Microhydration of Guanine base pairs

We report spectroscopy of clusters of guanine base pairs with one and two water molecules. We recorded the vibronic spectra of the mass-selected GG(H2O) and GG(H2O)2 clusters using resonant two photon ionization (R2PI) and we used IR-UV double resonance spectroscopy to obtain ground state IR spectra of these clusters. We found that a single water molecule stabilizes one of two structures we had previously found for guanine dimers. Addition of a second water molecule causes no further structural change.     

Oxidation of guanine in G, GG, and GGG sequence contexts by aromatic pyrenyl radical cations and carbonate radical anions: relationship between kinetics and distribution of alkali-labile lesions

Oxidatively generated DNA damage induced by the aromatic radical cation of the pyrene derivative 7,8,9,10-tetrahydroxytetrahydrobenzo[a]pyrene (BPT), and by carbonate radicals anions, was monitored from the initial one-electron transfer, or hole injection step, to the formation of hot alkali-labile chemical end-products monitored by gel electrophoresis. The fractions of BPT molecules bound to double-stranded 20-35-mer oligonucleotides with noncontiguous guanines G and grouped as contiguous GG and GGG sequences were determined by a fluorescence quenching method. Utilizing intense nanosecond 355 nm Nd:YAG laser pulses, the DNA-bound BPT molecules were photoionized to BPT*+ radicals by a consecutive two-photon ionization mechanism. The BPT*+ radicals thus generated within the duplexes selectively oxidize guanine by intraduplex electron-transfer reactions, and the rate constants of these reactions follow the trend 5'-..GGG.. > 5'-..GG.. > 5'-..G... In the case of CO3*- radicals, the oxidation of guanine occurs by intermolecular collision pathways, and the bimolecular rate constants are independent of base sequence context. However, the distributions of the end-products generated by CO3*- radicals, as well as by BPT*+, are base sequence context-dependent and are greater than those in isolated guanines at the 5'-G in 5'-...GG... sequences, and the first two 5'- guanines in the 5'-..GGG sequences. These results help to clarify the conditions that lead to a similar or different base sequence dependence of the initial hole injection step and the final distribution of oxidized, alkali-labile guanine products. In the case of the intermolecular one-electron oxidant CO3*-, the rate constant of hole injection is similar for contiguous and isolated guanines, but the subsequent equilibration of holes by hopping favors trapping and product formation at contiguous guanines, and the sequence dependence of these two phenomena are not correlated. In contrast, in the case of the DNA-bound oxidant BPT*+, the hole injection rate constants, as well as hole equilibration, exhibit a similar dependence on base sequence context, and are thus correlated to one another.     

15N NMR study on site-selective binding of metal ions to guanine runs in DNA: a good correlation with HOMO distribution

15N NMR of DNA containing 15N-N7-enriched guanine (G) in the presence of paramagnetic ions (Mn(II) and Co(II)) was investigated. As the concentration of metal ion was increased, 15N NMR signals of the 5'G of GG and the middle G of GGG broadened site-selectively, indicating that electron-donating sites in G runs preferentially localize on the 5'G of GG and the middle G of GGG. The selectivity for G-metal ion interaction observed in this study was in good agreement with calculated HOMO distribution of G runs.     

Dynamics of inter- and intrastrand hole transport in DNA hairpins

The dynamics of photoinduced electron transfer has been investigated in DNA hairpins possessing a stilbenedicarboxamide (Sa) electron acceptor, a guanine (G) primary donor, and two adjacent guanines (GG) as secondary donors. Hole transport from G to GG across a single A is more rapid than across AA or T by factors of 20 +/- 7 and 40 +/- 15, respectively. Intrastrand hole transport across a single A is more rapid than interstrand transport by a factor of 7 +/- 3.     

