共查询到20条相似文献,搜索用时 31 毫秒
1.
We describe the synthesis of novel 5-haloimidazole ribonucleosides as precursors of modified cobalamins. A regio- and stereoselective glycosylation of protected ribose with silylated 4(5)-haloimidazoles produces 5-haloimidazole ribonucleosides predominantly in the alpha-configuration (60-75%) without any 4-substituted imidazole ribonucleoside. The structure of the 5-fluoroimidazole ribonucleoside was confirmed by X-ray crystallography and 2D NMR spectroscopy. 相似文献
2.
Yamada T Okaniwa N Saneyoshi H Ohkubo A Seio K Nagata T Aoki Y Takeda S Sekine M 《The Journal of organic chemistry》2011,76(9):3042-3053
To develop oligonucleotides containing new 2'-O-modified ribonucleosides as nucleic acid drugs, we synthesized three types of ribonucleoside derivatives modified at the 2'-hydroxyl group with 2-(methoxycarbonyl)ethyl (MOCE), 2-(N-methylcarbamoyl)ethyl (MCE), and 2-(N,N-dimethylcarbamoyl)ethyl (DMCE) groups, as key intermediates, via the oxa-Michael reaction of the appropriately protected ribonucleoside (U, C, A, and G) derivatives. Among them, the 2'-O-MCE ribonucleosides were found to be the most stable under basic conditions. To study the effects of the 2'-O-modification on the nuclease resistance of oligonucleotides incorporating the 2'-O-modified ribonucleosides and their hybridization affinities for the complementary RNA and DNA strands, 2'-O-MCE-ribonucleoside phosphoramidite derivatives were successfully synthesized and subjected to the synthesis of 2'-O-MCE-oligonucleotides and 2'-O-methyl-oligonucleotides incorporating 2'-O-MCE-ribonucleosides. The 2'-O-MCE-oligonucleotides and chimeric oligomers with 2'-O-MCE and 2'-O-methyl groups thus obtained demonstrated complementary RNA strands and much higher nuclease resistances than the corresponding 2'-O-methylated species. Finally, we incorporated the 2'-O-MCE-ribonucleosides into antisense 2'-O-methyl-oligoribonucleotides to examine their exon-skipping activities in splicing reactions related to pre-mRNA of mouse dystrophin. The exon-skipping assay of these 2'-O-methyl-oligonucleotide incorporating 2'-O-MCE-uridines showed better efficacies than the corresponding 2'-O-methylated oligoribonucleotide phosphorothioate derivatives. 相似文献
3.
4.
[reaction: see text] H-Phosphonate monomers of 2'-O-(2-methoxyethyl) ribonucleosides have been synthesized. Oxidation of oligonucleotide H-phosphonates has been optimized to allow the synthesis of oligonucleotides containing either 2'-deoxy or 2'-O-(2-methoxyethyl) ribonucleoside residues combined with three different phosphate modifications in the backbone, i.e., phosphodiester (PO), phosphorothioate (PS), and phosphoramidate (PN). Phosphodiester linkages were introduced by oxidation with a cocktail of 0.1 M Et(3)N in CCl(4)/Pyr/H(2)O (5:9:1) without affecting phosphorothioate or phosphoramidate linkages. For the synthesis of phosphoramidate-modified oligonucleotides, N(4)-acetyl deoxycytidine-3'-H-phosphonate monomers were used to avoid transamination during the oxidation step. 相似文献
5.
Oscar L. Acevedo Robert S. Andrews Martin Dunkel P. Dan Cook 《Journal of heterocyclic chemistry》1994,31(4):989-995
A series of 4-(1-alkynyl)-2(1H)-pyrimidinone ribonucleosides were synthesized from the Pd-catalyzed coupling of terminal alkynes to the 4-chloropyrimidin-2-one ribonucleoside ( 2 ). These compounds were hydrated, using three different methods, to afford the 4-(2-oxoalkylidene)-2(1H)-pyrimidinones. The 4-enol-pyrimidin-2-one structure of the title compounds offers functional groups with the potential for Watson-Crick hydrogen bonding. 相似文献
6.
