共查询到20条相似文献,搜索用时 31 毫秒
1.
J. R. Albani 《Journal of fluorescence》2014,24(1):93-104
Fluorescence intensity decays of L-tryptophan free in polar, hydrophobic and mixture of polar-hydrophobic solvents were recorded along the emission spectrum (310–410 nm). Analysis of the data show that emission of tryptophan occurs with two lifetimes in 100 % polar and hydrophobic environments. The values of the two lifetimes are not the same in both environments while their populations (pre-exponentials values) are identical. Fluorescence lifetimes and pre-exponentials values do not change with the excitation wavelength and thus are independent of excitation energy. Our results indicate that tryptophan emission occurs from two specific sub-structures existing in the excited state. These sub-structures differ from those present in the ground states and characterize an internal property and/or organization of the tryptophan structure in the excited state. By sub-substructure, we mean here tryptophan backbone and its electronic cloud. In ethanol, three fluorescence lifetimes were measured; two lifetimes are very close to those observed in water (0.4–0.5 ns and 2–4 ns). Presence of a third lifetime for tryptophan in ethanol results from the interaction of both hydrophobic and hydrophilic dipoles or chemical functions of ethanol with the fluorophore. 相似文献
2.
Joseph R. Lakowicz Borys Kierdaszuk Ignacy Gryczynski Henryk Malak 《Journal of fluorescence》1996,6(1):51-59
We examined the steady-state and time-resolved emission of liver alcohol dehydrogenase resulting from one-photon and two-photon excitation. Previous studies with one-photon excitation revealed that the two nonidentical tryptophan residues display different emission spectra and decay times. The use of two-photon excitation resulted in similar emission spectra, multiexponential intensity decays, time-resolved emission spectra, and anisotropy decays as was observed for one-photon excitation. These results suggest that both nonidentical tryptophan residues are excited to a similar extent for one- and two-photon excitation. However, the limiting anisotropy (r
0) with two-photon excitation from 585 to 610 nm is below 0.1 and appears distinct from that observed previously forN-acetyl-l-tryptophanamide.Abbreviations LADH
liver alcohol dehydrogenase
- -NAD+
-nicotinamide adenine dinucleotide
- OPE
one-photon excitation
- OPIF
one-photon induced fluorescence
- TPE
two-photon excitation
- TCSPC
time-correlated single photon counting
- TPIF
two-photon induced fluorescence 相似文献
3.
We examined the emission spectra, intensity decays, and anisotropy decays of the DNA-4,6-diamidino-2-phenylindole (DAPI) complex resulting from one- and two-photon excitation of fluorescence. Similar lifetimes and correlation times were recovered from the frequency-domain data. However, the initial anisotropies of DAPI for one- and two-photon excitation revealed different angles between the absorption and the emission oscillators, 17.8 and 23.8°, respectively. This suggests the presence of two overlapping transitions in DAPI with different one- and two-photon cross sections for absorption. 相似文献
4.
J. R. Albani 《Journal of fluorescence》2014,24(1):105-117
Fluorescence intensity decays of L-tryptophan in proteins dissolved in pH 7 buffer, in ethanol and in 6 M guanidine pH 7.8 and in lyophilized proteins were measured. In all protein conditions, three lifetimes were obtained along the emission spectrum (310–410 nm). The two shortest lifetimes are in the same range of those obtained for L-Trp in water or in ethanol. Thus, these two lifetimes originate from specific two sub-structures existing in the excited state and are inherent to the tryptophan structure independently of the surrounding environment (amino acids residues, solvent, etc.) In proteins, the third lifetime originates from the interactions that are occurring between tryptophan residues and neighboring amino acids. Populations of these lifetimes are independent of the excitation wavelength and thus originate from pre-defined sub structures existing in the excited state and put into evidence after tryptophan excitation. Fluorescence decay studies of different tripeptides having a tryptophan residue in second position show that the best analysis is obtained with two fluorescence lifetimes. Consequently, this result seems to exclude the possibility that peptide bond induces the third fluorescence lifetimes. Indole dissolved in water and/or in ethanol emits with two fluorescence lifetimes that are completely different from those observed for L-Trp. Absence of the third lifetime in ethanol demonstrates that indole behaves differently when compared to tryptophan. Thus, it seems not adequate to attribute fluorescence lifetime or fluorescence properties of tryptophan to indole ring and to compare tryptophan fluorescence properties in proteins to molecules having close structures such as NATA which fluoresces with one lifetime. 相似文献
5.