Role of the guanine N1 imino proton in the migration and reaction of radical cations in DNA oligomers

Oxidation of a guanine nucleobase to its radical cation in DNA oligomers causes an increase in the acidity of the N1 imino proton that may lead to its spontaneous transfer to N3 of the paired cytosine. This proton transfer is suspected of playing an important role in long-distance radical cation hopping in DNA and the decisive product-determining role in the reaction of the radical cation with H2O or O2. We prepared and investigated DNA oligomers in which certain deoxycytidines are replaced by 5-fluoro-2'-deoxycytidines (F5dC). The pKa of F5C was determined to be 1.7 units below that of dC, which causes proton transfer from the guanine radical cation to be thermodynamically unfavorable. Photoinitiated one-electron oxidation of the DNA by UV irradiation of a covalently attached anthraquinone derivative introduces a radical cation that hops throughout the oligomer and is trapped selectively at GG steps. The introduction of F5dC does not affect the efficiency of charge hopping, but it significantly reduces the amount of reaction at the GG sites, as revealed by subsequent reaction with formamidopyrimidine glycosylase. These findings suggest that transfer of the guanine radical cation N1 proton to cytosine does not play a significant role in long-range charge transfer, but this process does influence the reactions with H2O and/or O2.     

Influence of intervening mismatches on long-range guanine oxidation in DNA duplexes

A systematic investigation of the efficiency of oxidative damage at guanine residues through long-range charge transport was carried out as a function of intervening base mismatches. A series of DNA oligonucleotides were synthesized that incorporate a ruthenium intercalator linked covalently to the 5' terminus of one strand and containing two 5'-GG-3' sites in the complementary strand. Single base mismatches were introduced between the two guanine doublet steps, and the efficiency of transport through the mismatches was determined through measurements of the ratio of oxidative damage at the guanine doublets distal versus proximal to the intercalated ruthenium oxidant. Differing relative extents of guanine oxidation were observed for the different mismatches. The damage ratio of oxidation at the distal versus proximal site for the duplexes containing different mismatches varies in the order GC approximately GG approximately GT approximately GA > AA > CC approximately TT approximately CA approximately CT. For all assemblies, damage found with the Delta-Ru diastereomer was found to be greater than with the Lambda-diastereomer. The extent of distal/proximal guanine oxidation in different mismatch-containing duplexes was compared with the helical stability of the duplexes, electrochemical data for intercalator reduction on different mismatch-containing DNA films, and base-pair lifetimes for oligomers containing the different mismatches derived from 1H NMR measurements of the imino proton exchange rates. While a clear correlation is evident both with helix stability and electrochemical data monitoring reduction of an intercalator through DNA films, damage ratios correlate most closely with base-pair lifetimes. Competitive hole trapping at the mismatch site does not appear to be a key factor governing the efficiency of transport through the mismatch. These results underscore the importance of base dynamics in modulating long-range charge transport through the DNA base-pair stack.     

Kinetic Analysis of the Reactions between GG-Containing Oligonucleotides and Platinum Complexes. 1. Reactions of Single-Stranded Oligonucleotides with cis-[Pt(NH(3))(2)(H(2)O)(2)](2+) and [Pt(NH(3))(3)(H(2)O)](2+)

Using concentration measurements based on high performance liquid chromatography, we have investigated the kinetics of reaction between single-stranded oligonucleotides containing a d(GpG) sequence, i.e., d(GG), d(TGG), d(TTGG), and d(CTGGCTCA), and the platinum complexes cis-[Pt(NH(3))(2)(H(2)O)(2)](2+) (1) and [Pt(NH(3))(3)(H(2)O)](2+) (2). The rate constants for the substitution of one aqua ligand of platinum in 1 or 2 by each guanine of the oligonucleotides were individually measured, as well as, for 1, those for the subsequent conversion of the monoadducts to the diadduct. For the platination of d(GG) and d(TGG), the rate constants are similar for the 5'- and 3'-guanines. The longer oligonucleotides d(TTGG) and d(CTGGCTCA) are platinated slightly faster on the 5'-G than on the 3'-G. 2 shows a similar slight preference for the 5'-guanine, but it reacts by a factor of 4-10 more slowly than 1. For both complexes, the platination rate constants increase with increasing oligonucleotide length. Platination of the 5'-G by 1 is 1 order of magnitude faster on d(CTGGCTCA) than on d(GG). Concerning the chelation step giving the GG diadduct of 1, the longer the oligonucleotide, the larger is the ratio between the rates of the cyclization of the 3'- and 5'-monoadducts k(3)(')(c) and k(5)(')(c): k(3)(')(c)/k(5)(')(c) equals 1.4 for d(GG) and 3.3 for d(CTGGCTCA).     

