Application of pressure assisted electrokinetic injection technique in the measurements of DNA oligonucleotides and their adducts using capillary electrophoresis-mass spectrometry

The identification and measurement of negatively charged DNA oligonucleotides and their benzo[a]pyrene-7,8,9,10-tetrahydro-7,8-dihydrodiol-9,10-epoxide (BPDE) adducts by capillary zone electrophoresis (CZE) hyphenated mass spectrometry (MS) system using an on-line enrichment technique, the constant pressure assisted electrokinetic injection (PAEKI), is described here. With optimized PAEKI conditions, an on-line sample concentration power of 300-800 times could be reached for both single-stranded (ss) and double-stranded (ds) oligonucleotides during a 90-s PAEKI injection. The detection limits using single quadrupole MS in the scan mode were 0.01-0.03 microM for ss and 0.04-0.08 microM for ds oligonucleotides, respectively. The relative standard deviations at 1 microM of oligonucleotides were from 7.6 to 15.8%. A dynamic linear calibration range of about two orders of magnitude were observed. Good mass spectra of oligonucleotides and BPDE-oligonucleotide adducts at low micromolar levels could be obtained using single quadrupole MS which could be a helpful tool in DNA adducts studies.     

Binding of DNA purine sites to dirhodium compounds probed by mass spectrometry

The adducts formed between the antitumor active compounds [Rh(2)(O(2)CCH(3))(2)(CH(3)CN)(6)](BF(4))(2), Rh(2)(O(2)CCH(3))(4), and Rh(2)(O(2)CCF(3))(4) with DNA oligonucleotides have been assessed by matrix-assisted laser desorption ionization (MALDI) and nanoelectrospray (nanoESI) coupled to time-of-flight mass spectrometry (TOF MS). A series of MALDI studies performed on dipurine (AA, AG, GA, and GG)-containing single-stranded oligonucleotides of different lengths (tetra- to dodecamers) led to the establishment of the relative reactivity cis-[Pt(NH(3))(2)(OH(2))(2)](2+) (activated cisplatin) approximately Rh(2)(O(2)CCF(3))(4) > cis-[Pt(NH(3))(2)Cl(2)] (cisplatin) > [Rh(2)(O(2)CCH(3))(2)(CH(3)CN)(6)](BF(4))(2) > Rh(2)(O(2)CCH(3))(4) approximately Pt(C(6)H(6)O(4))(NH(3))(2) (carboplatin). The relative reactivity of the complexes is associated with the lability of the leaving groups. The general trend is that an increase in the length of the oligonucleotide leads to enhanced reactivity for Rh(2)(O(2)CCH(3))(2)(CH(3)CN)(6)](BF(4))(2) and Rh(2)(O(2)CCH(3))(4) (except for the case of [Rh(2)(O(2)CCH(3))(2)(CH(3)CN)(6)](2+), which reacts faster with the GG octamers than with the dodecamers), whereas the reactivity of Rh(2)(O(2)CCF(3))(4) is independent of the oligonucleotide length. When monitored by ESI, the dodecamers containing GG react faster than the respectiveAA oligonucleotides in reactions with Rh(2)(O(2)CCF(3))(4) and Rh(2)(O(2)CCH(3))(2)(CH(3)CN)(6)](BF(4))(2), whereas AA oligonucleotides react faster with Rh(2)(O(2)CCH(3))(4). The mixed (AG, GA) purine sequences exhibit comparable rates of reactivity with the homopurine (AA, GG) dodecamers in reactions with Rh(2)(O(2)CCH(3))(4). The observation of initial dirhodium-DNA adducts with weak axial (ax) interactions, followed by rearrangement to more stable equatorial (eq) adducts, was achieved by electrospray ionization; the Rh-Rh bond as well as coordinated acetate or acetonitrile ligands remain intact in these dirhodium-DNA adducts. MALDI in-source decay (ISD), collision-induced dissociation (CID) MS-MS, and enzymatic digestion studies followed by MALDI and ESI MS reveal that, in the dirhodium compounds studied, the purine sites of the DNA oligonucleotides interact with the dirhodium core. Ultimately, both MALDI and ESI MS proved to be complementary, valuable tools for probing the identity and stability of dinuclear metal-DNA adducts.     