[reaction: see text] An effective method for the synthesis of 2'-O-cyanoethylated oligoribonucleotides as a new class of 2'-O-modified RNAs was developed. The reaction of appropriately protected ribonucleoside derivatives with acrylonitrile in t-BuOH in the presence of Cs2CO3 gave 2'-O-cyanoethylated ribonucleoside derivatives in excellent yields, which were converted by a successive selective deprotection/protection strategy to 2'-O-cyanoethylated 5'-O-dimethoxytritylribonucleoside 3'-phosphoramidite derivatives in high yields. Fully 2'-O-cyanoethylated oligoribonucleotides, (Uce)12 and (GceAceCceUce)3, were successfully synthesized in the phosphoramidite approach by use of the phosphoramidite building blocks. It was also found that oligoribonucleotides having a 2'-O-cyanoethylated ribonucleoside (Uce, Cce, Ace, or Gce) could be obtained by the selective removal of the TBDMS group from fully protected oligoribonucleotide intermediates without loss of the cyanoethyl group by use of NEt3 x 3HF as a desilylating reagent. The detailed T(m) experiments revealed that oligoribonucleotides containing 2'-O-cyanoethylated ribonucleosides have higher hybridization affinity for both DNA and RNA than the corresponding unmodified and 2'-O-methylated oligoribonucleotides. In addition, introduction of a cyanoethyl group into the 2'-position of RNA resulted in significant increase of nuclease resistance toward snake venom and bovine spleen phosphodiesterases compared with that of the methyl group. 相似文献
7.
Teichert F Winkler S Keun HC Steward WP Gescher AJ Farmer PB Singh R 《Rapid communications in mass spectrometry : RCM》2011,25(14):2071-2082
The patterns and levels of urinary excreted ribonucleosides which reflect RNA turnover and metabolism in humans offer the potential for early detection of disease and monitoring of therapeutic intervention. A liquid chromatography/tandem mass spectrometry (LC/MS/MS) method employing constant neutral loss (CNL) scanning for the loss of the ribose moiety (132 u) was used to detect ribonucleosides in human urine and to evaluate this analytical platform for biomarker research in clinical trials. Ribonucleosides were stable and not influenced by the time spent at room temperature prior to freezing or long-term storage at -80 °C. Matrix effects caused variation in the mass spectrometer response which was dependent on the concentration of the analysed urine sample. For the use of urinary ribonucleoside profiling in clinical biomarker studies, adjustment of the urine samples to a common concentration prior to sample preparation is therefore advocated. Changes in the mass spectrometer response should be accounted for by the use of an internal standard added after sample preparation. Diurnal variation exceeded inter-day variation of an individual's ribonucleoside profile, but inter-person differences were predominant and allowed the separation of individuals against each other in a multivariate space. Due to considerable diurnal variation the use of spot urine samples would introduce unnecessary variation and should be replaced by the collection of multiple spot urine samples across the day, where possible. Should such a protocol not be feasible, biological intra-day and inter-day variation must be considered and accounted for in the data interpretation. 相似文献
8.
