Multinuclear platinum(II)-amine complexes containing bis(aminopropyl)dicarba-closo-dodecaborane(12) ligands

Treatment of the bridging bidentate 1,Z-bis(aminopropyl)-1,Z-dicarba-closo-dodecaborane(12)(1,Z-bis(aminopropyl)-1,Z-carborane) ligands of the type 1,Z-[H(2)N(CH(2))(3)](2)-1,Z-C(2)B(10)H(10)(L(1), Z= 7, 5) or (L(2), Z= 12, 6) with two equivalents of trans-[PtClI(2)(NH(3))](-), followed by halogen ligand metathesis with AgOTf and HCl((aq)) afforded the novel diplatinum(II)-amine species cis-[[PtCl(2)(NH(3))](2)L(n)](7(n= 1) or 8(n= 2), respectively). Similarly, the reaction of L(1) or L(2) with the labile trans-[PtCl(dmf)(NH(3))(2)](+) afforded trans-[[PtCl(NH(3))(2)](2)L(n)](OTf)(2)(9(n= 1) or 10(n= 2), respectively) in good yield and purity. However, isolation of the analogous 1,2-carborane complexes was not possible owing to decomposition reactions that led to extensive degradation of the carborane cage and reduction of the metal centre. The mixed dinuclear complex [cis-[PtCl(2)(NH(3))]-L(1)-trans-[PtCl(NH(3))(2)]]OTf (19) was prepared by treatment of the Boc-protected amine ligand 1-[(Boc)(2)N(CH(2))(3)]-7-[H(2)N(CH(2))(3)]-1,7-C(2)B(10)H(10)(L(3), 15) with trans-[PtCl(dmf)(NH(3))(2)](+) to yield trans-[PtCl(NH(3))(2)L(3)]OTf (16), followed by acid deprotection of the pendant amine group, complexation with trans-[PtClI(2)(NH(3))](-), and halogen ligand metathesis using AgOTf and HCl((aq)). A novel trinuclear species containing 5 was prepared by the addition of two equivalents of 15 to the labile precursor cis-[Pt(dmf)(2)(NH(3))(2)](2+) followed by acid deprotection of the pendant amine groups. Further complexation with two equivalents of trans-[PtClI(2)(NH(3))](-) followed by halogen ligand metathesis using AgOTf and HCl((aq)) afforded the triplatinum(II)-amine species [cis-[Pt(NH(3))(2)(L(1))(2)]-cis-[PtCl(2)(NH(3))](2)](OTf)(2)(23). Complexes 7-10, 19 and 23 represent the first examples of multinuclear platinum(ii)-amine derivatives containing carborane cages. Preliminary in vitro cytotoxicity studies for selected complexes are also reported.     

The chemistry of dinuclear analogues of the anticancer drug cisplatin. A DFT/CDM study

The mechanism of the formation of dinuclear platinum(II) mu-hydroxo complexes from cisplatin hydrolysis products, their interconversion, decomposition, and reactions with biomolecules has been explored using a combined DFT/CDM approach. All activation barriers for the formation of [cis-{Pt(NH(3))(2)(X)}-(mu-OH)-cis-{Pt(NH(3))(2)(Y)}](n)()(+) (X, Y = Cl, OH(2), OH) via nucleophilic attack of a hydroxo complex on an aqua complex are lower than the activation barriers for cisplatin hydrolysis. Considering therapeutic Pt(II) concentrations in tumors, however, only the reaction between two molecules of cis-[Pt(NH(3))(2)(OH(2))(OH)](+) (E) yielding [cis-{Pt(NH(3))(2)(OH(2))}-(mu-OH)-cis-{Pt(NH(3))(2)(OH)}](2+) (5) remains kinetically superior to cisplatin hydrolysis. 5 is strongly stabilized by intramolecular hydrogen bonding between the terminal aqua and hydroxo ligands, resulting in an unusually high pK(a) of 5 and a low pK(a) of its conjugate acid. Unimolecular cyclization of 5 yields the dimers [cis-{Pt(NH(3))(2)}(mu-OH)](2)(2+) (7a with antiperiplanar OH groups and 7b with synperiplanar OH groups). The electronic structure of several diplatinum(II) complexes has been analyzed to clarify whether there are metal-metal interactions. The overall reactivity to guanine (Gua) and dimethyl sulfide (Met, representing the thioether functional group of methionine) increases in the order 5 < 7a approximately 7b < mononuclear complexes, whereas the kinetic selectivity to Gua relative to Met increases in the order 7a approximately 5 < 7b approximately monocationic mononuclear complexes < dicationic mononuclear complex. The results of this work (i) help assess whether dinuclear metabolites play a role in cisplatin chemotherapy, (ii) elucidate the toxicity and pharmacological inactivity of [cis-{Pt(NH(3))(2)}(mu-OH)](2)(2+), and (iii) suggest future investigations of dinuclear anticancer complexes that contain one mu-hydroxo ligand.     

