Probing helix formation in unsolvated peptides

Ion mobility measurements have been used to examine helix formation in unsolvated glycine-based peptides containing three alanine residues. Nine sequence isomers of Ac-[12G3A]K+H(+) were studied (Ac = acetyl, G = glycine, A = alanine, and K = lysine). The amount of helix present for each peptide was examined using two metrics, and it is strongly dependent on the proximity and the location of the alanine residues. Peptides with three adjacent alanines have the highest helix abundances, and those with well-separated alanines have the lowest. The helix abundances for most of the peptides can be fit reasonably well using a modified Lifson-Roig theory. However, Lifson-Roig theory fails to account for several key features of the experimental results. The most likely explanation for the correlation between helix abundances and the number of adjacent alanines is that neighboring alanines promote helix nucleation.     

Synthesis of helix 69 of Escherichia coli 23S rRNA containing its natural modified nucleosides,m(3)Psi and Psi

The synthesis of 3-methylpseudouridine (m(3)Psi) phosphoramidite, 5'-O-[benzhydryloxybis(trimethylsilyloxy)silyl]-2'-O-[bis(2-acetoxyethoxy)methyl]-3-methylpseudouridine-3'-(methyl-N,N-diisopropyl)phosphoramidite, is reported. Selective pivaloyloxymethyl protection of the Psi N1 followed by methylation at N3 was used to generate the naturally occurring pseudouridine analogue. The m(3)Psi phosphoramidite was used in combination with pseudouridine (Psi) and standard base phosphoramidites to synthesize a 19-nucleotide RNA representing helix 69 of Escherichia coli 23S ribosomal RNA (rRNA) (residues 1906-1924), containing a single m(3)Psi at position 1915 and two Psi's at positions 1911 and 1917. Our synthesis of the fully modified helix 69 RNA demonstrates the ability to make milligram quantities of RNA that can be used for further high-resolution structure studies. Site-selective introduction of the methyl group at the N3 position of pseudouridine at position 1915 causes a slight increase in the thermodynamic stability of the RNA hairpin relative to pseudouridine; RNAs containing either uridine or 3-methyluridine at position 1915 have similar stability. One-dimensional imino proton NMR and circular dichroism spectra of the modified RNAs reveal that the methyl group does not cause any substantial changes in the RNA hairpin structure.     

Surface energy modified chips for detection of conformational states and enzymatic activity in biomolecules

A novel patterning method for anchoring biomolecules and noncovalent assembled conjugated polyelectrolyte (CPE)/biomolecule complexes to a chip surface is presented. The surface energy of a hydrophilic substrate is modified using an elastomeric poly(dimethylsiloxane) (PDMS) stamp, containing a relief pattern. Modification takes place on the parts where the PDMS stamp is in conformal contact with the substrate and leaves low molecular weight PDMS residues on the surface resulting in a hydrophobic modification, and then biomolecules and CPE/biomolecule complexes are then adsorbed in a specific pattern. The method constitutes a discrimination system for different conformations in biomolecules using CPEs as reporters and the PDMS modified substrates as the discriminator. Detection of different conformations in two biomacromolecules, a synthetic peptide (JR2E) and a protein (calmodulin), reported by the CPE and resolved by fluorescence was demonstrated. Also, excellent enzyme activity in patterned CPE/horseradish peroxidase (HRP) enzyme was shown, demonstrating that this method can be used to pattern biomolecules with their activity retained. The method presented could be useful in various biochip applications, such as analyzing proteins and peptides in large-scale production, in making metabolic chips, and for making multi-microarrays.     

Probing the kinetics of membrane-mediated helix folding

The kinetics of peptide-membrane association have been studied previously using stopped-flow tryptophan fluorescence; however, such experiments do not directly report the coil-to-helix transition process, which is a hallmark of peptide-membrane interaction. Herein, we report a new method for directly assessing the kinetics of the helix formation accompanied by the peptide-membrane association. This method is based on the technique of fluorescence resonance energy transfer (FRET) and an amino acid FRET pair, p-cyano-L-phenylalanine and tryptophan. To demonstrate the utility of this method, we have studied the membrane-mediated helix folding dynamics of a mutant of magainin 2, an antibiotic peptide found in the skin of the African clawed frog, Xenopus laevis. Our results indicate that the coil-to-helix transition occurs during the binding of the peptide to the lipid vesicle (1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine/1-palmitoyl-2-oleoyl-sn-glycero-3-[phospho-rac-(1-glycerol)], 3:1, wt/wt) but prior to the full insertion of the peptide into the hydrophobic region of the lipid bilayers.     