Acid/azole complexes as highly effective promoters in the synthesis of DNA and RNA oligomers via the phosphoramidite method 总被引:1,自引:0,他引:1
Hayakawa Y Kawai R Hirata A Sugimoto JI Kataoka M Sakakura A Hirose M Noyori R 《Journal of the American Chemical Society》2001,123(34):8165-8176
The utility of various kinds of acid salts of azole derivatives as promoters for the condensation of a nucleoside phosphoramidite and a nucleoside is investigated. Among the salts, N-(phenyl)imidazolium triflate, N-(p-acetylphenyl)imidazolium triflate, N-(methyl)benzimidazolium triflate, benzimidazolium triflate, and N-(phenyl)imidazolium perchlorate have shown extremely high reactivity in a liquid phase. These reagents serve as powerful activators of deoxyribonucleoside 3'-(allyl N,N-diisopropylphosphoramidite)s or 3'-(2-cyanoethyl N,N-diisopropylphosphoramidite)s employed in the preparation of deoxyribonucleotides, and 3'-O-(tert-butyldimethylsilyl)ribonucleoside 2'-(N,N-diisopropylphosphoramidite)s or 2'-O-(tert-butyldimethylsilyl)ribonucleoside 3'-(N,N-diisopropylphosphoramidite)s used for the formation of 2'-5' and 3'-5' internucleotide linkages between ribonucleosides, respectively. The azolium salt has allowed smooth and high-yield condensation of the nucleoside phosphoramidite and a 5'-O-free nucleoside, in which equimolar amounts of the reactants and the promoter are employed in the presence of powdery molecular sieves 3A in acetonitrile. It has been shown that some azolium salts serve as excellent promoters in the solid-phase synthesis of oligodeoxyribonucleotides and oligoribonucleotides. For example, benzimidazolium triflate and N-(phenyl)imidazolium triflate can be used as effective promoters in the synthesis of an oligodeoxyribonucleotide, (5')CGACACCCAATTCTGAAAAT(3') (20mer), via a method using O-allyl/N-allyloxycarbonyl-protected deoxyribonucleoside 3'-phosphoramidites or O-(2-cyanoethyl)/N-phenoxyacetyl-protected deoxyribonucleotide 3'-phosphoramidite as building blocks, respectively, on high-cross-linked polystyrene resins. Further, N-(phenyl)imidazolium triflate is useful for the solid-phase synthesis of oligoribonucleotides, such as (5')AGCUACGUGACUACUACUUU(3') (20mer), according to an allyl/allyloxycarbonyl-protected strategy. The utility of the azolium promoter has been also demonstrated in the liquid-phase synthesis of some biologically important substances, such as cytidine-5'-monophosphono-N-acetylneuraminic acid (CMP-Neu5Ac) and adenylyl(2'-5')adenylyl(2'-5')adenosine (2-5A core). 相似文献
9.
10.
Phosphate monoesters are synthesized from a mixture of phosphoric acid (1 or 2 equiv) and alcohols (1 equiv) in the presence of tributylamine. The reaction is promoted by nucleophilic bases such as N-alkylimidazole and 4-(N,N-dialkylamino)pyridine. 2',3'-O-Isopropylidene ribonucleosides are selectively converted to their 5'-monophosphates without the protection of amino groups in nucleobases. 相似文献
11.
[reaction: see text] An efficient procedure for the immobilization of 3'-deoxy-3'-(O-methyltyrosyl)aminoadenosine was developed. A poly(ethylene glycol)-derived diacid linker/spacer was attached to aminomethyl polystyrene. Coupling of the 2'-hydroxy instead of the 2'-O-succinylated ribonucleoside resulted in high immobilization yields (over 80%) and allowed for the recovery of valuable unreacted material. This specific procedure should be applicable to other ribonucleosides containing a bulky modification at the 3'-position and can be used for the stepwise construction of 3'-aminoacyl- or 3'-peptidyl-RNA conjugates. 相似文献
12.