Hydrolytic metal-mediated coupling of dialkylcyanamides at a Pt(IV) center giving a new family of diimino ligands

Addition of excess R(2)NCN to an aqueous solution of K(2)[PtCl(4)] led to the precipitation of [PtCl(2)(NCNR(2))(2)] (R(2) = Me(2) 1; Et(2) 2; C(5)H(10) 3; C(4)H(8)O, 4) in a cis/trans isomeric ratio which depends on temperature. Pure isomers cis-1-3 and trans-1-3 were separated by column chromatography on SiO(2), while trans-4 was obtained by recrystallization. Complexes cis-1-3 isomerize to trans-1-3 on heating in the solid phase at 110 degrees C; trans-1 has been characterized by X-ray crystallography. Chlorination of the platinum(II) complexes cis-1-3 and trans-1-4 gives the appropriate platinum(IV) complexes [PtCl(4)(NCNR(2))(2)] (cis-5-7 and trans-5-8). The compound cis-6 was also obtained by treatment of [PtCl(4)(NCMe)(2)] with neat Et(2)NCN. The platinum(IV) complex trans-[PtCl(4)(NCNMe(2))(2)] (trans-5) in a mixture of undried Et(2)O and CH(2)Cl(2) undergoes facile hydrolysis to give trans-[PtCl(4)[(H)=C(NMe(2))OH](2)] (9; X-ray structure has been determined). The hydrolysis went to another direction with the cis-[PtCl(4)(NCNR(2))(2)] (cis-5-7) which were converted to the metallacycles [PtCl(4)[NH=C(NR(2))OC(NR(2))=NH]] (11-13) due to the unprecedented hydrolytic coupling of the two adjacent dialkylcyanamide ligands giving a novel (for both coordination and organic chemistry) diimino linkage. Compounds 11-13 and also 14 (R(2) = C(4)H(8)O) were alternatively obtained by the reaction between cis-[PtCl(4)(MeCN)(2)] and neat undried NCNR(2). The structures of complexes 11, 13, and 14 were determined by X-ray single-crystal diffraction. All the platinum compounds were additionally characterized by elemental analyses, FAB mass-spectrometry, and IR and (1)H and (13)C[(1)H] NMR spectroscopies.     

A complete kinetic study of GG versus AG plantination suggests that the doubly aquated derivatives of cisplatin are the actual DNA binding species

The hairpin-stabilized double-stranded oligonucleotides d(TATGGTATT4ATACCATA) (I) and d(TATAGTATT4ATACTATA) (II) were allowed to react with the three aquated forms of the antitumor drug cisplatin (cis-[PtCl2(NH3)2], 1) which are likely candidates for DNA binding, that is, cis-[PtC1(NH3)2(H2O)]+ (2), cis-[Pt(NH3)2(H2O)2]2+ (3), and its conjugate base cis-[Pt(OH)(NH3)2(H2O)]+ (4). The reaction between I and [Pt(NH3)3(H2O)]2+ (5) was also studied for comparison. All reactions were monitored by HPLC. The platination reactions of I and II were carried out in NaClO4 (0.1M) at 293 K and at a constant pH of 4.5 +/- 0.1 for 2, 3, and 5. The data relative to the platination by 4 were obtained from measurements in unbuffered NaClO4 solutions (0.1M) at a starting pH close to neutrality, where 3 and 4 are present in equilibrium. In this case, a fit function describing the pH-time curve allowed the determination of the actual concentrations of 3, 4, and the dihydroxo complex. The platination rate constants characterizing the bimolecular reactions between either I or II and 2, 3, and 4 were individually determined along with the rate constants for hydrolysis of the chloro-monoadducts and for the chelation reactions of the aqua-monoadducts. The reactivity of compounds 2-5, which have the general formula cis-[Pt(NH3)2(H2O)(Y)]2+/-, decreases in the order 3>4>5>2, that is, Y= H2O > OH- >NH3 > Cl-, which is the order of decreasing hydrogen-bond donating ability of Y. Deprotonation of 3 to 4 reduces the reactivity of the platinum complex only by a factor of approximately equals 2, and both complexes discriminate between the different purines of I and II in the same manner. Whereas 3 and 4 react approximately three times faster with the GG sequence of I than with the AG sequence of II, 2 shows a similar reactivity towards both sequences. In view of the well-established preferential binding of cisplatin to GG sequences of DNA in vivo and in vitro, this result suggests that the actual DNA platination species are derived from double hydrolysis of cisplatin.     

