Cell-penetrating peptides as delivery vehicles for a protein-targeted terbium complex

Release after transmission: Arginine-rich, cell-penetrating peptides (CPPs) mediate cytoplasmic delivery of trimethoprim (TMP)-terbium complex conjugates and selective, intracellular labeling of E.?coli dihydrofolate reductase (eDHFR) fusion proteins. A disulfide bond linking CPP and cargo is reduced following uptake. CPP conjugation can be used to deliver otherwise cell-impermeable, ligand-fluorophore conjugates.     

Cell-penetrating cis-gamma-amino-l-proline-derived peptides

The synthesis of cis-gamma-amino-l-proline oligomers functionalized at the proline alpha-amine with several groups that mimic the side chains of natural amino acids, including alanine, leucine, and phenylalanine, is herein described. These gamma-peptides enter into different cell lines (COS-1 and HeLa) via an endocytic mechanism. The ability of these compounds to be taken up into cells was studied at 37 degrees C and 4 degrees C by plate fluorimetry, flow cytometry, and confocal microscopy. In addition to their capacity for cellular uptake, these unnatural short length oligomers offer advantages over the well-known penetrating TAT peptide, such as being less toxic than TAT and protease resistance.     

Calixarenes and related macrocycles as gene delivery vehicles

The success of gene therapy depends largely on the development of new efficient gene delivery vehicles. The emerging class of molecules for this application is macrocycles that feature persistent shape, thus ensuring higher level of supramolecular organization of the DNA complexes. The review focuses on recently developed calixarenes and close analogues as gene delivery vectors, their chemistry, ability to compact nucleic acids, transfection ability in vitro and cytotoxicity. Their fixed conformation with the possibility of multiple functional groups at the upper and lower rims allows preparation of cone-shaped macromolecules capable of programmed hierarchical assembly in the presence of DNA. It is shown that specially designed calixarenes, particularly those having amphiphilic structure with clustered DNA binding units, can form small virus-sized DNA nanoparticles with well-defined architecture, high transfection efficiency and low toxicity. The field is still largely underexplored so that there is a lot of room for further improvement of the molecular design of calixarenes. Moreover, their evaluation in vivo on animals will be an important step towards their validation for gene therapy.     

Hollow silica nanocontainers as drug delivery vehicles

Novel hollow silica nanoparticles (HSNPs) for drug delivery vehicles were synthesized using silica-coated magnetic assemblies, which are composed of a number of Fe(3)O(4) nanocrystals, as templates. The core cavity was obtained by removal of Fe(3)O(4) phase with hydrochloric acid and subsequent calcination at a high temperature. HSNPs were modified by amine in order to introduce positive surface charge and further PEGylated for increased solubility in aqueous medium. Doxorubicin as a model drug was loaded into the HSNPs, and notable sustained drug release from HSNPs was demonstrated.     

Chlorins as photosensitizers in biology and medicine

The photodynamic therapy (PDT) of tumors involves illumination of the tumorous area following the administration of a tumor-localizing photodynamic sensitizer. Hematoporphyrin derivative (HPD) and Photofrin II (a purified form of HPD), the main sensitizers used clinically for PDT to date, are complex mixtures of porphyrins; furthermore, these preparations absorb light very poorly in the red region of the spectrum (wavelengths greater than 600 nm) where light penetration into mammalian tissues is greatest. Thus there is considerable interest in identifying new sensitizers that localize more effectively in tumors, absorb more strongly at longer wavelengths and can be prepared in high purity. Much of this interest has been directed towards chlorins (reduced porphyrins), which typically absorb strongly in the red. This review summarizes research that has been carried out on selected types of chlorins, some of which may have important applications as sensitizers for PDT.     

Surfactant self-assembly objects as novel drug delivery vehicles

The past decade has been witness to a new impetus in surfactant self-assembly objects as agents for drug delivery that are an alternative to micellar, lamellar (liposome, niosome and transfersome) or microemulsion-based vehicles. The review focus herein is on the application of hexagonal, cubic, ‘intermediate’ (viz. rhombohedral, tetragonal and monoclinic) and L₃ (‘sponge’) mesophases.     