Magdalena Pfister Helga Schirmeister Marion Mohr Silke Farkas Klaus-Peter Stengele Tilman Reiner Martin Dunkel Surendra Gokhale Ramamurthy Charubala Wolfgang Pfleiderer 《Helvetica chimica acta》1995,78(7):1705-1737
The 2-(4-nitrophenyl)ethylsulfonyl (npes) group is developed as a new sugar OH-blocking group in the ribonucleoside series. Its cleavage can be performed in a β-eliminating process under aprotic conditions using 1,8-diazabicyclo[5.4.0]undec-7-ene (DBU) as the most effective base. Since sulfonates do not show acyl migration, partial protection of 1,2-cis-diol moieties is possible leading to new types of oligonucleotide building blocks. A series of Markiewicz-protected ribonucleosides 1–10 is converted into their 2′-O-[2-(4-nitrophenyl)ethylsulfonyl] derivatives 29–38 in which the 5′-O? Si bond can be cleaved by acid hydrolysis forming 39–45 . Subsequent monomethoxytritylation leads to 46–50 , and desilylation affords the 5′-O-(monomethoxytrityl)-2′-O-[2-(4-nitrophenyl)ethylsulfonyl]ribonucleosides 51–55 . Acid treatment to remove trityl groups do also not harm the npes group (→ 56–58 ). Unambiguous syntheses of fully blocked 2′-O-[2-(4-nitrophenyl)ethylsulfonyl]ribonucleosides 96–102 are achieved from the corresponding 3′-O-(tert-butyl)dimethylsilyl derivatives. Furthermore, various base-protected 5′-O-(monomethoxytrityl)- and 5′-O-(dimethoxytrityl)ribonucleosides, i.e. 59–77 , are treated directly with 2-(4-nitrophenyl)ethylsulfonyl chloride forming in all cases a mixture of the 2′,3′-di-O- and the two possible 2′- and 3′-O-monosulfonates 107–148 which can be separated into the pure components by chromatographic methods. The npes group is more labile towards DBU cleavage than the corresponding base-protecting 2-(4-nitrophenyl)ethyl (npe) and 2-(4-nitrophenyl)ethoxycarbonyl (npeoc) groups allowing selective deblocking which is of great synthetic potential. 相似文献
13.
The syntheses and properties of 8-aza-7-deazapurine (pyrazolo[3,4-d]pyrimidine) ribonucleosides related to 2-aminoadenosine and isoguanosine are described. Glycosylation of 8-aza-7-deazapurine-2,6-diamine 5 with 1-O-acetyl-2,3,5-tri-O-benzoyl-beta-D-ribofuranose (12) in the presence of BF(3) x Et(2)O as a catalyst gave the N(8) isomer 14 (73%) with a trace amount of the N(9) isomer 13a (4.8%). Under the same reaction conditions, the 7-halogenated 8-aza-7-deazapurine-2,6-diamines 6-8 afforded the thermodynamically more stable N(9) nucleosides 13b-d as the only products (53-70%). Thus, a halogen in position 7 shifts the glycosylation from N(8) to N(9). The 8-aza-7-deazapurine-4,6-diamine ribonucleosides 1a-d were converted to the isoguanosine derivatives 3a-d by diazotization of the 2-amino group. Although compounds 1a,b do not contain a nitrogen at position 7 (the enzyme binding site), they were deaminated by adenosine deaminase; however, their deamination occurred with a much slower velocity than that of the related purines. The pK(a) values indicate that the 7-non-functionalized nucleosides 1a (pK(a) 5.8) and 15 (pK(a) 6.4) are possibly protonated in neutral conditions when incorporated into RNA. The nucleosides 3a-d exist predominantly in the keto (lactam) form with K(TAUT) (keto/enol) values of 400-1200 compared to 10(3)-10(4) for pyrrolo[2,3-d]pyrimidine isoguanosine derivatives 4a-c and 10 for isoguanosine itself, which will reduce RNA mispairing with U. 相似文献
14.
