Enhanced in-source fragmentation in MALDI-TOF-MS of oligonucleotides using 1,5-diaminonapthalene

The capability to rapidly and confidently determine or confirm the sequences of short oligonucleotides, including native and chemically-modified DNA and RNA, is important for a number of fields. While matrix-assisted laser desorption/ionization (MALDI) time-of-flight (TOF) mass spectrometry (MS) has been used previously to sequence short oligonucleotides, the typically low fragmentation efficiency of in-source or post-source decay processes necessitates the accumulation of a large number of spectra, thus limiting the throughput of these methods. Here we introduce a novel matrix, 1,5-diaminonapthalene (DAN), for facile in-source decay (ISD) of DNA and RNA molecular anions, which allows for rapid sequence confirmation. d-, w-, and y-series ions are prominent in the spectra, complementary to the (a-B)- and w- ions that are typically produced by MALDI post-source decay (PSD). Results are shown for several model DNA and RNA oligonucleotides, including combinations of DAN-induced fragmentation with true tandem TOF MS (MS/MS) for pseudo-MS³ and “activated-ion PSD.”     

Repurposing Antiviral Drugs for Orthogonal RNA‐Catalyzed Labeling of RNA

In vitro selected ribozymes are promising tools for site‐specific labeling of RNA. Previously known nucleic acid catalysts attached fluorescently labeled adenosine or guanosine derivatives through 2′,5′‐branched phosphodiester bonds to the RNA of interest. Herein, we report new ribozymes that use orthogonal substrates, derived from the antiviral drug tenofovir, and attach bioorthogonal functional groups, as well as affinity handles and fluorescent reporter units through a hydrolytically more stable phosphonate ester linkage. The tenofovir transferase ribozymes were identified by in vitro selection and are orthogonal to nucleotide transferase ribozymes. As genetically encodable functional RNAs, these ribozymes may be developed for potential cellular applications. The orthogonal ribozymes addressed desired target sites in large RNAs in vitro, as shown by fluorescent labeling of E. coli 16S and 23S rRNAs in total cellular RNA.     

Repurposing Antiviral Drugs for Orthogonal RNA-Catalyzed Labeling of RNA

In vitro selected ribozymes are promising tools for site-specific labeling of RNA. Previously known nucleic acid catalysts attached fluorescently labeled adenosine or guanosine derivatives through 2′,5′-branched phosphodiester bonds to the RNA of interest. Herein, we report new ribozymes that use orthogonal substrates, derived from the antiviral drug tenofovir, and attach bioorthogonal functional groups, as well as affinity handles and fluorescent reporter units through a hydrolytically more stable phosphonate ester linkage. The tenofovir transferase ribozymes were identified by in vitro selection and are orthogonal to nucleotide transferase ribozymes. As genetically encodable functional RNAs, these ribozymes may be developed for potential cellular applications. The orthogonal ribozymes addressed desired target sites in large RNAs in vitro, as shown by fluorescent labeling of E. coli 16S and 23S rRNAs in total cellular RNA.     

A Vastly Increased Chemical Variety of RNA Modifications Containing a Thioacetal Structure

Recently discovered new chemical entities in RNA modifications have involved surprising functional groups that enlarge the chemical space of RNA. Using LC‐MS, we found over 100 signals of RNA constituents that contained a ribose moiety in tRNAs from E. coli. Feeding experiments with variegated stable isotope labeled compounds identified 37 compounds that are new structures of RNA modifications. One structure was elucidated by deuterium exchange and high‐resolution mass spectrometry. The structure of msms²i⁶A (2‐methylthiomethylenethio‐N6‐isopentenyl‐adenosine) was confirmed by methione‐D3 feeding experiments and by synthesis of the nucleobase. The msms²i⁶A contains a thioacetal, shown in vitro to be biosynthetically derived from ms²i⁶A by the radical‐SAM enzyme MiaB. This enzyme performs thiomethylation, forming ms²i⁶A from i⁶A in a first turnover. The new thioacetal is formed by a second turnover. Along with the pool of 36 new modifications, this work describes a new layer of RNA modification chemistry.     