Basic peptides as functional components of non-viral gene transfer vehicles

Improving the performance of non-viral gene-delivery vehicles that consist of synthetic compounds and nucleic acids is a key to successful gene therapy. Supplementing synthetic vehicles with various biological functions by using natural or artificial peptides is a promising approach with which to achieve this goal. One of the obstacles hindering this effort is that some of the potentially useful peptides, especially those with many basic amino acid residues, interfere with the formation of the complex owing to strong electrostatic interactions with the nucleic acid. In this review, we describe our recent work in examining the potential of these peptides in gene delivery, using a recombinant lambda phage particle as the model for the gene-delivery complex. Lambda phage encapsulates large duplex DNA in a rigid polyplex-like shell with a diameter of 55 nm, and can display various peptides on this capsid, independently of particle formation. By examining the expression of marker genes encapsulated in the phage capsid, we have demonstrated that the protein transduction domain of HIV Tat protein and the nuclear localization signal derived from SV40 T antigen can remarkably facilitate the delivery of these marker genes across the two major barriers, the cell membrane and the nuclear membrane, respectively. Our results indicate that these basic peptides can constitute effective components of synthetic gene-transfer complexes, as long as sufficient copies are displayed on the outer surface of the complex.     

Inorganic nanomaterials as delivery systems for proteins,peptides, DNA,and siRNA

With large current interest in nanomedicine, there has been rapid progress during the last couple of years in the understanding of opportunities offered by advanced materials in diagnostics, drug delivery, functional biomaterials, and biosensors, as well as combinations of these, e.g., theranostics. In the present overview, focus is placed on drug delivery aspects of inorganic nanomaterials, notably as carriers for proteins, peptides, DNA, and siRNA. Throughout, an attempt is made to illustrate how structure and interactions affect loading and release of such biomacromolecular drugs in various inorganic delivery systems, and how this translates into functional advantages.     

Skin and wound delivery systems for antimicrobial peptides

Non-healing wounds cause hundreds of thousands of deaths every year, and result in large costs for society. A key reason for this is the prevalence of challenging bacterial infections, which may dramatically hinder wound healing. With resistance development among bacteria against antibiotics, this situation has deteriorated during the last couple of decades, pointing to an urgent need for new wound treatments. In particular, this applies to wound dressings able to combat bacterial infection locally in wounds and impaired skin, including those formed by bacteria resistant to conventional antibiotics. Within this context, antimicrobial peptides (AMPs) are currently receiving intense interest. AMPs are amphiphilic peptides, frequently net positively charged, and with a sizable fraction of hydrophobic amino acids. Through destabilization of bacterial membranes, neutralization of inflammatory lipopolysaccharides, and other mechanisms, AMPs can be designed for potent antimicrobial effects, also against antibiotics-resistant strains, and to provide immunomodulatory effects while simultaneously displaying low toxicity. While considerable attention has been placed on AMP optimization and clarification of their mode(s)-of-action, much less attention has been paid on efficient AMP delivery. Considering that AMPs are large molecules, net positively charged, amphiphilic, and susceptible to infection-mediated proteolytic degradation, efficient in vivo delivery of such peptides is, however, challenging and delivery systems needed for the realization of AMP-based therapeutics. In the present work, recent developments regarding AMP delivery systems for treatment of wounds and skin infections are discussed, with the aim to link results from physicochemical studies on, e.g., peptide loading/release, membrane interactions, and self-assembly, with those on the biological functional performance of AMP delivery systems in terms of antimicrobial effects, cell toxicity, inflammation, and wound healing.     

Dodeca(carboranyl)-substituted closomers: toward unimolecular nanoparticles as delivery vehicles for BNCT

The syntheses of the dodeca(carboranyl)-substituted closomers, dodeca[7-(2-methyl-1,2-dicarba-closo-dodecaboran-1-yl)heptanoate]-closo- dodecaborate(2-) and dodeca[7-(8-methyl-7,8-dicarba-nido-dodecaboran-7-yl)- heptanoate]-closo-dodecaborate(14-) are reported. These boron-rich, unimolecular nanospheres possess great potential for future use as drug-delivery platforms for boron neutron capture therapy (BNCT).     