Guanine of the third strand of C.G*G triplex serves as an effective hole trap

We have examined the structural and electronic effects of the one-electron oxidation of the C.GG triplex, where G is located in a quite different environment from the G of duplex DNA. Upon photoirradiation of an external photosensitizer (riboflavin) with the C.GG triplex, oxidative DNA cleavage occurred exclusively at guanine repeat sequences in the third strand of triple helix DNA. Hole transport through the C.GG triplex also occurred, resulting in selective cleavage at G in the third strand. Thus, the hole generated in the duplex can migrate to GGG in the third strand and is trapped exclusively at Gs in the third strand. These experimental results, together with molecular orbital calculations, suggest that the origin of the selective strand cleavage can be explained as follows: (i) guanine repeat sequences in the third strand are more easily oxidized than in duplex DNA and (ii) in their radical cation states, G of the third strand rapidly deprotonates and reacts with oxygen and/or water, leading to strand cleavage. These results indicate that the oxidative damage preferentially occurred at Gs of the third strand owing to thermodynamic and kinetic features of the one-electron oxidation of the C.GG triplex.     

Photocontrolled DNA binding of a receptor-targeted organometallic ruthenium(II) complex

A photoactivated ruthenium(II) arene complex has been conjugated to two receptor-binding peptides, a dicarba analogue of octreotide and the Arg-Gly-Asp (RGD) tripeptide. These peptides can act as "tumor-targeting devices" since their receptors are overexpressed on the membranes of tumor cells. Both ruthenium-peptide conjugates are stable in aqueous solution in the dark, but upon irradiation with visible light, the pyridyl-derivatized peptides were selectively photodissociated from the ruthenium complex, as inferred by UV-vis and NMR spectroscopy. Importantly, the reactive aqua species generated from the conjugates, [(η(6)-p-cym)Ru(bpm)(H(2)O)](2+), reacted with the model DNA nucleobase 9-ethylguanine as well as with guanines of two DNA sequences, (5')dCATGGCT and (5')dAGCCATG. Interestingly, when irradiation was performed in the presence of the oligonucleotides, a new ruthenium adduct involving both guanines was formed as a consequence of the photodriven loss of p-cymene from the two monofunctional adducts. The release of the arene ligand and the formation of a ruthenated product with a multidentate binding mode might have important implications for the biological activity of such photoactivated ruthenium(II) arene complexes. Finally, photoreactions with the peptide-oligonucleotide hybrid, Phac-His-Gly-Met-linker-p(5')dCATGGCT, also led to arene release and to guanine adducts, including a GG chelate. The lack of interaction with the peptide fragment confirms the preference of such organometallic ruthenium(II) complexes for guanine over other potential biological ligands, such as histidine or methionine amino acids.     

Charge hopping in DNA.

The efficiency of charge migration through stacked Watson-Crick base pairs is analyzed for coherent hole motion interrupted by localization on guanine (G) bases. Our analysis rests on recent experiments, which demonstrate the competition of hole hopping transitions between nearest neighbor G bases and a chemical reaction of the cation G(+) with water. In addition, it has been assumed that the presence of units with several adjacent stacked G bases on the same strand leads to the additional vibronic relaxation process (G(+)G...G) --> (GG...G)(+). The latter may also compete with the hole transfer from (G(+)G...G) to a single G site, depending on the relative positions of energy levels for G(+) and (G(+)G...G). A hopping model is proposed to take the competition of these three rate steps into account. It is shown that the model includes two important limits. One corresponds to the situation where the charge relaxation inside a multiple guanine unit is faster than hopping. In this case hopping is terminated by several adjacent G bases located on the same strand, as has been observed for the GGG triple. In the opposite, slow relaxation limit the GG...G unit allows a hole to migrate further in accord with experiments on strand cleavage exploiting GG pairs. We demonstrate that for base pair sequences with only the GGG triple, the fast relaxation limit of our model yields practically the same sequence- and distance dependencies as measurements, without invoking adjustable parameters. For sequences with a certain number of repeating adenine:thymine pairs between neighboring G bases, our analysis predicts that the hole transfer efficiency varies in inverse proportion to the sequence length for short sequences, with change to slow exponential decay for longer sequences. Calculations performed within the slow relaxation limit enable us to specify parameters that provide a reasonable fit of our numerical results to the hole migration efficiency deduced from experiments with sequences containing GG pairs. The relation of the results obtained to other theoretical and experimental studies of charge transfer in DNA is discussed. We propose experiments to gain a deeper insight into complicated kinetics of charge-transfer hopping in DNA.     