Biologically active platinum complexes containing 8-thiotheophylline and 8-(methylthio)theophylline

Complexes [Pt(mu-N,S-8-TT)(PPh(3))(2)](2) (1), [Pt(mu-S,N-8-TT)(PTA)(2)](2) (2), [Pt(8-TTH)(terpy)]BF(4) (3), cis-[PtCl(8-MTT)(PPh(3))(2)] (4), cis-[Pt(8-MTT)(2)(PPh(3))(2)] (5), cis-[Pt(8-MTT)(8-TTH)(PPh(3))(2)] (6), cis-[PtCl(8-MTT)(PTA)(2)] (7), cis-[Pt(8-MTT)(2)(PTA)(2)] (8), and trans-[Pt(8-MTT)(2)(py)(2)] (9) (8-TTH(2) = 8-thiotheophylline; 8-MTTH = 8-(methylthio)theophylline; PTA = 1,3,5-triaza-7-phosphaadamantane) are presented and studied by IR and multinuclear ((1)H, (31)P[(1)H]) NMR spectroscopy. The solid-state structure of 4 and 9 has been authenticated by X-ray crystallography. Growth inhibition of the cancer cells T2 and SKOV3 induced by the above new thiopurine platinum complexes has been investigated. The activity shown by complexes 4 and 9 was comparable with cisplatin on T2. Remarkably, 4 and 9 displayed also a valuable activity on cisplatin-resistant SKOV3 cancer cells.     

Heterometallic platinum(II) compounds with β-aminoethylferrocenes: synthesis, electrochemical behaviour and anticancer activity

A new family of heterometallic compounds 3-6 containing ferrocenyl and platinum(II) centers has been synthesized by reaction of 1-β-aminoethylferrocene (1) and 1,1'-bis(β-aminoethyl)ferrocene (2) with Pt(II) precursors. Using K(2)[PtCl(4)] as the Pt(II) source, the cis-square-planar neutral compounds [Fe{η(5)-C(5)H(4)(CH(2))(2)NH(2)}(2)PtCl(2)] (3) and [{Fe(η(5)-C(5)H(4)(CH(2))(2)NH(2))(η(5)-C(5)H(5))}(2)PtCl(2)] (5) were obtained. Reaction of cis-[PtCl(2)(dmso)(2)] with 1 and 2 resulted in the displacement of dmso and chloride ligands from the platinum coordination sphere, affording the cationic and neutral compounds [Fe{η(5)-C(5)H(4)(CH(2))(2)NH(2)}(2)Pt(dmso)Cl]Cl (4) and [Fe(η(5)-C(5)H(4)(CH(2))(2)NH(2))(η(5)-C(5)H(5))Pt(dmso)Cl(2)] (6). Compounds 3-6 were thoroughly characterized using multinuclear ((1)H, (13)C, (195)Pt) NMR, IR spectroscopy, ESI mass spectrometry and elemental analysis. Single-crystal X-ray analysis of heterometallic 6 confirmed the cis geometry of the molecule and revealed that the platinum atom is held in a perfect square-planar geometry. The electrochemical behaviour of the heterometallic compounds 3-6, which has been examined by cyclic (CV) and square wave (SWV) voltammetries in dichloromethane and dmso solution, is characterized by the reversible one-electron oxidation of the ferrocene moieties. The results of the biological activity studies revealed that the organometallic complex 5 is active against all cell lines with GI(50) values in the range 1.7-2.3 μM. When compared to the standard anticancer drug cisplatin, heterotrimetallic 5, possessing two aminoethylferrocenyl units coordinated to the Pt(II) center, showed a greater activity profile in the colon cancer cell line. Cell cycle studies revealed that the new mixed compound exhibits a mechanism of action different to cisplatin.     

Facile cyanamide-ammonia coupling mediated by cis- and trans-[PtIIL2] centers and giving metal-bound guanidines

Diffusion of ammonia into CH(2)Cl(2) solutions of the dialkylcyanamide complexes cis- or trans-[PtCl(2)(RCN)(2)] (R = NMe(2), NEt(2), NC(5)H(10)) at 20-25 degrees C leads to metal-mediated cyanamide-ammonia coupling to furnish, depending on reaction time, one or another type of novel bisguanidine compound, i.e. the molecular cis- or trans-[PtCl(2){NH=C(NH(2))R}(2)] (cis- and trans-) and the cationic cis- or trans-[Pt(NH(3))(2){NH=C(NH(2))R}(2)](Cl)(2) (cis- and trans-) complexes. Compounds cis- or trans- were converted to cis- or trans-, accordingly, upon prolonged treatment with NH(3) in CH(2)Cl(2). The ammination of the relevant nitrile complexes cis- or trans-[PtCl(2)(RCN)(2)] (R = Et, CH(2)Ph, Ph) in CH(2)Cl(2) solutions affords only the cationic compounds cis- or trans-[Pt(NH(3))(2){NH=C(NH(2))R}(2)](Cl)(2) (cis- and trans-). The formulation of was supported by satisfactory C, H and N elemental analyses, agreeable ESI(+)-MS (or FAB(+)-MS), IR, (1)H and (13)C NMR spectroscopies. The structures of trans-, trans-, cis-, trans-, cis-, and cis- were determined by single-crystal X-ray diffraction disclosing structural features and showing that the ammination gives ligated guanidines and amidines in the E- and Z-forms, respectively, where both correspond to the trans-addition of NH(3) to the nitrile species.     