Mass spectrometry assisted assignments of binding and cleavage sites of copper(II) and platinum(II) complexes towards oxidized insulin B chain

Interaction of cis-[Pt(en)(H2O)2]2+ and [CuL(H2O)]2+, where L is 2-[bis(2-aminoethyl)amino]ethanol, with oxidized insulin B chain in molar ratio of 1 : 1, 1 : 2 and 1 : 3 at pH 2.5 and 40 degrees C has been investigated by electrospray ionization mass spectrometry (ESI-MS) and tandem mass spectrometry (MS/MS). The results show that the binding sites of the two complexes with oxidized insulin B chain are terminal NH2, imidazole groups of His5 and His10. The hydrolytic cleavage studies show that the [CuL(H2O)]2+, upon a pendant hydroxyl group of the ligand, selectively cleaves the peptide bonds at Gly8-Ser9, Asn3-Gln4 and Phe1-Val2, and the cis-[Pt(en)(H2O)2]2+ only cleaves the peptide bond at His10-Leu11. This is the first report of cis-[Pt(en)(H2O)2]2+-promoted cleavage of His-X peptide bond.     

Unprecedented monofunctional metalation of adenine nucleobase in guanine- and thymine-containing dinucleotide sequences by a cytotoxic platinum-acridine hybrid agent

We have investigated the reactions of [PtCl(en)(ACRAMTU-S)](NO(3))(2) (2) (en = ethane-1,2-diamine; ACRAMTU = 1-[2-(acridin-9-ylamino)ethyl]-1,3-dimethylthiourea, acridinium cation, 1), the prototype of a new class of cytotoxic DNA-targeted agents, with 2'-deoxyguanosine (dGuo) and random-sequence native DNA by in-line liquid chromatography/mass spectrometry (LC/MS) and NMR spectroscopy ((1)H, (195)Pt) to identify the covalent adducts formed by platinum. In the mononucleoside model system, two adducts are observed, [Pt(en)(ACRAMTU)(dGuo)](3+) (P1, major) and [Pt(en)(dGuo)(2)](2+) (P2, minor). The reaction, which proceeds significantly slower (half-life 11-12 h at 37 degrees C, pH 6.5) than analogous reactions with cisplatin and reactions of 2 with double-stranded DNA, results in the unexpected displacement of the sulfur-bound acridine ligand in approximately 15% of the adducts. This reactivity is not observed in double-stranded DNA, rendering 1 a typical nonleaving group in reactions with this potential biological target. In enzymatic digests of calf thymus DNA treated with 2, three adducts were identified: [Pt(en)(ACRAMTU)(dGuo)](3+) (A1, approximately 80%), [Pt(en)(ACRAMTU)[d(GpA)]](2+) (A2, approximately 12%), and [Pt(en)(ACRAMTU)[d(TpA)]](2+) (A3, approximately 8%). A1 and P1 proved to be identical species. In the dinucleotide adducts A2 and A3, complex 2 covalently modifies adenine at GA and TA base steps, which are high-affinity intercalation sites of the acridine derivative 1. A2 and A3, which may be formed in the minor groove of DNA, are the first examples of monofunctional adenine adducts of divalent platinum formed in double-stranded DNA. The analysis of the adduct profile indicates that the sequence specificity of 1 plays an important role in the molecular recognition between DNA and the corresponding conjugate, 2. Possible biological consequences of the unusual adduct profile are discussed.     