Aso M Ikeno T Norihisa K Tanaka M Koga N Suemune H 《The Journal of organic chemistry》2001,66(10):3513-3520
We designed a new type of spin-labeled nucleosides with an N-tert-butylaminoxyl radical which is introduced to the nucleobase directly. Purine and pyrimidine ribonucleosides containing the aminoxyl radical such as 1a-d, 2, 3, and 4 were synthesized to investigate the stability and behavior of the N-tert-butylaminoxyl radical on a nucleobase. Lithiation of tri-O-silylated 6-chloropurine ribonucleoside (5) followed by reaction with 2-methyl-2-nitrosopropane (MNP) gave the key compound 6a, which was further converted to 6b-d. Oxidation of the obtained 6a-d and their triols (7a-d) with Ag(2)O led to formation of the corresponding stable spin-labeled nucleosides (8a-d and 1a-d), which were confirmed by EPR spectroscopy. Similarly, the precursors of spin-labeled pyrimidines (13, 20, and 23) were synthesized by site-selective lithiation of tri-O-protected pyrimidine derivatives (9, 18, and 21) followed by the reaction with MNP and deprotection. An EPR study showed that the aminoxyl radicals (2, 3, and 4) were stable and that their hyperfine structures were dependent on the position of the radical. Electron densities of pyrimidine also affected hyperfine structures. 相似文献
15.
The preparation of building blocks for the incorporation of 6′-O-(5-bromopentyl)-substituted β-D -allofuranosylnucleosides and 2′-O-[(3-bromopropoxy)methyl]-substituted ribonucleosides into oligonucleotide sequences is presented (Schemes 1 and 2). These reactive building blocks can be modified with a variety of soft nucleophiles while the (fully protected) sequence is still attached to the solid support. As an example of this strategy, we carried out some preliminary solid-phase substitution and conjugation reactions with DNA sequences containing a 2′-O-[(3-bromopropoxy)methyl]-substituted ribonucleoside (Scheme 3) and determined the pairing properties of duplexes obtained therefrom. 相似文献
16.
Nikolaienko TY Bulavin LA Hovorun DM 《Physical chemistry chemical physics : PCCP》2012,14(20):7441-7447
Physical properties of over 8000 intramolecular hydrogen bonds (iHBs), including 2901 ones of the types OH···O, OH···N, NH···O and OH···C, in 4244 conformers of the DNA-related molecules (four canonical 2'-deoxyribonucleotides, 1,2-dideoxyribose-5-phosphate, and 2-deoxy-D-ribose in its furanose, pyranose and linear forms) have been investigated using quantum theory of atoms in molecules (QTAIM) and vibrational analysis. It has been found that for all iHBs with positive red-shift of the proton donating group stretching frequency the shift value correlates with ρ(cp)-the electron charge density at the (3,-1)-type bond critical point. Combining QTAIM and spectroscopic data new relationships for estimation of OH···O, OH···N, NH···O and OH···C iHB enthalpy of formation (kcal mol(-1)) with RMS error below 0.8 kcal mol(-1) have been established: E(OH···O) = -3.09 + 239·ρ(cp), E(OH···N) = 1.72 + 142·ρ(cp), E(NH···O) = -2.03 + 225·ρ(cp), E(OH···C) = -0.29 + 288·ρ(cp), where ρ(cp) is in e a(0)(-3) (a(0)- the Bohr radius). It has been shown that XHY iHBs with red-shift values over 40 cm(-1) are characterized by the following minimal values of the XHY angle, ρ(cp) and nubla(2)ρ(cp): 112°, 0.005 e a(0)(-3) and 0.016 e a(0)(-5), respectively. New relationships have been used to reveal the strongest iHBs in canonical 2'-deoxy- and ribonucleosides and the O(5')H···N(3) H-bond in ribonucleoside guanosine was found to have the maximum energy (8.1 kcal mol(-1)). 相似文献
17.