Binding of DNA purine sites to dirhodium compounds probed by mass spectrometry

The adducts formed between the antitumor active compounds [Rh(2)(O(2)CCH(3))(2)(CH(3)CN)(6)](BF(4))(2), Rh(2)(O(2)CCH(3))(4), and Rh(2)(O(2)CCF(3))(4) with DNA oligonucleotides have been assessed by matrix-assisted laser desorption ionization (MALDI) and nanoelectrospray (nanoESI) coupled to time-of-flight mass spectrometry (TOF MS). A series of MALDI studies performed on dipurine (AA, AG, GA, and GG)-containing single-stranded oligonucleotides of different lengths (tetra- to dodecamers) led to the establishment of the relative reactivity cis-[Pt(NH(3))(2)(OH(2))(2)](2+) (activated cisplatin) approximately Rh(2)(O(2)CCF(3))(4) > cis-[Pt(NH(3))(2)Cl(2)] (cisplatin) > [Rh(2)(O(2)CCH(3))(2)(CH(3)CN)(6)](BF(4))(2) > Rh(2)(O(2)CCH(3))(4) approximately Pt(C(6)H(6)O(4))(NH(3))(2) (carboplatin). The relative reactivity of the complexes is associated with the lability of the leaving groups. The general trend is that an increase in the length of the oligonucleotide leads to enhanced reactivity for Rh(2)(O(2)CCH(3))(2)(CH(3)CN)(6)](BF(4))(2) and Rh(2)(O(2)CCH(3))(4) (except for the case of [Rh(2)(O(2)CCH(3))(2)(CH(3)CN)(6)](2+), which reacts faster with the GG octamers than with the dodecamers), whereas the reactivity of Rh(2)(O(2)CCF(3))(4) is independent of the oligonucleotide length. When monitored by ESI, the dodecamers containing GG react faster than the respectiveAA oligonucleotides in reactions with Rh(2)(O(2)CCF(3))(4) and Rh(2)(O(2)CCH(3))(2)(CH(3)CN)(6)](BF(4))(2), whereas AA oligonucleotides react faster with Rh(2)(O(2)CCH(3))(4). The mixed (AG, GA) purine sequences exhibit comparable rates of reactivity with the homopurine (AA, GG) dodecamers in reactions with Rh(2)(O(2)CCH(3))(4). The observation of initial dirhodium-DNA adducts with weak axial (ax) interactions, followed by rearrangement to more stable equatorial (eq) adducts, was achieved by electrospray ionization; the Rh-Rh bond as well as coordinated acetate or acetonitrile ligands remain intact in these dirhodium-DNA adducts. MALDI in-source decay (ISD), collision-induced dissociation (CID) MS-MS, and enzymatic digestion studies followed by MALDI and ESI MS reveal that, in the dirhodium compounds studied, the purine sites of the DNA oligonucleotides interact with the dirhodium core. Ultimately, both MALDI and ESI MS proved to be complementary, valuable tools for probing the identity and stability of dinuclear metal-DNA adducts.     

Platinum(IV) coordination compounds containing 5-methyl-1,2,4-triazolo[1,5-a]pyrimidin-7(4H)-one as nonleaving ligand. Molecular and cytotoxicity in vitro characterization

Novel platinum(IV) coordination compounds with 5-methyl-1,2,4-triazolo[1,5-a]pyrimidin-7(4H)-one (HmtpO): cis-trans-[PtCl(2)(OH)(2)(NH(3))(HmtpO)] (1), cis-trans-[PtCl(5)(HmtpO)][(CH(3))(2)NH(2)] (2) have been prepared and structurally characterized by spectroscopic methods ((1)H, IR and X-ray crystallography (2)). The X-ray results indicate that the local geometry around the platinum(IV) centre approximates a typical octahedral arrangement with nitrogen atom N3 of the HmtpO and three chloride atoms in equatorial positions. The remaining two axial positions are occupied by two chlorides. The preliminary assessment of antitumor properties of (1) was performed as an in vitro antiproliferative activity against HL-60 human acute promyelocytic leukemia and HCV29T bladder cancer. The cis-trans-[PtCl(2)(OH)(2)(NH(3))(HmtpO)] (1) exhibits higher cytotoxic activity against HL-60 (IC(50)=6.4 μM) than cisplatin.     