Influence of dT20 and [d(AT)10]2 on cisplatin hydrolysis studied by two-dimensional [1H,15N] HMQC NMR spectroscopy

The influence of the presence of DNA on the kinetics of cisplatin (cis-[PtCl2(NH3)2]) aquation (replacement of Cl- by H2O) and anation (replacement of H2O by Cl-) involved in the hydrolysis of cisplatin have been determined by two-dimensional [1H,15N] HMQC NMR spectroscopy. Single-stranded dT20 and double-stranded [d(AT)10]2 oligonucleotides were used as DNA models, avoiding guanines which are known to react rapidly with aquated cisplatin forms. Reactions starting from cis-[PtCl2(15NH3)2], or from a stoichiometric mixture of cis-[Pt(15NH3)2(H2O)2]2+ and Cl- (all 0.5 mM Pt(II); in ionic strength, adjusted to 0.095 M or 0.011 M with NaClO4, pH between 3.0 and 4.0) were followed in an NMR tube in both the absence and presence of 0.7 mM dT20 or [d(AT)10]2. In the presence of dT20, we observed a slight and ionic-strength-independent decrease (15-20 %) of the first aquation rate constant, and a more significant decrease of the second anation rate constant. The latter was more important at low ionic strength, and can be explained by efficient condensation of cis-[Pt(15NH3)2(H2O)2]2+ on the surface of single-stranded DNA, in a region depleted of chloride anions. At low ionic strength, we observed an additional set of [1H,15N] HMQC spectral signals indicative of an asymmetric species of PtN2O2 coordination, and we assigned them to phosphate-bound monoadducts of cis-[Pt(15NH3)2(H2O)2]2+. Double-stranded [d(AT)10]2 slowed down the first aquation step also by approximately 15 %; however, we could not determine the influence on the second hydrolysis step because of a significant background reaction with cis-[Pt(NH3)2(H2O)2]2+.     

In vivo detection of DNA adducts induced by cisplatin using capillary HPLC–ICP-MS and their correlation with genotoxic damage in Drosophila melanogaster

The antitumoral effect of cisplatin [cis-diamminodichloroplatinum(II)] in mammals is related to its binding to DNA components. However, there is a lack of specific chemical methods to selectively detect those adducts formed in vivo at low concentrations. In this work, a new sensitive and selective method of determining cisplatin–DNA adducts based on the use of element-selective mass spectrometry is proposed, and the method is then applied to detect cisplatin adducts induced in vivo in somatic cells of Drosophila melanogaster. The bioanalytical strategy proposed here allows the determination of the most important DNA adduct formed between adjacent guanine units of the same DNA strand with cisplatin, and it is based on the coupling of capillary liquid chromatography (cap-LC) to inductively coupled plasma mass spectrometry (ICP-MS). This set-up allows the simultaneous monitoring of the Pt (from the drug) and P (from the DNA components) present in these adducts, once they have been cleaved by enzymatic hydrolysis of the DNA samples. Using this instrumental set-up, the adducts of cisplatin formed in vivo when D. melanogaster flies are exposed to different cisplatin concentrations can be detected and their concentration determined. The results obtained show a direct correlation between the concentration of cisplatin adducts, the induced genotoxic damage (measured as DNA strand breaks using the Comet assay) and the cisplatin concentration. Figure The work illustrates the complementary use of bioanalytical and biological information to study cisplatin interactions with DNA is vivo at biologically relevant concentrations of the drug     

The influence of cisplatin on the gas-phase dissociation of oligonucleotides studied by electrospray ionization tandem mass spectrometry

cis-Diamminedichloroplatinum(II) (cisplatin, DDP) is a cornerstone of anticancer therapy and has become one of the most widely used drugs for the treatment of various epithelial malignancies. The cytotoxicity of cisplatin is mainly based upon its affinity to adjacent guanines in nucleic acids, resulting in the formation of 1,2-intrastrand adducts. In this study the gas-phase dissociation of DNA- and RNA-cisplatin adducts is investigated by electrospray ionization (ESI) tandem mass spectrometry (MS/MS). The fundamental mechanistic aspects of fragmentation are elucidated to provide the basis for the tandem mass spectrometric determination of binding motifs and binding sites of this important anticancer drug. It is shown that the binding of cisplatin to vicinal guanines drastically alters the gas-phase fragmentation behavior of oligonucleotides. The 3′-C-O bond adjacent to the GG base pair is preferentially cleaved, leading to extensive formation of the corresponding w-ion. This observation was even made for oligoribonucleotides, which usually tend to form c- and y-ions under CID conditions. The absence of complementary ions of equal abundance indicates that oligonucleotide-cisplatin adducts are following more than one dissociation pathway in the gas-phase. Several mechanisms that explain the increased cleavage of the 3′-C-O bond and the lack of the complementary a-ion are proposed. Results of additional MS/MS experiments on methylphosphonate-oligodeoxynucleotides confirm the proposed mechanisms.     