Hole traps in DNA.

Sequences of guanines, GG and GGG, are known to be readily oxidized, forming radical cations, i.e., hole traps, on DNA. The trapping probability of GG is less than that of GGG. Lewis et al. (J. Am. Chem. Soc. 2000, 122, 12037) have used measurements on synthetic hairpins to determine the free energy liberated when a hole goes from the radical cation G(+) to GG or to GGG. They find these free energies to be of the order of thermal energy at room temperature, in contradiction to the expectation by many of much greater trap depths. We have calculated the wave function of a hole on G, on GG, and on GGG surrounded by adenines, as in the Lewis et al. experiments, using a simple tight-binding model. We find that to account for the shallow traps found by them it is necessary that the difference in ionization potentials of contiguous guanine and adenine be smaller by about 0.2 eV than the 0.4 eV found for isolated bases. Using this value and taking into account polaron formation, we find the wave functions of holes trapped on G, GG, or GGG to extend over approximately 6 sites (bases) and with energy level differences in good agreement with the values found by Lewis et al.     

Mechanisms of formation of 8-oxoguanine due to reactions of one and two OH* radicals and the H2O2 molecule with guanine: A quantum computational study

Mechanisms of formation of the mutagenic product 8-oxoguanine (8OG) due to reactions of guanine with two separate OH* radicals and with H2O2 were investigated at the B3LYP/6-31G, B3LYP/6-311++G, and B3LYP/AUG-cc-pVDZ levels of theory. Single point energy calculations were carried out with the MP2/AUG-cc-pVDZ method employing the optimized geometries at the B3LYP/AUG-cc-pVDZ level. Solvent effect was treated using the PCM and IEF-PCM models. Reactions of two separate OH* radicals and H2O2 with the C2 position of 5-methylimidazole (5MI) were investigated taking 5MI as a model to study reactions at the C8 position of guanine. The addition reaction of an OH* radical at the C8 position of guanine is found to be nearly barrierless while the corresponding adduct is quite stable. The reaction of a second OH* radical at the C8 position of guanine leading to the formation of 8OG complexed with a water molecule can take place according to two different mechanisms, involving two steps each. According to one mechanism, at the first step, 8-hydroxyguanine (8OHG) complexed with a water molecule is formed ,while at the second step, 8OHG is tautomerized to 8OG. In the other mechanism, at the first step, an intermediate complexed (IC) with a water molecule is formed, the five-membered ring of which is open, while at the second step, the five-membered ring is closed and a hydrogen bonded complex of 8OG with a water molecule is formed. The reaction of H2O2 with guanine leading to the formation of 8OG complexed with a water molecule can also take place in accordance with two different mechanisms having two steps each. At the first step of one mechanism, H2O2 is dissociated into two OH* groups that react with guanine to form the same IC as that formed in the reaction with two separate OH* radicals, and the subsequent step of this mechanism is also the same as that of the reaction of guanine with two separate OH* radicals. At the first step of the other mechanism of the reaction of guanine with H2O2, the latter molecule is dissociated into a hydrogen atom and an OOH* group which become bonded to the N7 and C8 atoms of guanine, respectively. At the second step of this mechanism, the OOH* group is dissociated into an oxygen atom and an OH* group, the former becomes bonded to the C8 atom of guanine while the latter abstracts the H8 atom bonded to C8, thus producing 8OG complexed with a water molecule. Solvent effects of the aqueous medium on certain reaction barriers and released energies are appreciable. 5MI works as a satisfactory model for a qualitative study of the reactions of two separate OH* radicals or H2O2 occurring at the C8 position of guanine.     