[reaction: see text] The Silyl-Hilbert-Johnson reaction as well as the nucleobase-anion glycosylation of a series of 7-deazapurines has been investigated, and the 7-functionalized 7-deazapurine ribonucleosides were prepared. Glycosylation of the 7-halogenated 6-chloro-2-pivaloylamino-7-deazapurines 9b-d with 1-O-acetyl-2,3,5-tri-O-benzoyl-D-ribofuranose (5) gave the beta-D-nucleosides 11b-d (73-75% yield), which were transformed to a number of novel 7-halogenated 7-deazapurine ribonucleosides (2b-d, 3b-d, and 4b-d) related to guanosine, 2-aminoadenosine, and xanthosine. 7-Alkynyl derivatives (2e-i, 3e-h, or 4g) have been prepared from the corresponding 7-iodonucleosides 2d, 3d, or 4d employing the palladium-catalyzed Sonogashira cross-coupling reaction. The 7-halogenated 2-amino-7-deazapurine ribonucleosides with a reactive 6-chloro substituent (18b-d) were synthesized in an alternative way using nucleobase-anion glycosylation performed on the 7-halogenated 2-amino-6-chloro-7-deazapurines 13b-d with 5-O-[(1,1-dimethylethyl)dimethylsilyl]-2,3-O-(1-methylethylidene)-alpha-D-ribofuranosyl chloride (17). Compounds 18b-d have been converted to the nucleosides 19b-d carrying reactive substituents in the pyrimidine moiety. Conformational analysis of selected nucleosides on the basis of proton coupling constants and using the program PSEUROT showed that these ribonucleosides exist in a preferred S conformation in solution. 相似文献
18.
The compounds [meso-tetrakis(1-methyl-4-pyridiniumyl)porphyrinato]iron(III ) (FeIIITMPyP) and [meso-tetrakis(3,5-dichloro-1-methyl-4-pyridiniumyl)porphyrinat o]iron(III) (FeIIITCl2MPyP) photocatalysed the release of bases from nucleosides and their derivatives. The ribonucleosides, of which cytidine (C) gave the highest yield, produced much higher yields of free base than the corresponding deoxyribonucleosides. Under an argon atmosphere, virtually quantitative reduction of FeIIITMPyP into FeIITMPyP by C or 2'-deoxycytidine (dC) was observed and the reduction by C was much more effective than by dC. The increased reactivity of ribonucleosides relative to deoxyribonucleosides was ascribed to a difference in the binding properties of the porphyrin-nucleoside interactions and to base-releasing degradation of ribonucleosides from their C-2' carbon radical. 相似文献
19.
Silverman LN Pitzer ME Ankomah PO Boxer SG Fenlon EE 《The journal of physical chemistry. B》2007,111(40):11611-11613
The vibrational Stark effect (VSE) has proven to be an effective method for the study of electric fields in proteins via the use of infrared probes. To explore the use of VSE in nucleic acids, we investigated the Stark spectroscopy of nine structurally diverse nucleosides. These nucleosides contained nitrile or azide probes in positions that correspond to both the major and minor grooves of DNA. The nitrile probes showed better characteristics and exhibited absorption frequencies over a broad range; that is, from 2253 cm-1 for 2'-O-cyanoethyl ribonucleosides 8 and 9 to 2102 cm(-1) for a 13C-labeled 5-thiocyanatomethyl-2'-deoxyuridine 3c. The largest Stark tuning rate observed was |Deltamu| = 1.1 cm(-1)/(MV/cm) for both 5-cyano-2'-deoxyuridine 1 and N2-nitrile-2'-deoxyguanosine 7. The latter is a particularly attractive probe because of its high extinction coefficient (epsilon = 412 M-1cm-1) and ease of incorporation into oligomers. 相似文献
20.
A protocol for chemoselective deprotection of N,O-acylated ribonucleosides has been developed. Peracylated pyrimidine ribonucleosides subjected to guanidinium nitrate and NaOMe in MeOH/CH2Cl2 at 0 °C undergo high yielding O-deacylation, while even more pronounced chemoselectivity is observed with peracylated purine ribonucleosides as O5′-acyl groups are preserved. Nucleobase-protecting groups (ABz, CBz, GiBu, and UBz) are stable to these conditions, rendering this reagent mixture as a valuable addition to the collection of protecting group protocols in nucleoside chemistry. 相似文献