Synthesis of acetimino complexes of Pt(II) and Pt(IV) and the first heteronuclear mu-acetimido complexes

The reactions of [Ag(NH=CMe2)2]ClO4 with cis-[PtCl2L2] in a 1:1 molar ratio give cis-[PtCl(NH=CMe2)(PPh3)2]ClO4 (1cis) or cis-[PtCl(NH=CMe2)2(dmso)]ClO4 (2), and in 2:1 molar ratio, they produce [Pt(NH=CMe2)2L2](ClO4)2 [L = PPh3 (3), L2= tbbpy = 4,4'-di-tert-butyl-2,2'-dipyridyl (4)]. Complex 2 reacts with PPh3 (1:2) to give trans-[PtCl(NH=CMe2)(PPh3)2]ClO(4) (1trans). The two-step reaction of cis-[PtCl2(dmso)2], [Au(NH=CMe2)(PPh3)]ClO4, and PPh3 (1:1:1) gives [SP-4-3]-[PtCl(NH=CMe2)(dmso)(PPh3)]ClO4 (5). The reactions of complexes 2 and 4 with PhICl2 give the Pt(IV) derivatives [OC-6-13]-[PtCl3(NH=CMe2)(2)(dmso)]ClO4 (6) and [OC-6-13]-[PtCl2(NH=CMe2)2(dtbbpy)](ClO4)2 (7), respectively. Complexes 1cis and 1trans react with NaH and [AuCl(PPh3)] (1:10:1.2) to give cis- and trans-[PtCl{mu-N(AuPPh3)=CMe2}(PPh3)2]ClO4 (8cis and 8trans), respectively. The crystal structures of 4.0.5Et2O.0.5Me2CO and 6 have been determined; both exhibit pseudosymmetry.     

Oxidative Addition of the Dithiobis(formamidinium) Cation to Platinum(II) Chloro Am(m)ine Compounds: Studies on Structure, Spectroscopic Properties, Reactivity, and Cytotoxicity of a New Class of Platinum(IV) Complexes Exhibiting S-Thiourea Coordination

The oxidative addition of the salt [{SC(NMe(2))(2)}(2)]Cl(2).2H(2)O (1), the disulfide-like dimerized form of 1,1,3,3-tetramethylthiourea (tmtu), to Pt(II) chloro am(m)ine compounds is described. Oxidation of the [PtCl(3)(NH(3))](-) anion with 1 in methanol yields cis-[PtCl(4)(NH(3))L] (2; L = tmtu) as the result of the trans addition of one tmtu and one chloro ligand. The same mode of oxidation is found in reactions of 1 with [PtCl(dien)](+) (dien = diethylenetriamine) and trans-[PtCl(2)(NH(3))(2)]. In these cases, however, the oxidation is followed by (light-independent) cis,trans isomerizations, giving trans,mer-[PtCl(2)(dien)L]Cl(2) (4) and fac-[PtCl(3)(NH(3))(2)L]Cl.0.5MeOH (6), respectively. The single-crystal X-ray structures of 2 and trans,mer-[PtCl(2)(dien)L](BF(4))(2) (4a) have been determined. 2: monoclinic, space group P2(1)/n, a = 6.280(1) ?, b = 13.221(3) ?, c = 16.575(2) ?, beta = 96.45(1) degrees, Z = 4. 4a: monoclinic, space group C2/m, a = 21.093(5) ?, b = 8.9411(9) ?, c = 14.208(2) ?, beta = 124.65(2) degrees, Z = 4. The tmtu ligands are S-bound. In 2 a pronounced trans influence of the S-donor ligand on the Pt-Cl bond (2.370(1) ?) trans to sulfur is observed. The unusual acidity of the Pt(IV) complexes exhibiting tmtu coordination trans to chloride is attributed to hydrolysis of the labilized Pt-Cl(trans) bond, which is supported by ion sensitive electrode measurements. An upfield shift of the (195)Pt resonances is found on changing the ligand combination from NCl(4)S (2) to N(3)Cl(2)S (4). This order correlates with the trans influences of the ligands: tmtu > am(m)ine > chloride. The cytotoxicity of 2 and 6 in L1210 cell lines is reported and discussed in terms of a possible mechanism of action of the compounds invivo. It is suggested that tmtu may act as a lipophilic carrier ligand and therefore enhance the cellular uptake of the new potential Pt(IV) drugs.     

Internal versus terminal metalation of double-helical oligodeoxyribonucleotides

The formation of adducts between cis-[Pt(NH(3))(2)Cl(2)], Zn(II), and Mn(II) and double-stranded oligodeoxynucleotides was studied by 1D and 2D (1)H, (31)P, and (15)N NMR spectroscopy. For labile adducts involving Zn(II) and Mn(II), both (1)H chemical shifts (Zn(II)) and (1)H line-broadening effects (Mn(II)) showed that in the hexamer [d(GGCGCC)](2) I, the terminal G(1)-N7 is the exclusive binding site, while for the dodecamer [d(GGTACCGGTACC)](2) II, which contains both a terminal and internal GG pair, the preference for metal binding is the internal guanine G(7). Zn(II) binding to II was confirmed by natural-abundance 2D [(1)H,(15)N] HMBC NMR spectroscopy, which unambiguously showed that G(7)-N7 is the preferred binding site. The long duplex [d(GGTATATATACCGGTATATATACC)](2) III was expected to have a more pronounced accumulation of electrostatic potential towards the central part of the sequence (vs the terminal part) than does II. However, the Zn(II) titration of III showed no increase in coordination with the internal Gs (vs the terminal Gs), compared with what was observed for II. The reaction between the nonlabile metal complex cis-[PtCl(2)((15)NH(3))(2)] (cisplatin) and II showed a slight preference for the internal GG pair over the terminal GG pair. However, when the diaqua form of cisplatin cis-[Pt((15)NH(3))(2)(H(2)O)(2)] was reacted with II a more pronounced binding preference for the internal GG pair was observed.     