Kinetic analysis of the stepwise formation of a long-range DNA interstrand cross-link by a dinuclear platinum antitumor complex: evidence for aquated intermediates and formation of both kinetically and thermodynamically controlled conformers.

Reported here is a detailed study of the kinetics and mechanism of formation of a 1,4 GG interstrand cross-link by [(trans-PtCl(NH(3))(2))(2)(mu-NH(2)(CH(2))(n)NH(2))](2+) (1,1/t,t (n = 6), 1), the prototype of a novel class of platinum antitumor complexes. The reaction of the self-complementary 12-mer duplex 5'-[d(ATATGTACATAT)(2)] with (15)N-1 has been studied at 298 K, pH 5.4, by [(1)H,(15)N] HSQC 2D NMR spectroscopy. Initial electrostatic interactions with the duplex are observed for 1 and the monoaqua monochloro species (2). Aquation of 1 to yield 2 occurs with a pseudo-first-order rate constant of (4.15 +/- 0.04) x 10(-5) s(-1). 2 then undergoes monofunctional binding to the guanine N7 of the duplex to form 3 (G/Cl) with a rate constant of 0.47 +/- 0.06 M(-(1) s(-1). There is an electrostatic interaction between the unbound [PtN(3)Cl] group of 3 and the duplex, which is consistent with H-bonding interactions observed in the molecular model of the monofunctional (G/Cl) adduct. Closure of 3 to form the 1,4 GG interstrand cross-link (5) most likely proceeds via the aquated (G/H(2)O) intermediate (4) (pseudo-first-order rate constant = (3.62 +/- 0.04) x 10(-5) s(-1)) followed by closure of 4 to form 5 (rate constant = (2.7 +/- 1.5) x 10(-3) s(-1)). When closure is treated as direct from 3 (G/Cl) the rate constant is (3.39 +/- 0.04) x 10(-5) s(-1). Closure is ca. 10-55-fold faster than that found for 1,2 GG intrastrand cross-link formation by the diaqua form of cisplatin. Changes in the (1)H and (15)N shifts of the interstrand cross-link 5 indicate that the initially formed conformer (5(i)) converts irreversibly into other product conformer(s) 5(f). The NMR data for 5(i) are consistent with a molecular model of the 1,4 GG interstrand cross-link on B-form DNA, which shows that the NH(2) protons have no contacts except with solvent. The NMR data for 5(f) show several distinct NH(2) environments indicative of interactions between the NH(2) protons and the DNA. HPLC characterization of the final product showed only one major product peak that was confirmed by ESI-FTICR mass spectroscopy to be a cross-linked adduct of (15)N-1 and the duplex. The potential significance of these findings to the antitumor activity of dinuclear platinum complexes is discussed.     

One-electron oxidation of DNA oligomers that lack guanine: reaction and strand cleavage at remote thymines by long-distance radical cation hopping

The anthraquinone (AQ) photosensitized one-electron oxidation of DNA introduces a radical cation (electron "hole") that migrates through the duplex by hopping. The radical cation normally is trapped irreversibly by reaction at guanine. We constructed AQ-linked DNA oligomers composed exclusively of A/T base pairs. Their irradiation led to reaction and strand cleavage primarily at thymines. Long-distance radical cation hopping to distant thymines was demonstrated by the distance dependence of the process and by experiments with DNA oligomers that contain a single remote GG step. The reaction of the radical cation at thymine was shown to involve its 5-methyl group by the replacement of selected thymines with uracils. These findings show that the reactivity of radical cations in DNA cannot be explained simply by exclusive reliance on the relative oxidation potential of the nucleobases. Instead, the site of reaction is determined in accord with the Curtin-Hammett principle for reactive species in rapid equilibrium.     