Mass Spectrometric Strategies to Improve the Identification of Pt(II)-Modification Sites on Peptides and Proteins

To further explore the binding chemistry of cisplatin (cis-Pt(NH₃)₂Cl₂) to peptides and also establish mass spectrometry (MS) strategies to quickly assign the platinum-binding sites, a series of peptides with potential cisplatin binding sites (Met(S), His(N), Cys(S), disulfide, carboxyl groups of Asp and Glu, and amine groups of Arg and Lys, were reacted with cisplatin, then analyzed by electron capture dissociation (ECD) in a Fourier transform ion cyclotron resonance mass spectrometer (FT-ICR MS). Radical-mediated side-chain losses from the charge-reduced Pt-binding species (such as CH₃S^? or CH₃SH from Met, SH^? from Cys, CO₂ from Glu or Asp, and NH₂ ^? from amine groups) were found to be characteristic indicators for rapid and unambiguous localization of the Pt-binding sites to certain amino acid residues. The method was then successfully applied to interpret the top-down ECD spectrum of an inter-chain Pt-crosslinked insulin dimer, insulin?+?Pt(NH₃)₂?+?insulin (>10 kDa). In addition, ion mobility MS shows that Pt binds to multiple sites in Substance P, generating multiple conformers, which can be partially localized by collisionally activated dissociation (CAD). Platinum(II) (Pt(II)) was found to coordinate to amine groups of Arg and Lys, but not to disulfide bonds under the conditions used. The coordination of Pt to Arg or Lys appears to arise from the migration of Pt(II) from Met(S) as shown by monitoring the reaction products at different pH values by ECD. No direct binding of cisplatin to amine groups was observed at pH 3?~?10 unless Met residues were present in the sequence, but noncovalent interactions between cisplatin hydrolysis and amination [Pt(NH₃)₄]²⁺ products and these peptides were found regardless of pH.

Structural analysis of drug-DNA adducts by tandem mass spectrometry

The utility of electrospray ionisation (ESI) tandem mass spectrometry (MS/MS) for the characterisation of ligand-oligonucleotide adducts is demonstrated with adducts formed between the oligonucleotide 5'-CACGTG-3' and both a platinating agent, cis-diamminedichloroplatinum(II) (cisplatin), and an alkylating ligand, n-bromohexylphenanthridinium bromide (phenC6Br). We have demonstrated previously that negative ion MS/MS spectra of alkylated oligonucleotides show a highly specific fragmentation pathway that enables the site of binding of the ligand to be readily identified. In comparison, the positive ion ESI-MS/MS spectra reported here also show a single major fragmentation pathway, but the dominant ion is the protonated ligand-base adduct. MS/MS of this ion confirms the site on binding of the ligand to the guanine base. MS/MS spectra of cisplatin adducts show much less specific fragmentation than alkylated adducts, particularly in the negative ion mode. This suggests that the ESI-MS/MS spectra of ligand-DNA adducts are strongly influenced by the extent to which the ligand weakens the glycosidic bond in the residue to which it is bound. For platinating agents, which do not labilise the glycosidic bond, additional experiments involving MS/MS of source-generated product ions were required to enable isomeric adducts to be distinguished.     