Molecular dynamics simulation study of gold nanosheet as drug delivery vehicles for anti-HIV-1 aptamers

The adsorption process of three aptamers with gold nanosheet (GNS) as a drug carrier has been investigated with the help of molecular dynamics simulations. The sequencing of the considered aptamers are as (CUUCAUUGUAACUUCUCAUAAUUUCCCGAGGCUUUUACUUUCGGGGUCCU) and (CCGGGUCGUCCCCUACGGGGACUAAAGACUGUGUCCAACCGCCCUCGCCU) for AP1 and AP2, respectively. AP3 is a muted version of AP1 in which nucleotide positions 4, 6, 18, 28 and 39 have C4A, U6G, A18G, G28A, and U39C mutations. At positions 24, and 40, a deletion mutation is seen to eliminate U24 and U40 bases. These aptamers are inhibitors for HIV-1 protease and can be candidates as potential pharmaceutics for treatment of AIDS in the future. The interactions between considered aptamers and GNS have been analyzed in detail with help of structural and energetic properties. These analyses showed that all three aptamers could well adsorb on GNS. Overall, the final results show that the adsorption of AP2 on the GNS is more favorable than other considered ones and consequently GNS can be considered as a device in order to immobilize these aptamers.     

Hyperbranched copolymer micelles as delivery vehicles of doxorubicin in breast cancer cells

Four types of drug nanoparticles (NPs) based on amphiphilic hyperbranched block copolymers were developed for the delivery of the chemotherapeutic doxorubicin (DOX) to breast cancer cells. These carriers have their hydrophobic interior layer composed of the hyperbranched aliphatic polyester, Boltorn^® H30 or Boltorn^® H40, that are polymers of poly 2,2‐bis (methylol) propionic acid (bis‐MPA), while the outer hydrophilic shell was composed of about 5 poly(ethylene glycol) (PEG) segments of 5 or 10 kDa molecular weight. A chemotherapeutic drug DOX, was further encapsulated in the interior of these polymer micelles and was shown to exhibit a controlled release profile. Dynamic light scattering and transmission electron microscopy analysis confirmed that the NPs were uniformly sized with a mean hydrodynamic diameter around 110 nm. DOX‐loaded H30‐PEG10k NPs exhibited controlled release over longer periods of time and greater cytotoxicity compared with the other materials developed against our tested breast cancer cell lines. Additionally, flow cytometry and confocal scanning laser microscopy studies indicated that the cancer cells could internalize the DOX‐loaded H30‐PEG10k NPs, which contributed to the sustained drug release, and induced more apoptosis than free DOX did. These findings indicate that the H30‐PEG10k NPs may offer a very promising approach for delivering drugs to cancer cells. © 2011 Wiley Periodicals, Inc. J Polym Sci Part A: Polym Chem, 2012     

Poly(alkylcyanoacrylate) colloidal particles as vehicles for antitumour drug delivery: a comparative study

Because of the fundamental importance of new therapeutic routes for cancer treatment, a number of systems based on colloidal particles as vehicles for the delivery of chemotherapeutic agents have been devised. The target is always to provide the proper dose of the antitumour agent only at the desired locus of action, thus reducing the unwanted side effects. The systems studied in this work are nanospheres of the biodegradable polymers poly(ethyl-2-cyanoacrylate), poly(butylcyanoacrylate), poly(hexylcyanoacrylate) and poly(octylcyanoacrylate), all suitable for parenteral administration, as vehicles for 5-fluorouracil, a well studied drug used for the treatment of solid tumours. Two loading methods have been analyzed: the first one is based on drug addition during the process of generation of the particles, by an anionic emulsion/polymerization procedure, and the subsequent drug trapping in the polymeric network. The second method is based on surface adsorption in already formed nanoparticles, after incubation in the drug solution. A detailed investigation of the capabilities of the polymer particles to load this drug is described. The main factors determining the drug incorporation to the polymer network were the type of monomer, the pH and the drug concentration. The release kinetics of 5-fluorouracil is found to be controlled by the pH of the release medium, the type of drug incorporation and the type of polymer.     