A New Pathway of DNA G‐Quadruplex Formation

A new folding intermediate of Oxytricha nova telomeric Oxy‐1.5 G‐quadruplex was characterized in aqueous solution using NMR spectroscopy, native gel electrophoresis, thermal differential spectra (TDS), CD spectroscopy, and differential scanning calorimetry (DSC). NMR experiments have revealed that this intermediate (i‐Oxy‐1.5) exists in two symmetric bimolecular forms in which all guanine bases are involved in GG N1‐carbonyl symmetric base pairs. Kinetic analysis of K⁺‐induced structural transitions shows that folding of Oxy‐1.5 G‐quadruplex from i‐Oxy‐1.5 is much faster and proceeds through less intermediates than folding from single strands. Therefore, a new folding pathway of Oxy‐1.5 G‐quadruplex is proposed. This study provides evidence that G‐rich DNA sequences can self‐assemble into specific pre‐organized DNA structures that are predisposed to fold into G‐quadruplex when interacting with cations such as potassium ions.     

One-electron oxidation of DNA: the effect of replacement of cytosine with 5-methylcytosine on long-distance radical cation transport and reaction

One-electron oxidation of duplex DNA generates a radical cation that migrates through the nucleobases until it is trapped by an irreversible reaction with water or oxygen. The trapping site is often a GG step, because this site has a relatively low ionization potential and this causes the radical cation to pause there momentarily. Modifications to guanine that lower its ionization potential convert it to a better trap for the radical cation. One such modification is the formation of the Watson-Crick base pair with cytosine, which is reported to very significantly decrease its ionization potential. Methylation of cytosine to form 5-methylcytosine (5-MeC) is a naturally occurring reaction in genomic DNA that may be associated with regions of enhanced oxidative damage. The G.5-MeC base pair is reported to be more rapidly oxidized than normal G.C base pairs. We examined the oxidation of DNA oligomers that were substituted in part with 5-MeC. Irradiation of a covalently linked anthraquinone group injects a radical cation into the DNA and results in strand cleavage after piperidine treatment. For the sequences examined, substitution of 5-MeC for C has no measurable effect on the reactions. Cytosine methylation is not a general cause of enhanced oxidative damage in DNA.     

Electrochemical determination of triple helices: electrocatalytic oxidation of guanine in an intramolecular triplex

Electrocatalytic oxidation of the oligonucleotide 5'- GAA GAG GTT TTT CCT CTT CTT TTT CTT CTC C (TS) by Ru(bpy)(3)(2+) was studied by cyclic voltammetry. This oligonucleotide forms either an intramolecular triplex, hairpin, or single strand, depending on the pH (Plum, G. E.; Breslauer, K. J. J. Mol. Biol. 1995, 248, 679-695). In the triplex form, the guanine doublet in TS is buried inside the folded structure, and as such is less susceptible to oxidation by electrogenerated Ru(bpy)(3)(3+). Digital simulations of the catalytic voltammograms gave a rate constant of 3.5 +/- 0.2 x 10(2) M(-1) s(-1) for oxidation of the triplex form, while oxidation of the duplex and single-stranded forms occurred with much faster rate constants of (3.5-9.1) x 10(4) M(-1) s(-1). Experiments using a truncated form of TS that lacked the third strand of the triplex were consistent with these measurements. The Ru(bpy)(3)(3+) complex was also generated by photolyzing Ru(bpy)(3)(2+) in the presence of Fe(CN)(6)(3-). This reaction produced strand scission following piperidine treatment, which was visualized using high-resolution gel electrophoresis. These experiments showed decreased reactivity for the triplex form, and also gave an unusual reversal of a common selectivity for the 5'-G of GG doublets generally seen in B-form DNA. This reversal was ascribed to strain caused by the location of the GG doublet adjacent to the hairpin loop.     