Towards a better understanding of the cisplatin mode of action

We have studied how platinum(II) complexes [Pt(dien)Cl]Cl, [Pt(en)Cl2] and cisplatin react with hybrid molecules that contain sulfur and nitrogen ligands, in particular Phac-Met-linker-p5'dG (Phac = phenylacetyl), Phac-His-linker-p5'dG, Phac-His-Met-linker-p5'dG and Phac-His-Gly-Met-linker-p5'dCATGGCT. The progress of the reactions was monitored by HPLC, and by [1H,15N]-HSQC NMR when 15N-cisplatin was used. The products were isolated and characterised by using enzymatic and chemical reactions and spectroscopic techniques (UV and/or NMR spectroscopy, electrospray or MALDI-TOF mass spectrometry). The combined use of digestion with proteases and reaction with hydrogen peroxide followed by mass spectrometric analysis indicated the platinum coordination positions on the peptide moiety of the largest hybrid. Monofunctional Pt-S adducts were transformed into Pt-N complexes in which Pt-N7 bonds were formed preferentially. Most of the chelates isolated had Pt-S bonds, and, in the case of cisplatin complexes, loss of the ammine trans to sulfur gave rise to the formation of tricoordinate species with platinum-mediated peptide-nucleotide cross-links. 1,2-Intrachain platinum GpG adducts were only obtained in very small amounts (1-4%).     

A complete kinetic study of GG versus AG plantination suggests that the doubly aquated derivatives of cisplatin are the actual DNA binding species

The hairpin-stabilized double-stranded oligonucleotides d(TATGGTATT4ATACCATA) (I) and d(TATAGTATT4ATACTATA) (II) were allowed to react with the three aquated forms of the antitumor drug cisplatin (cis-[PtCl2(NH3)2], 1) which are likely candidates for DNA binding, that is, cis-[PtC1(NH3)2(H2O)]+ (2), cis-[Pt(NH3)2(H2O)2]2+ (3), and its conjugate base cis-[Pt(OH)(NH3)2(H2O)]+ (4). The reaction between I and [Pt(NH3)3(H2O)]2+ (5) was also studied for comparison. All reactions were monitored by HPLC. The platination reactions of I and II were carried out in NaClO4 (0.1M) at 293 K and at a constant pH of 4.5 +/- 0.1 for 2, 3, and 5. The data relative to the platination by 4 were obtained from measurements in unbuffered NaClO4 solutions (0.1M) at a starting pH close to neutrality, where 3 and 4 are present in equilibrium. In this case, a fit function describing the pH-time curve allowed the determination of the actual concentrations of 3, 4, and the dihydroxo complex. The platination rate constants characterizing the bimolecular reactions between either I or II and 2, 3, and 4 were individually determined along with the rate constants for hydrolysis of the chloro-monoadducts and for the chelation reactions of the aqua-monoadducts. The reactivity of compounds 2-5, which have the general formula cis-[Pt(NH3)2(H2O)(Y)]2+/-, decreases in the order 3>4>5>2, that is, Y= H2O > OH- >NH3 > Cl-, which is the order of decreasing hydrogen-bond donating ability of Y. Deprotonation of 3 to 4 reduces the reactivity of the platinum complex only by a factor of approximately equals 2, and both complexes discriminate between the different purines of I and II in the same manner. Whereas 3 and 4 react approximately three times faster with the GG sequence of I than with the AG sequence of II, 2 shows a similar reactivity towards both sequences. In view of the well-established preferential binding of cisplatin to GG sequences of DNA in vivo and in vitro, this result suggests that the actual DNA platination species are derived from double hydrolysis of cisplatin.     

Interactions of platinum(II) complexes with sulfur-containing peptides studied by electrospray ionization mass spectrometry and tandem mass spectrometry

Reactions of two platinum(II) complexes, cis-[Pt(NH3)2(H2O)2]2+ (Pt1) and cis-[Pt(en)(H2O)2]2+ (Pt2), with several sulfur-containing peptides, have been investigated by electrospray ionization mass spectrometry (ESI-MS) and tandem mass spectrometry (MS/MS). The species produced in the reactions were detected with ESI-MS, and MS/MS analysis was performed to probe structural information. Collision-induced dissociation revealed different dissociation pathways for the main reaction products of the two platinum(II) complexes with the same peptides. The major difference is the prominent loss of ammonia ligand for complexes of Pt1 due to the strong trans effect of sulfur, whereas the loss of ethylenediamine (en) ligand from Pt2 complexes is less favored, reflecting the chelating effect of the bidentate ligand. Despite the differences in dissociation patterns, Pt1 and Pt2, in general, form structurally similar complexes with the same peptides. In the reactions with Met-Arg-Phe-Ala they both produce a N,S-chelate ring through the N-terminal NH2 and sulfur of the Met residue, and in the reactions with Ac-Met-Ala-Ser they bind to the sulfur of Met and deprotonate an amide nitrogen upstream from the anchor site. Both of them are able to promote hydrolysis of the peptides. In reactions with glutathione they both form four-membered Pt2S2 rings and Pt-S-Pt bonding through the bridging thiolate ligand, although the reaction rate is much slower for Pt2 due to steric hindrance of the en ligand.     