Oligonucleotide-Addressed Covalent 3′-Terminal Derivatization of Small RNA Strands for Enrichment and Visualization

The HEN1 RNA 2′-O-methyltransferase plays important roles in the biogenesis of small non-coding RNAs in plants and proved a valuable tool for selective transfer of functional groups from cofactor analogues onto miRNA and siRNA duplexes in vitro. Herein, we demonstrate the versatile HEN1-mediated methylation and alkylation of small RNA strands in heteroduplexes with a range of complementary synthetic DNA oligonucleotides carrying user-defined moieties such as internal or 3′-terminal extensions or chemical reporter groups. The observed DNA-guided covalent functionalization of RNA broadens our understanding of the substrate specificity of HEN1 and paves the way for the development of novel chemo-enzymatic tools with potential applications in miRNomics, synthetic biology, and nanomedicine.     

Targeting of Single‐Stranded Oligonucleotides through Metal‐Induced Cyclization of Short Complementary Strands

A new strategy to cyclize short synthetic oligonucleotides on DNA or RNA target strands is described. The approach is based on metal‐templated cyclization of short synthetic oligonucleotides conjugated with two chelating 2,2′ : 6′,2′′‐terpyridine (Tpy) moieties at their 3′‐ and 5′‐ends. Cyclization after metal addition (Zn²⁺, Fe²⁺) was demonstrated by means of thermal‐denaturation experiments, MALDI‐Q‐TOF‐MS, and gel electrophoresis (PAGE). 1D‐ and 2D‐NMR Experiments were performed to analyze the association of complementary strands after metal‐mediated cyclization. Our protocol allows the efficient circularization of synthetic oligonucleotides. Thereby, the hybridization on a complementary strand was more efficient with an RNA target strand and a 2′‐O‐methylated circularized oligomer.     

Temperature dependence of internucleotide nitrogen–nitrogen scalar couplings in RNA

The temperature dependence of internucleotide nitrogen–nitrogen scalar couplings ^2hJ(N,N) across hydrogen bonds in adenine–uracil (A–U) and guanine–cytosine (G–C) base pairs of the 22 nucleotide RNA oligomer GGCGAAGUCGAAAGAUGGCGCC was studied between 280 and 310 K. The value of ^2hJ(N,N) was observed to decrease monotonically for all four base pairs with increasing temperature. The temperature dependence of ^2hJ(N,N) was found to be more pronounced for the A–U base pair than for G–C base pairs. An earlier study of cross‐correlation effects at 296 K appeared to indicate a reduced mobility of the A–U base pair, as evidenced by small contributions of chemical shift modulation to relaxation rates. Copyright © 2002 John Wiley & Sons, Ltd.     

A Non‐Invasive NMR Method Based on Histidine Imidazoles to Analyze the pH‐Modulation of Protein–Nucleic Acid Interfaces

A useful ²J(N?H) coupling‐based NMR spectroscopic approach is proposed to unveil, at the molecular level, the contribution of the imidazole groups of histidines from RNA/DNA‐binding proteins on the modulation of binding to nucleic acids by pH. Such protonation/deprotonation events have been monitored on the single His96 located at the second RNA/DNA recognition motif (RRM2) of T‐cell intracellular antigen‐1 (TIA‐1) protein. The pK_a values of the His96 ionizable groups were substantially higher in the complexes with short U‐rich RNA and T‐rich DNA oligonucleotides than those of the isolated TIA‐1 RRM2. Herein, the methodology applied to determine changes in pK_a of histidine side chains upon DNA/RNA binding, gives valuable information to understand the pH effect on multidomain DNA/RNA‐binding proteins that shuttle among different cellular compartments.     

Endless: A Purine‐Binding RNA Motif that Can Be Expressed in Cells

It is becoming increasingly clear that nature uses RNAs extensively for regulating vital functions of the cell, and short sequences are frequently used to suppress gene expression. However, controlling the concentration of small molecules intracellularly through designed RNA sequences that fold into ligand‐binding structures is difficult. The development of “endless”, a triplex‐based folding motif that can be expressed in mammalian cells and binds the second messenger 3′,5′‐cyclic guanosine monophosphate (cGMP), is described. In vitro, DNA or RNA versions of endless show low micromolar to nanomolar dissociation constants for cGMP. To test its functionality in vivo, four endless RNA motifs arranged in tandem were co‐expressed with a fluorescent cGMP sensor protein in murine vascular smooth muscle cells. Nitric oxide induced endogenous cGMP signals were suppressed in endless‐expressing cells compared to cells expressing a control motif, which suggests that endless can act as a genetically encoded cGMP sink to modulate signal transduction in cells.