A DFT study of a novel oxime anticancer trans platinum complex: Monofunctional and bifunctional binding to purine bases

The first and second substitution reactions binding of the anticancer drug trans‐[Pt((CH₃)₂C?NOH)((CH₃)₂CHNH₂)Cl₂] to purine bases were studied computationally using a combination of density functional theory and isoelectric focusing polarized continuum model approach. Our calculations demonstrate that the trans monoaqua and diaqua reactant complexes (RCs) can generate either trans‐ or cis‐monoadducts via identical or very similar trans trigonal‐bipyramidal transition‐state structures. Furthermore, these monoadducts can subsequently close by coordination to the adjacent purine bases to form 1,2‐intrastrand Pt‐DNA adducts and eventually distort DNA in the same way as cisplatin. Thus, it is likely that the transplatin analogues have the same mechanism of anticancer activity as cisplatin. For the first substitutions, the activation free energies of monoaqua complexes are always lower than that of diaqua complexes. The lowest activation energy for monoaqua substitutions is 16.2 kcal/mol for guanine and 16.5 kcal/mol for adenine, whereas the lowest activation energy for diaqua substitutions is 17.1 kcal/mol for guanine and 25.9 kcal/mol for adenine. For the second substitutions, the lowest activation energy from trans‐monoadduct to trans‐diadduct is 19.1 kcal/mol for GG adduct and 20.7 kcal/mol for GA adduct, whereas the lowest activation energy from cis‐monoadduct to cis‐diadduct is 18.9 kcal/mol for GG adduct and 18.5 kcal/mol for GA adduct. In addition, the first and second substitutions prefer guanine over adenine, which is explained by the remarkable larger complexation energy for the initial RC in combination with lower activation energy for the guanine substitution. Overall, the hydrogen‐bonds play an important role in stabilizing these species of the first and second substitutions. © 2010 Wiley Periodicals, Inc. Int J Quantum Chem, 2011     

Second-order Møller-Plesset calculations on the water molecule using Gaussian-type orbital and Gaussian-type geminal theory

The Gaussian-type orbital and Gaussian-type geminal (GGn) model is applied to the water molecule, at the level of second-order M?ller-Plesset (MP2) theory. In GGn theory, correlation factors are attached to all doubly-occupied orbital pairs (GG0), to all doubly-occupied and singly-excited pairs (GG1), or to all orbital pairs (GG2). Optimizing the GG2 model using a weak-orthogonality functional, we obtain the current best estimate of the all-electron MP2 correlation energy of water, -361.95 mE(h). In agreement with previous observations, the GG1 model performs almost as well as the GG2 model (-361.26 mE(h)), whereas the GG0 model is poorer (-351.36 mE(h)). For the barrier to linearity of water, we obtain an MP2 correlation contribution of -463 +/- 5 cm(-1).     

Internal versus terminal metalation of double-helical oligodeoxyribonucleotides

The formation of adducts between cis-[Pt(NH(3))(2)Cl(2)], Zn(II), and Mn(II) and double-stranded oligodeoxynucleotides was studied by 1D and 2D (1)H, (31)P, and (15)N NMR spectroscopy. For labile adducts involving Zn(II) and Mn(II), both (1)H chemical shifts (Zn(II)) and (1)H line-broadening effects (Mn(II)) showed that in the hexamer [d(GGCGCC)](2) I, the terminal G(1)-N7 is the exclusive binding site, while for the dodecamer [d(GGTACCGGTACC)](2) II, which contains both a terminal and internal GG pair, the preference for metal binding is the internal guanine G(7). Zn(II) binding to II was confirmed by natural-abundance 2D [(1)H,(15)N] HMBC NMR spectroscopy, which unambiguously showed that G(7)-N7 is the preferred binding site. The long duplex [d(GGTATATATACCGGTATATATACC)](2) III was expected to have a more pronounced accumulation of electrostatic potential towards the central part of the sequence (vs the terminal part) than does II. However, the Zn(II) titration of III showed no increase in coordination with the internal Gs (vs the terminal Gs), compared with what was observed for II. The reaction between the nonlabile metal complex cis-[PtCl(2)((15)NH(3))(2)] (cisplatin) and II showed a slight preference for the internal GG pair over the terminal GG pair. However, when the diaqua form of cisplatin cis-[Pt((15)NH(3))(2)(H(2)O)(2)] was reacted with II a more pronounced binding preference for the internal GG pair was observed.