Synthesis, characterization and antiproliferative activity on mesothelioma cell lines of bis(carboxylato)platinum(IV) complexes based on picoplatin

The synthesis and characterization of a series of picoplatin-based (picoplatin = [PtCl(2)(mpy)(NH(3))], mpy = 2-methylpyridine), Pt(iv) complexes with axial carboxylato ligands of increasing length are reported. The synthesis is based on the oxidation with hydrogen peroxide of picoplatin to give the cis,cis,trans-[PtCl(2)(mpy)(NH(3))(OH)(2)] intermediate and then its transformation into the dicarboxylato complexes cis,cis,trans-[PtCl(2)(mpy)(NH(3))(RCOO)(2)] (R = CH(3)(CH(2))(n), n = 0-4) with the corresponding anhydride. Pt(iv) complexes with n = 0-2 were selected to be tested on four malignant pleural mesothelioma (MPM) cell lines, on human mesothelial cells (HMC), and on the cisplatin-sensitive ovarian A2780 cell line along with cisplatin as a metallo-drug reference. In general, the longer the axial chain, the more cytotoxic and selective the Pt(IV) complex is. Pt(IV) analogs show good activity on the MPM cell lines, approaching or in some case bypassing that of cisplatin and represent quite promising drug candidates for the treatment of tumors whose chemoresistance is mainly based on glutathione overexpression, such as MPM.     

Theoretical study of rhodium(III)-catalyzed hydrogenation of carbon dioxide into formic acid. Significant differences in reactivity among rhodium(III), rhodium(I), and ruthenium(II) complexes

The title reaction was theoretically investigated, where cis-[RhH(2)(PH(3))(3)](+) and cis-[RhH(2)(PH(3))(2)(H(2)O)](+) were adopted as models of the catalyst. The first step of the catalytic cycle is the CO(2) insertion into the Rh(III)-H bond, of which the activation barrier (E(a)) is 47.2 and 28.4 kcal/mol in cis-[RhH(2)(PH(3))(3)](+) and cis-[RhH(2)(PH(3))(2)(H(2)O)](+), respectively, where DFT(B3LYP)-calculated E(a) values (kcal/mol unit) are given hereafter. These results indicate that an active species is not cis-[RhH(2)(PH(3))(3)](+) but cis-[RhH(2)(PH(3))(2)(H(2)O)](+). After the CO(2) insertion, two reaction courses are possible. In one course, the reaction proceeds through isomerization (E(a) = 2.8) of [RhH(eta(1)- OCOH)(PH(3))(2)(H(2)O)(2)](+), five-centered H-OCOH reductive elimination (E(a) = 2.7), and oxidative addition of H(2) to [Rh(PH(3))(2)(H(2)O)(2)](+) (E(a) = 5.8). In the other one, the reaction proceeds through isomerization of [RhH(eta(1)-OCOH)(PH(3))(2)(H(2)O)(H(2))](+) (E(a) = 5.9) and six-centered sigma-bond metathesis of [RhH(eta(1)-OCOH)(PH(3))(2)(H(2)O)](+) with H(2) (no barrier). RhH(PH(3))(2)-catalyzed hydrogenation of CO(2) proceeds through CO(2) insertion (E(a) = 1.6) and either the isomerization of Rh(eta(1)-OCOH)(PH(3))(2)(H(2)) (E(a) = 6.1) followed by the six-centered sigma-bond metathesis (E(a) = 0.3) or H(2) oxidative addition to Rh(eta(1)-OCOH)(PH(3))(2) (E(a) = 7.3) followed by isomerization of RhH(2)(eta(1)-OCOH)(PH(3))(2) (E(a) = 6.2) and the five-centered H-OCOH reductive elimination (E(a) = 1.9). From these results and our previous results of RuH(2)(PH(3))(4)-catalyzed hydrogenation of CO(2) (J. Am. Chem. Soc. 2000, 122, 3867), detailed discussion is presented concerning differences among Rh(III), Rh(I), and Ru(II) complexes.     