HPIC-UV-ICP-SFMS study of the interaction of cisplatin with guanosine monophosphate

Interaction of cis-[Pt(NH3)2Cl2] (cisplatin) with 5'-guanosine monophosphate (5'-GMP) has been investigated for the first time by on-line coupling of high performance ion chromatography (HPIC) to inductively coupled plasma sector field mass spectrometry (ICP-SFMS). The time-dependent reaction course of the cisplatin-5'-GMP system was followed after incubation under simulated physiological conditions by monitoring the decrease in the concentration of 5'-GMP and the increase in the concentration of formed adducts, on the basis of speciation analysis. Because of the two-step mechanism an intermediate mono adduct was observed together with the major product, the bis adduct cis-[Pt(NH3)2(GMP)2]2-. The data obtained correlated well with those from earlier studies employing orthogonal techniques such as capillary electrophoresis (CE). Furthermore, HPIC-ICP-SFMS provided unambiguous stoichiometric information about the major GMP-adduct. For this purpose the platinum-to-phosphorus ratio was determined by simultaneously measuring 31P and 195Pt. To separate significant interferences from 15N16O+, 14N16O1H+, 12C18O1H+, and 13C17O1H+ on 31P, high-mass resolution (m/deltam = 4,500) proved to be mandatory. The P/Pt signal ratio of 2/1 obtained corresponds to the molar ratio in the bis adduct cis-[Pt(NH3)2(GMP)2]2-.     

Internal versus terminal metalation of double-helical oligodeoxyribonucleotides

The formation of adducts between cis-[Pt(NH(3))(2)Cl(2)], Zn(II), and Mn(II) and double-stranded oligodeoxynucleotides was studied by 1D and 2D (1)H, (31)P, and (15)N NMR spectroscopy. For labile adducts involving Zn(II) and Mn(II), both (1)H chemical shifts (Zn(II)) and (1)H line-broadening effects (Mn(II)) showed that in the hexamer [d(GGCGCC)](2) I, the terminal G(1)-N7 is the exclusive binding site, while for the dodecamer [d(GGTACCGGTACC)](2) II, which contains both a terminal and internal GG pair, the preference for metal binding is the internal guanine G(7). Zn(II) binding to II was confirmed by natural-abundance 2D [(1)H,(15)N] HMBC NMR spectroscopy, which unambiguously showed that G(7)-N7 is the preferred binding site. The long duplex [d(GGTATATATACCGGTATATATACC)](2) III was expected to have a more pronounced accumulation of electrostatic potential towards the central part of the sequence (vs the terminal part) than does II. However, the Zn(II) titration of III showed no increase in coordination with the internal Gs (vs the terminal Gs), compared with what was observed for II. The reaction between the nonlabile metal complex cis-[PtCl(2)((15)NH(3))(2)] (cisplatin) and II showed a slight preference for the internal GG pair over the terminal GG pair. However, when the diaqua form of cisplatin cis-[Pt((15)NH(3))(2)(H(2)O)(2)] was reacted with II a more pronounced binding preference for the internal GG pair was observed.     

