and, 9-deaza-9-propynylguanine N7-(2'-deoxyribonucleoside) (3b). The replacement of protonated dC by compounds 1 and 3b resulted in intramolecular triplexes which are formed pH-independently and are stable under neutral conditions. These triplexes contain "purine" nucleosides in the third pyrimidine rich strand of the oligonucleotide hairpin.     

Oligonucleotide duplexes containing N8-glycosylated 8-aza-7-deazaguanine and self-assembly of 8-aza-7-deazapurines on the nucleoside and the oligomeric level

The 8-aza-7-deazaguanine N8-(2'-deoxy-beta-D-ribofuranoside) (1) was synthesized, converted into the phosphoramidite 4 and incorporated into oligonucleotides. Nucleoside 1 forms stable base pairs with 2'-deoxy-5-methylisocytidine in DNA with antiparallel chain orientation (aps) and with 2'-deoxycytidine in duplexes with parallel chains (ps). According to the CD spectra self-complementary oligonucleotides d(1-m5isoC)3 and d(1-C), form autonomous DNA-structures. Neither the nucleoside 1 nor the regularly linked 8-aza-7-deaza-2'-deoxyguanosine form G-like tetrads while the regularly linked 8-aza-7-deaza-2'-deoxyisoguanosine gives higher molecular assemblies which are destroyed by bulky 7-bromo substituents. This was verified on monomeric nucleosides by ESI-MS spectrometry and on oligonucleotides by HPLC analysis.     

Neomycin binding to Watson-Hoogsteen (W-H) DNA triplex groove: a model

Neomycin is the most effective aminoglycoside (groove binder) in stabilizing a DNA triple helix. It stabilizes TAT, as well as mixed base DNA triplexes, better than known DNA minor groove binders (which usually destabilize the triplex) and polyamines. Neomycin selectively stabilizes the triplex (in the presence of salt), without any effect on the DNA duplex. (1) Triplex stabilization by neomycin is salt dependent (increased KCl and MgCl(2) concentrations decrease neomycin's effectiveness, at a fixed drug concentration). (2) Triplex stabilization by neomycin is pH dependent (increased pH decreases neomycin's effectiveness, at a fixed drug concentration). (3) CD binding studies indicate approximately 5-7 base triplets/drug apparent binding site, depending upon the structure/sequence of the triplex. (4) Neomycin shows nonintercalative groove binding to the DNA triplex, as evident from viscometric studies. (5) Neomycin shows a preference for stabilization of TAT triplets but can also accommodate CGC(+) triplets. (6) Isothermal titration calorimetry (ITC) studies reveal an association constant of approximately 2 x 10(5) M(-)(1) between neomycin and an intramolecular triplex and a higher K(a) for polydA.2polydT. (7) Binding/modeling studies show a marked preference for neomycin binding to the larger W-H groove. Ring I/II amino groups and ring IV amines are proposed to be involved in the recognition process. (8) The novel selectivity of neomycin is suggested to be a function of its charge and shape complementarity to the triplex W-H groove, making neomycin the first molecule that selectively recognizes a triplex groove over a duplex groove.     

Unfolding of G-quadruplexes: energetic, and ion and water contributions of G-quartet stacking

It has been shown that DNA oligonucleotides composed, in part, of G repeat sequences can adopt G-quadruplex structures in the presence of specific metal ions. In this work, we use a combination of spectroscopic and calorimetric techniques to determine the spectral and thermodynamic characteristics of two DNA aptamers, d(G2T2G2TGTG2T2G2), G2, and d(G3T2G3TGTG3T2G3), G3; a sequence in the promoter region of the c-MYC oncogene, d(TG4AG3TG4AG3TG4A2G2), NHE-III; and the human telomere sequence d(AG3T2AG3T2AG3T2AG3), 22GG. The circular dichroism spectra of these oligonucleotides in the presence of K+ indicate that all form G-quadruplexes with G-quartets in an antiparallel arrangement (G2), in a parallel arrangement (NHE-III and 22GG), or in a mixed parallel and antiparallel G-quartet arrangement (G3). Melting profiles show transition temperatures, TM, above 45 degrees C that are independent of strand concentration, consistent with the formation of very stable intramolecular G-quadruplexes. We used differential scanning calorimetry to obtain complete thermodynamic profiles for the unfolding of each quadruplex. Subtracting the thermodynamic folding profiles of G2 from those of G3 yielded the following thermodynamic profile for the formation of a G-quartet stack: DeltaG degrees 20 = -2.2 kcal/mol, DeltaHcal = -14.6 kcal/mol, TDeltaScal = -12.4 kcal/mol, DeltanK+ = -0.3 mol of K+/mol, and DeltanW = 13 mol of H2O/mol. Furthermore, we used this profile to estimate the thermodynamic contributions of the loops and/or extra base sequences of each oligonucleotide in the G-quadruplex state. The average free energy contributions of the latter indicate that the incorporation of loops and base overhangs stabilizes quadruplex structures. This stabilization is enthalpy-driven and is due to base-stacking contributions.     