Influence of dT20 and [d(AT)10]2 on cisplatin hydrolysis studied by two-dimensional [1H,15N] HMQC NMR spectroscopy

The influence of the presence of DNA on the kinetics of cisplatin (cis-[PtCl2(NH3)2]) aquation (replacement of Cl- by H2O) and anation (replacement of H2O by Cl-) involved in the hydrolysis of cisplatin have been determined by two-dimensional [1H,15N] HMQC NMR spectroscopy. Single-stranded dT20 and double-stranded [d(AT)10]2 oligonucleotides were used as DNA models, avoiding guanines which are known to react rapidly with aquated cisplatin forms. Reactions starting from cis-[PtCl2(15NH3)2], or from a stoichiometric mixture of cis-[Pt(15NH3)2(H2O)2]2+ and Cl- (all 0.5 mM Pt(II); in ionic strength, adjusted to 0.095 M or 0.011 M with NaClO4, pH between 3.0 and 4.0) were followed in an NMR tube in both the absence and presence of 0.7 mM dT20 or [d(AT)10]2. In the presence of dT20, we observed a slight and ionic-strength-independent decrease (15-20 %) of the first aquation rate constant, and a more significant decrease of the second anation rate constant. The latter was more important at low ionic strength, and can be explained by efficient condensation of cis-[Pt(15NH3)2(H2O)2]2+ on the surface of single-stranded DNA, in a region depleted of chloride anions. At low ionic strength, we observed an additional set of [1H,15N] HMQC spectral signals indicative of an asymmetric species of PtN2O2 coordination, and we assigned them to phosphate-bound monoadducts of cis-[Pt(15NH3)2(H2O)2]2+. Double-stranded [d(AT)10]2 slowed down the first aquation step also by approximately 15 %; however, we could not determine the influence on the second hydrolysis step because of a significant background reaction with cis-[Pt(NH3)2(H2O)2]2+.     

Platinum(IV) analogues of AMD473 (cis-[PtCl2(NH3)(2-picoline)]): preparative, structural, and electrochemical studies

The preparation and oxidation of the anticancer drug AMD473, cis-[PtCl2(NH3)(2-pic)] (2-pic = 2-methylpyridine), has been investigated. cis-[PtCl2(NH3)(2-pic)] is readily oxidized with peroxide to give the trans-dihydroxoplatinum(IV) complex cis,trans,cis-[PtCl2(OH)2(NH3)(2-pic)]. The crystal structure of this complex reveals that it is highly strained as a result of a steric clash between the methyl group of the 2-picoline ligand and an axial hydroxo ligand, with the Pt-N-C angle adjacent to this clash opened up to an unprecedented 138.6(6) degrees . Attempts at converting the dihydroxoplatinum(IV) complex to dichloro and diacetato analogues were unsuccessful with reaction with HCl leading to loss and protonation of the 2-picoline ligand to form the salt (2-picH)[PtCl5(NH3)] and the platinum(II) complex cis-[PtCl2(NH3)(2-pic)], both confirmed by crystallography. Electrochemical studies revealed that cis,trans,cis-[PtCl2(OH)2(NH3)(2-pic)] is reduced more readily (-714 mV vs Ag/AgCl) than its pyridine analogue cis,trans,cis-[PtCl2(OH)2(NH3)(pyridine)] (-770 mV vs Ag/AgCl) consistent with the steric clash in the former complex destabilizing the platinum(IV) oxidation state.     

Amidoximes provide facile platinum(II)-mediated oxime-nitrile coupling

The nucleophilic addition of amidoximes R'C(NH(2))═NOH [R' = Me (2.Me), Ph (2.Ph)] to coordinated nitriles in the platinum(II) complexes trans-[PtCl(2)(RCN)(2)] [R = Et (1t.Et), Ph (1t.Ph), NMe(2) (1t.NMe(2))] and cis-[PtCl(2)(RCN)(2)] [R = Et (1c.Et), Ph (1c.Ph), NMe(2) (1c.NMe(2))] proceeds in a 1:1 molar ratio and leads to the monoaddition products trans-[PtCl(RCN){HN═C(R)ONC(R')NH(2)}]Cl [R = NMe(2); R' = Me ([3a]Cl), Ph ([3b]Cl)], cis-[PtCl(2){HN═C(R)ONC(R')NH(2)}] [R = NMe(2); R' = Me (4a), Ph (4b)], and trans/cis-[PtCl(2)(RCN){HN═C(R)ONC(R')NH(2)}] [R = Et; R' = Me (5a, 6a), Ph (5b, 6b); R = Ph; R' = Me (5c, 6c), Ph (5d, 6d), correspondingly]. If the nucleophilic addition proceeds in a 2:1 molar ratio, the reaction gives the bisaddition species trans/cis-[Pt{HN═C(R)ONC(R')NH(2)}(2)]Cl(2) [R = NMe(2); R' = Me ([7a]Cl(2), [8a]Cl(2)), Ph ([7b]Cl(2), [8b]Cl(2))] and trans/cis-[PtCl(2){HN═C(R)ONC(R')NH(2)}(2)] [R = Et; R' = Me (10a), Ph (9b, 10b); R = Ph; R' = Me (9c, 10c), Ph (9d, 10d), respectively]. The reaction of 1 equiv of the corresponding amidoxime and each of [3a]Cl, [3b]Cl, 5b-5d, and 6a-6d leads to [7a]Cl(2), [7b]Cl(2), 9b-9d, and 10a-10d. Open-chain bisaddition species 9b-9d and 10a-10d were transformed to corresponding chelated bisaddition complexes [7d](2+)-[7f](2+) and [8c](2+)-[8f](2+) by the addition of 2 equiv AgNO(3). All of the complexes synthesized bear nitrogen-bound O-iminoacylated amidoxime groups. The obtained complexes were characterized by elemental analyses, high-resolution ESI-MS, IR, and (1)H NMR techniques, while 4a, 4b, 5b, 6d, [7b](Cl)(2), [7d](SO(3)CF(3))(2), [8b](Cl)(2), [8f](NO(3))(2), 9b, and 10b were also characterized by single-crystal X-ray diffraction.     