Multiple conformational states in crystals and in solution in alphagamma hybrid peptides. Fragility of the C12 helix in short sequences

The conformational properties of foldamers generated from alphagamma hybrid peptide sequences have been probed in the model sequence Boc-Aib-Gpn-Aib-Gpn-NHMe. The choice of alpha-aminoisobutyryl (Aib) and gabapentin (Gpn) residues greatly restricts sterically accessible conformational space. This model sequence was anticipated to be a short segment of the alphagamma C12 helix, stabilized by three successive 4-->1 hydrogen bonds, corresponding to a backbone-expanded analogue of the alpha polypeptide 3(10)-helix. Unexpectedly, three distinct crystalline polymorphs were characterized in the solid state by X-ray diffraction. In one form, two successive C12 hydrogen bonds were obtained at the N-terminus, while a novel C17 hydrogen-bonded gamma alpha gamma turn was observed at the C-terminus. In the other two polymorphs, isolated C9 and C7 hydrogen-bonded turns were observed at Gpn (2) and Gpn (4). Isolated C12 and C9 turns were also crystallographically established in the peptides Boc-Aib-Gpn-Aib-OMe and Boc-Gpn-Aib-NHMe, respectively. Selective line broadening of NH resonances and the observation of medium range NH(i) <--> NH(i+2) NOEs established the presence of conformational heterogeneity for the tetrapeptide in CDCl3 solution. The NMR results are consistent with the limited population of the continuous C12 helix conformation. Lengthening of the (alphagamma) n sequences in the nonapeptides Boc-Aib-Gpn-Aib-Gpn-Aib-Gpn-Aib-Gpn-Xxx (Xxx = Aib, Leu) resulted in the observation of all of the sequential NOEs characteristic of an alphagamma C12 helix. These results establish that conformational fragility is manifested in short hybrid alphagamma sequences despite the choice of conformationally constrained residues, while stable helices are formed on chain extension.     

Pseudouridines in rRNA helix 69 play a role in loop stacking interactions

The (1)H NMR spectra of RNAs representing E. coli 23S rRNA helix 69 with [1,3-(15)N]pseudouridine modification at specific sites reveal unique roles for pseudouridine in stabilizing base-stacking interactions in the hairpin loop region.     

Probing vibrational wave packets in molecular excited states

A time-dependent theoretical method is used to describe a UV pump?CUV probe strategy to trace, at a femtosecond time scale, the motion of vibrational wave packets created in excited states of the hydrogen molecule by measuring single ionization probabilities. We use a spectral method to solve the time-dependent Schr?dinger equation in full dimensionality, including correlation and all electronic and vibrational degrees of freedom. A pump pulse initially creates a vibrational wave packet in the intermediate electronic excited states of $\hbox{H}_2$ . The frequency of the probe is chosen to ionize the target leaving the ion in a bound vibrational state. By varying the time delay between pulses, non-dissociative single ionization is enhanced or suppressed. Energy differential ionization probabilities are reported and compared with a model based on the Franck?CCondon approximation.     

Probing hydrogen bonding in a DNA triple helix using protium-deuterium fractionation factors

In this communication we report protium-deuterium fractionation factors for the intramolecular triple helix formed by the DNA oligonucleotide 5'-d(AGAGAGAACCCCTTCTCTCTTTTTCTCTCTT)-3'. The fractionation factors of individual Watson-Crick and Hoogsteen hydrogen bonds in the structure are measured by NMR spectroscopy. The results show that, in contrast to proteins, the fractionation factors are all equal or lower than unity. On the average, the values of the fractionation factors are centered between 0.6 and 0.8, and no significant differences are observed between Hoogsteen and Watson-Crick hydrogen bonds. Deviations from the average are observed for the 5'-end region of the molecule where a base triad is absent and the structure is strained by the intramolecular folding of the DNA strand.     

Characterization of protein conformational states by normal-mode frequencies

Conformational change in polymers including proteins is central to many molecular processes. Defining conformational states, however, remains a difficult and increasingly common problem, with many existing methods based on arbitrary or potentially unrepresentative measures. Furthermore, the expanding length of molecular dynamics simulations and direct observation of transitions between different energy basins suggest that this issue will only become evermore important. Methods commonly used to characterize conformational states include principal component analysis, root-mean-square deviation-based clustering, and geometric measurements such as hinge angles and distances. Here we present a method where the eigenvector frequencies derived from a Gaussian network model (Bahar, I.; Atilgan, A. R.; Erman, B. Folding Des. 1997, 2, 173-181) of a trajectory of structures from a molecular dynamics simulation are used to describe the state of the protein at each time point. We apply the method to three proteins that share the same fold as the type II periplasmic binding proteins: The lysine-arginine-ornithine-binding protein, the glutamine-binding protein, and the ligand-binding domain from the NR1 N-methyl-D-aspartate receptor. We find that the method can distinguish different states in good agreement with a variety of previous analyses and additionally provides information on the dynamic properties of that system at a given time point.     