Direct determination of the primary binding site of cisplatin on cytochrome c by mass spectrometry

Protein—cisplatin interactions lie at the heart of both the effectiveness of cisplatin as a therapeutic agent and side effects associated with cisplatin treatment. Because a greater understanding of the protein—cisplatin interactions at the molecular level can inform the design of cisplatin-like agents for future use, mass spectrometric determination of the binding site of cisplatin on a model protein, cytochrome c, was undertaken in this paper. The monoadduct cytochrome c—Pt(NH₃)₂(H₂O) is found to be the primary adduct produced by the cytochrome c—cisplatin interactions under native conditions. To locate the primary binding site of cisplatin, both free cytochrome c and the cytochrome c adducts underwent trypsin digestion, followed by Fourier transform mass spectrometry (FT-MS) to identify unique fragments in the adduct digest. Four such fragments were found in the adduct digest. Tandem mass spectrometry (MS/MS and MS³ indicates that two fragments are Pt(NH₃)₂(H₂O) bound peptides (Gly56-Glu104 and Asn54-Glu104) with one water associated at the peptide bond Lys79∼Met80, and the other two fragments are heme containing peptides (acety1-Gly1-Lys53 and acety1-Gly1-Lys55). The product-ion spectra of the four fragments reveal that Met65 is the primary binding site of cisplatin on cytochrome c.     

Slowing of cisplatin aquation in the presence of DNA but not in the presence of phosphate: improved understanding of sequence selectivity and the roles of monoaquated and diaquated species in the binding of cisplatin to DNA

1H-15N HSQC NMR spectroscopy is used to study the aquation reactions of cisplatin in 9 mM NaClO4 and 9 mM phosphate (pH 6) solutions at 298 K. For the first time in a single reaction and, therefore, under a single set of reaction conditions, the amounts of all species formed are followed and the rates of aquation, diaquation, and related anation processes are determined in both media. Binding of phosphate to aquated Pt species is observed, but the initial rate of aquation is not affected by the presence of 9 mM phosphate. The reaction between cisplatin and the 14-base-pair self-complementary oligonucleotide 5'-d(AATTGGTACCAATT)-3', having a GpG intrastrand binding site, is investigated. Various kinetic models for this reaction are evaluated and the most appropriate found to be that with a reversible aquation step and a single binding site for the self-complementary duplex. The rate constant for aquation is (1.62 +/- 0.02) x 10(-5) s-1, with the anation rate constant fixed at 4.6 x 10(-3) M-1 s-1, the value obtained from the aquation studies. The rate constants for monofunctional binding of cis-[PtCl(15NH3)2-(OH2)]+ to the sequence were 0.48 +/- 0.19 and 0.16 +/- 0.06 M-1 s-1 for the 3'- and 5'-guanine bases, respectively. Closure rate constants for the monofunctional adducts are (2.55 +/- 0.07) x 10(-5) and (0.171 +/- 0.011) x 10(-5) s-1, for the 3'- and 5'-guanines, respectively. The presence of DNA slows the aquation of cisplatin by 30-40% compared to that observed in 9 mM NaClO4 or 9 mM phosphate, and there is some evidence that the degree of slowing is sequence dependent. The possibility that cis-[Pt(OH)(NH3)2(OH2)]+ contributes to the binding of cisplatin to DNA is investigated, and it is found that about 1% followed this route, the majority of the binding occurring via the monoaquated species cis-[PtCl(NH3)2(OH2)]+. Comparison of the rates of disappearance of cisplatin in reactions at single defined GpG, ApG, GpA, GpTpG and 1,2-interstrand GG binding sites shows that the adduct profile is determined at the level of monofunctional adduct formation.     

Direct qualitative analysis of triacylglycerols by electrospray mass spectrometry using a linear ion trap

Triacylglycerols (TAGs) isolated from a biological sample provide a challenge for mass spectrometric analysis because of the complexity of naturally occurring TAGs, which may contain different fatty acyl substituents resulting in a large number of molecular species having the identical elemental composition. We have investigated the use of mass spectrometry to obtain unambiguous information as to the individual TAG molecular species present in a complex mixture of triacylglycerols using a linear ion trap mass spectrometer. Ammonium adducts of TAGs, [M+NH4]+, were generated by electrospray ionization, which permitted the molecular weight of each TAG molecular species to be determined. The mechanisms involved in the decomposition of the [M+NH4]+ and subsequent fragment ions were investigated using deuterium labeling, MS/MS, and MS3 experiments. Collision induced decomposition of [M+NH4]+ ions resulted in the neutral loss of NH3 and an acyl side-chain (as a carboxylic acid) to generate a diacyl product ion. MS/MS data were used to identify each acyl group present for a given [M+NH4]+ ion, and this information could be combined with molecular weight data to identify possible TAG molecular species present in a biological extract. Subsequent MS3 experiments on the resultant diacyl product ions, which gave rise to acylium (RCO+) and related ions, enabled unambiguous TAG molecular assignments. These strategies of MS, MS/MS, and MS3 experiments were applied to identify components within a complex mixture of neutral lipids extracted from RAW 264.7 cells.     