A photoactivated trans-diammine platinum complex as cytotoxic as cisplatin

The synthesis and X-ray structure (as the tetrahydrate) of the platinum(IV) complex trans,trans,trans-[Pt(N(3))(2)(OH)(2)(NH(3))(2)] 3 are described and its photochemistry and photobiology are compared with those of the cis isomer cis,trans,cis-[Pt(N(3))(2)(OH)(2)(NH(3))(2)] 4. Complexes 4 and 3 are potential precursors of the anticancer drug cisplatin and its inactive trans isomer transplatin, respectively. The trans complex 3 is octahedral, contains almost linear azide ligands, and adopts a layer structure with extensive intermolecular hydrogen bonding. The intense azide-to-platinum(IV) charge-transfer band of complex 3 (285 nm; epsilon=19 500 M(-1) cm(-1)) is more intense and bathochromically shifted relative to that of the cis isomer 4. In contrast to transplatin, complex 3 rapidly formed a platinum(II) bis(5'-guanosine monophosphate) (5'-GMP) adduct when irradiated with UVA light, and did not react in the dark. Complexes 3 and 4 were non-toxic to human skin cells (keratinocytes) in the dark, but were as cytotoxic as cisplatin on irradiation for a short time (50 min). Damage to the DNA of these cells was detected by using the "comet" assay. Both trans- and cis-diammine platinum(IV) diazide complexes therefore have potential as photochemotherapeutic agents.     

Slowing of cisplatin aquation in the presence of DNA but not in the presence of phosphate: improved understanding of sequence selectivity and the roles of monoaquated and diaquated species in the binding of cisplatin to DNA

1H-15N HSQC NMR spectroscopy is used to study the aquation reactions of cisplatin in 9 mM NaClO4 and 9 mM phosphate (pH 6) solutions at 298 K. For the first time in a single reaction and, therefore, under a single set of reaction conditions, the amounts of all species formed are followed and the rates of aquation, diaquation, and related anation processes are determined in both media. Binding of phosphate to aquated Pt species is observed, but the initial rate of aquation is not affected by the presence of 9 mM phosphate. The reaction between cisplatin and the 14-base-pair self-complementary oligonucleotide 5'-d(AATTGGTACCAATT)-3', having a GpG intrastrand binding site, is investigated. Various kinetic models for this reaction are evaluated and the most appropriate found to be that with a reversible aquation step and a single binding site for the self-complementary duplex. The rate constant for aquation is (1.62 +/- 0.02) x 10(-5) s-1, with the anation rate constant fixed at 4.6 x 10(-3) M-1 s-1, the value obtained from the aquation studies. The rate constants for monofunctional binding of cis-[PtCl(15NH3)2-(OH2)]+ to the sequence were 0.48 +/- 0.19 and 0.16 +/- 0.06 M-1 s-1 for the 3'- and 5'-guanine bases, respectively. Closure rate constants for the monofunctional adducts are (2.55 +/- 0.07) x 10(-5) and (0.171 +/- 0.011) x 10(-5) s-1, for the 3'- and 5'-guanines, respectively. The presence of DNA slows the aquation of cisplatin by 30-40% compared to that observed in 9 mM NaClO4 or 9 mM phosphate, and there is some evidence that the degree of slowing is sequence dependent. The possibility that cis-[Pt(OH)(NH3)2(OH2)]+ contributes to the binding of cisplatin to DNA is investigated, and it is found that about 1% followed this route, the majority of the binding occurring via the monoaquated species cis-[PtCl(NH3)2(OH2)]+. Comparison of the rates of disappearance of cisplatin in reactions at single defined GpG, ApG, GpA, GpTpG and 1,2-interstrand GG binding sites shows that the adduct profile is determined at the level of monofunctional adduct formation.