Solvent triggering between conformational states in amphiphilic shape-persistent macrocycles

The amphiphilic shape-persistent macrocycle 1 containing four phenol-OH groups as polar side groups and four hexyloxy groups as nonpolar side groups in an adaptable arrangement was recrystallized from solvents of different polarity. X-ray crystallography reveals that the conformation of the macrocycle is solvent dependent such that in the pyridine solvate only two of the nonpolar side groups point outward while in the THF solvate all four of them point outward. Moreover, in the latter case the three-dimensional packing leads to the formation of a supramolecular channel structure with a large pore size.     

Probing occupied states of the molecular layer in Au-alkanedithiol-GaAs diodes

Internal photoemission (IPE) studies were performed on molecular diodes in which the alkanedithiol [HS(CH(2))(n)SH, n = 8, 10] molecular layer is sandwiched between Au and GaAs electrodes. The results are compared to those from Au-GaAs Schottky diodes. An exponential energy dependence in the IPE yield was observed for the molecular diodes, in contrast to the quadratic energy dependence characteristic of metal-semiconductor Schottky diodes, indicating that Au is not the source of electrons in the IPE process in the molecular diodes. From the GaAs dopant density dependence, we also can rule out GaAs being the source of these electrons. Compared with the results of cluster electronic structure calculations, we suggest that IPE is probing the occupied levels of GaAs-molecular interfacial states.     

A study of the conformational states of cyclopeptide systems

Summary 1. An empirical method for the quantitative determination of the number of NH groups of different types in peptides based on measurements of the integral intensity of the amide A bands in the IR spectra has been developed.2. The IR spectra of the diastereomeric cyclohexaalanyls in CHCl₃ solutions have been studied; they indicate the participation of an average of four NH groups in IMBHs.3. On the basis of a theoretical conformational analysis and of dipole-moment measurements, the system of IMHBs and the type of dominant conformation of the cyclohexapeptides in nonpolar solvents have been established.M. M. Shemyakin Institute of the Chemistry of Natural Compounds of the Academy of Sciences of the USSR. Translated from Khimiya Prirodnykh Soedinenii, No. 3, pp. 347–357, May–June, 1971.     

DNA quality control by conformational readout on the undamaged strand of the double helix

Synthetic DNA probes were incubated in human cell extracts to dissect the early step of bulky lesion recognition in the nucleotide excision repair pathway. Excision was induced upon combination of the target adduct with either a two-sided bulge, involving both the damaged sequence and its undamaged partner strand, or a one-sided bulge, affecting exclusively the undamaged complementary sequence. Surprisingly, the same adduct became refractory to repair when only the modified strand was bulged out of the double helix. Adduct removal was further dependent on an intact opposing strand and, at carcinogen-DNA adducts, the assembly of excision complexes was triggered by a single flipped-out deoxyribonucleotide in the complementary sequence. These findings describe a mechanism of molecular readout in DNA repair that, unexpectedly, is entirely confined to the undamaged side of the double helix.     

Probing the conformational changes upon oxidation in cross-conjugated architectures featuring vinylogous TTF units

We report the synthesis and electropolymerisation of 1,3,5-tris(1,3-dithiole-2-ylidenephenylene)benzene 4. The resulting polymer features extended tetrathiafulvalene (TTF) units and can be considered as a cross-conjugated, cross-linked structure. Upon p-doping, electrochemical and UV-vis spectroelectrochemical experiments indicate that the polymer undergoes a unique conformational change within the dendralene unit from one definitive orthogonal arrangement to another.     

Probing structure in invisible protein states with anisotropic NMR chemical shifts

A general method for obtaining quantitative structural information on invisible, excited protein states by solution-based NMR spectroscopy is presented. The approach exploits relaxation dispersion techniques in which changes in chemical shifts between ground and excited states are monitored in solutions with and without small amounts of residual molecular alignment. This allows the calculation of differences in chemical shifts induced by alignment that can be directly related to molecular structure, in cases where the orientation and magnitude of the chemical-shift tensor are well defined. An example using carbonyl chemical shifts as probes of a protein-ligand binding reaction is presented to illustrate and validate the method.