Structure of triplex DNA in the gas phase

Extensive (more than 90 microseconds) molecular dynamics simulations complemented with ion-mobility mass spectrometry experiments have been used to characterize the conformational ensemble of DNA triplexes in the gas phase. Our results suggest that the ensemble of DNA triplex structures in the gas phase is well-defined over the experimental time scale, with the three strands tightly bound, and for the most abundant charge states it samples conformations only slightly more compact than the solution structure. The degree of structural alteration is however very significant, mimicking that found in duplex and much larger than that suggested for G-quadruplexes. Our data strongly supports that the gas phase triplex maintains an excellent memory of the solution structure, well-preserved helicity, and a significant number of native contacts. Once again, a linear, flexible, and charged polymer as DNA surprises us for its ability to retain three-dimensional structure in the absence of solvent. Results argue against the generally assumed roles of the different physical interactions (solvent screening of phosphate repulsion, hydrophobic effect, and solvation of accessible polar groups) in modulating the stability of DNA structures.     

Theoretical studies of d(A:T)-based parallel-stranded DNA duplexes.

Poly d(A:T) parallel-stranded DNA duplexes based on the Hoogsteen and reverse Watson-Crick hydrogen bond pairing are studied by means of extensive molecular dynamics (MD) simulations and molecular mechanics coupled to Poisson-Boltzmann (MM-PB/SA) calculations. The structural, flexibility, and reactivity characteristics of Hoogsteen and reverse Watson-Crick parallel duplexes are described from the analysis of the trajectories. Theoretical calculations show that the two parallel duplexes are less stable than the antiparallel Watson-Crick duplex. The difference in stability between antiparallel and parallel duplexes increases steadily as the length of the duplex increases. The reverse Watson-Crick arrangement is slightly more stable than the Hoogsteen duplex, the difference being also increased linearly with the length of the duplex. A subtle balance of intramolecular and solvation terms is responsible for the preference of a given helical structure.     

Evaluation of effects of bivalent cations on the formation of purine-rich triple-helix DNA by ESI-FT-MS

The GGA triplet repeats are widely dispersed throughout eukaryotic genomes. (GGA)n or (GGT)n oligonucleotides can interact with double-stranded DNA containing (GGA:CCT)n to form triple-stranded DNA. The effects of 8 divalent metal ions (3 alkaline-earth metals and 5 transition metals) on formation of these purine-rich triple-helix DNA were investigated by electrospray ionization Fourier transform ion cyclotron resonance mass spectrometry (ESI-FT-MS). In the absence of metal ions, no triplex but single-strand, duplex, and purine homodimer ions were observed in mass spectra. The triple-helix DNA complexes were observed only in the presence of certain divalent ions. The effects of different divalent cations on the formation of purine-rich triplexes were compared. Transition-metal ions, especially Co²⁺ and Ni²⁺, significantly boost the formation of triple-helix DNA, whereas alkaline-earth metal ions have no positive effects on triplex formation. In addition, Ba²⁺ is notably beneficial to the formation of homodimer instead of triplex.     

Polycation comb-type copolymer reduces counterion condensation effect to stabilize DNA duplex and triplex formation

We have previously demonstrated that the polycation comb-type copolymer having abundant grafts of hydrophilic polymer chains significantly stabilizes DNA duplexes and triplexes [Maruyama et al., Bioconjugate Chem., 8 (1997) 3, Ferdous et al., Nucleic Acids Res., 26 (1998) 39]. This study was designed to estimate the mechanisms involved in the copolymer-mediated stabilization of DNA duplexes and triplexes. The melting temperatures, T_m, of DNA duplex and triplex increased with increasing salt concentration, as well documented by the Poisson–Boltzmann and counterion condensation theories that were originally proposed by Manning [J. Chem. Phys., 51 (1969) 924] and further elaborated by Manning [Biopolymers 11 (1972) 937, Biopolymers. 15 (1976) 2385] and Record [Biopolymers, 14 (1975) 2137–2158, Biopolymers, 15 (1976) 893]. In the presence of the copolymer, however, the T_m values of DNA duplexes and triplexes did not show significant change with salt concentration. It was concluded that the copolymer is capable of reducing the counterion condensation effects to stabilize DNA duplexes and triplexes. Strong but exchangeable interaction between the copolymer and DNA is seemingly involved in the stabilization behavior.