Disulfide bond cleavage induced by a platinum(II) methionine complex

The cleavage of a disulfide bond and the redox equilibrium of thiol/disulfide are strongly related to the levels of glutathione (GSH)/oxidized glutathione (GSSG) or mixed disulfides in vivo. In this work, the cleavage of a disulfide bond in GSSG induced by a platinum(II) complex [Pt(Met)Cl2] (where Met = methionine) was studied and the cleavage fragments or their platinated adducts were identified by means of electrospray mass spectrometry, high-performance liquid chromatography, and ultraviolet techniques. The second-order rate constant for the reaction between [Pt(Met)Cl2] and GSSG was determined to be 0.4 M(-1) s(-1) at 310 K and pH 7.4, which is 100- and 12-fold faster than those of cisplatin and its monoaqua species, respectively. Different complexes were formed in the reaction of [Pt(Met)Cl2] with GSSG, mainly mono- and dinuclear platinum complexes with the cleavage fragments of GSSG. This study demonstrated that [Pt(Met)Cl2] can promote the cleavage of disulfide bonds. The mechanistic insight obtained from this study may provide a deeper understanding on the potential involvement of platinum complexes in the intracellular GSH/GSSG systems.     

Acetonimine and 4-imino-2-methylpentan-2-amino platinum(II) complexes: synthesis and in vitro antitumor activity

The reaction of [Pt(dmba)(PPh3)Cl] [where dmba = N,C-chelating 2-(dimethylaminomethyl)phenyl] with aqueous ammonia in acetone in the presence of AgClO4 gives the acetonimine complex [Pt(dmba)(PPh3)(NH=CMe2)]ClO4 (1). The reaction of [Pt(dmba)(DMSO)Cl] with aqueous ammonia in acetone in the presence of AgClO4 gives a mixture of [Pt(dmba)(NH=CMe2)2]ClO4 (2) and [Pt(dmba)(imam)]ClO4 (3a) (where imam = 4-imino-2-methylpentan-2-amino). [Pt(dmba)(DMSO)Cl] reacts with [Ag(NH=CMe2)2]ClO4 in a 1:1 molar ratio to give [Pt(dmba)(DMSO)(NH=CMe2)]ClO4 (4). The reaction of [Pt(dmba)(DMSO)Cl] with 20% aqueous ammonia in acetone at 70 degrees C in the presence of KOH gives [Pt(dmba)(CH2COMe)(NH=CMe2)] (5), whereas the reaction of [Pt(dmba)(DMSO)Cl] with 20% aqueous ammonia in acetone in the absence of KOH gives [Pt(dmba)(imam)]Cl (3b). The reaction of [NBu4]2[Pt2(C6F5)4(mu-Cl)2] with [Ag(NH=CMe2)2]ClO4 in a 1:2 molar ratio produces cis-[Pt(C6F5)2(NH=CMe2)2] (6). The crystal structures of 1 x 2 Me2CO, 2, 3a, 5, and 6 have been determined. Values of IC50 were calculated for the new platinum complexes against a panel of human tumor cell lines representative of ovarian (A2780 and A2780 cisR) and breast cancers (T47D). At 48 h incubation time complexes 1, 4, and 5 show very low resistance factors against an A2780 cell line which has acquired resistance to cisplatin. 1, 4, and 5 were more active than cisplatin in T47D (up to 30-fold in some cases). The DNA adduct formation of 1, 4, and 5 was followed by circular dichroism and electrophoretic mobility.