Quantitative microfluidic biomolecular analysis for systems biology and medicine

In the postgenome era, biology and medicine are rapidly evolving towards quantitative and systems studies of complex biological systems. Emerging breakthroughs in microfluidic technologies and innovative applications are transforming systems biology by offering new capabilities to address the challenges in many areas, such as single-cell genomics, gene regulation networks, and pathology. In this review, we focus on recent progress in microfluidic technology from the perspective of its applications to promoting quantitative and systems biomolecular analysis in biology and medicine.     

Milk proteins as vehicles for bioactives

Milk proteins are natural vehicles for bioactives. Many of their structural and physicochemical properties facilitate their functionality in delivery systems. These properties include binding of ions and small molecules, excellent surface and self-assembly properties; superb gelation properties; pH-responsive gel swelling behavior, useful for programmable release; interactions with other macromolecules to form complexes and conjugates with synergistic combinations of properties; various shielding capabilities, essential for protecting sensitive payload; biocompatibility and biodegradability, enabling to control the bioaccessibility of the bioactive, and promote its bioavailability.The review highlights the main achievements reported in the last 3 years: harnessing the casein micelle, a natural nanovehicle of nutrients, for delivering hydrophobic bioactives; discovering unique nanotubes based on enzymatic hydrolysis of α-la; introduction of novel encapsulation techniques based on cold-set gelation for delivering heat-sensitive bioactives including probiotics; developments and use of Maillard reaction based conjugates of milk proteins and polysaccharides for encapsulating bioactives; introduction of β-lg–pectin nanocomplexes for delivery of hydrophobic nutraceuticals in clear acid beverages; development of core-shell nanoparticles made of heat-aggregated β-lg, nanocoated by beet-pectin, for bioactive delivery; synergizing the surface properties of whey proteins with stabilization properties of polysaccharides in advanced W/O/W and O/W/O double emulsions; application of milk proteins for drug targeting, including lactoferrin or bovine serum albumin conjugated nanoparticles for effective in vivo drug delivery across the blood-brain barrier; beta casein nanoparticles for targeting gastric cancer; fatty acid-coated bovine serum albumin nanoparticles for intestinal delivery, and Maillard conjugates of casein and resistant starch for colon targeting.Major future challenges are spot-lighted.     

Synthetic polymers in biology and medicine

Synthetic organic polymers have gained great importance as supports and separation materials in biochemical laboratory techniques, medical diagnostics and biotechnological procedures. Furthermore they are used as carriers for drugs and biologically active substances in pharmacy, medicine and agriculture. Classifying their biocompatibility it has to be distinguished between in vitro application of polymers interacting on the one hand with molecular biosystems such as proteins and on the other hand with living cells, and in vivo administration in higher organisms, especially in the human organism.     

Amine containing cationic methacrylate copolymers as efficient gene delivery vehicles to retinal epithelial cells

Non‐viral gene delivery vectors have emerged as potential alternatives in the field of gene therapy by replacing the biological viral vectors. DNA–cationic polymer complexes are one of the most promising systems to target many inborn or acquired diseases without the utilization of conventional drugs. Despite the excellent binding efficiency of cationic polymers, the gene transfection seems limited to date. In this work, a series of ammonium‐based block‐copolymers with different alkyl side chains (ethyl, butyl, and hexyl) and functionality (alcohol, amine, and alkyl) have been prepared to evaluate their capacity to deliver genetic material. First, different ionic liquid monomers with different pendent functional groups were prepared and characterized. Then, polyplexes elaborated with different polymers at several polymer DNA ratios (w/w) were characterized in terms of size, zeta potential, and DNA binding, release, and protection capacity. Finally, the transfection efficiency and cell viability was evaluated in ARPE19 cells. We found that only the systems containing the amine pendent group were able to transfect ARPE19 cell and, that this amine containing polymer was less cytotoxic even at high polymer/DNA ratios (30:1). In conclusion, our studies suggested that the proper selection of the pendent group substantially impacts overall transfection efficiency of cationic polymers. © 2016 Wiley Periodicals, Inc. J. Polym. Sci., Part A: Polym. Chem. 2017 , 55, 280–287