R. Akers G. Alexander J. Allison K. Ametewee K. J. Anderson S. Arcelli S. Asai D. Axen G. Azuelos A. H. Ball et al. 《Zeitschrift fur Physik C Particles and Fields》1995,67(3):389-401
Updated measurements of the B0 and B+ meson lifetimes are presented. From a data sample of 1.72 million hadronic Z0 decays recorded during the period 1991 to 1993, a sample of approximately 1000 semileptonic B meson decays containing a D0, D+ or D*+ has been isolated. From the distribution of decay times in the different samples the lifetimes of the B0 and B+ mesons are determined to be 1.53±0.12±0.08 ps and 1.52±0.14±0.09 ps, respectively, where the first error is statistical and the second systematic. The ratio of the B+ to B0 lifetimes is measured to be 0.99±0.14
–0.04
+0.05
, confirming expectations that the lifetimes are similar. 相似文献
6.
A. Ya. Khaĭrullina M. V. Parhotz T. V. Oleĭnik L. M. Buĭ B. M. Dzhagarov 《Optics and Spectroscopy》2001,91(1):46-52
The potential of using multiple light scattering methods to monitor the state and concentration of photosensitizer and hemoglobin in whole blood is demonstrated. Samples of whole blood with various contents of chlorine e 6 photosensitizer were studied in the spectral region of 620–850 nm. On the basis of experimentally measured coefficients of diffuse reflection and transmission, absorption spectra of blood with and without the photosensitizer and the concentrations of oxy-, deoxy-, and methemoglobin in the samples are calculated. On the basis of this information, the absorption spectrum of chlorine e 6 in whole blood is reconstructed and its state and concentration are estimated for the first time. It is found that chlorine e 6 in whole blood occurs mainly in the monomer form. 相似文献
7.
Greg S. Harms Steve W. Pauls John F. Hedstrom Carey K. Johnson 《Journal of fluorescence》1997,7(4):283-292
We have examined the lifetimes and rotational correlation times of dityrosine emission by time-correlated single-photon counting. We first noticed dityrosine fluorescence in samples of tyrosine and tyrosine dipeptides by its characteristic red-shifted emission at 400 to 430 nm. The longer rotational correlation time relative to tyrosine proved that this fluorescence emanated from a distinct species. Comparison with the fluorescence properties of synthesized dityrosine established the identity of the emitting species. Fluorescence intensity decays of dityrosine are generally characterized by two decay components, one with a lifetime in the range of 150 to 800 ps and another between 2.5 and 4.5 ns. We found no evidence for an excited-state reaction, since a rising phase (negative-amplitude component) was not observed. In the pH range from 4 to 10, two ground-state species exist in equilibrium with pK
a 7. Both species exhibit two fluorescence decays. The average fluorescence lifetime increases gradually with pH over the pH range from 4 to 10 and decreases at pH 2. Anisotropy decays were measured for dityrosine and the alanine–dityrosine–alanine and leucine–dityrosine–leucine dipeptides. The rotational correlation times of dityrosine and dityrosine dipeptides increase linearly with van der Waals volumes. The slope indicates a stronger solute–solvent interaction than predicted with stick boundary conditions. It is suggested that these interactions result from the presence of two zwitterionic pairs. 相似文献
8.
G. Morello M. Anni P.D. Cozzoli L. Manna R. Cingolani M. De Giorgi 《Superlattices and Microstructures》2008,43(5-6):528
Time Resolved Photoluminescence (TRPL) measurements on the picosecond time scale (temporal resolution of 17 ps) on colloidal CdSe and CdSe/ZnS Quantum Dots (QDs) were performed, to elucidate the role of intrinsic and surface states on the emission process. Transient PL spectra reveal three emission peaks with different lifetimes (60 ps, 460 ps and 9–10 ns, from the bluest to the reddest peak). The energy separations among the states, together with their characteristic decay times, allow us to attribute the two higher energy peaks to ±1U and ±1L bright states of the fine structure picture of spherical CdSe QDs, and the third one to surface states emission, respectively. We show that the contribution of surface emission to the PL results to be different for the two samples studied (67% in the CdSe QDs and 32% in CdSe/ZnS QDs), confirming the decisive role of the ZnS shell in the improvement of the surface passivation. 相似文献
9.
We measured the wavelength-dependent intensity decays of 4,9-dihydro-4,6-dimethyl-9-oxo-1H-imidazo-1,2a-purine (Yt-base) in propanol to determine the time-resolved emission spectra and rates of spectral relaxation. We found that resolution of the spectral relaxation times was dramatically improved by global analysis of the frequency-domain data with increasing amounts of the collisional quencher CCl4. Collisional quenching preferentially decreases the longer-lived relaxed component of the emission, thereby increasing the fractional contribution of the incompletely relaxed portion of the emission. The data could not be explained by a single spectral relaxation time, and at least two relaxation times are needed to describe the time-dependent emission center of gravity of Yt-base.Dedicated to Professor Stefan Paszyc on the occasion of his 70th birthday. 相似文献
10.
Sun B Shi GA Nageswara Rao SV Stavola M Tolk NH Dixit SK Feldman LC Lüpke G 《Physical review letters》2006,96(3):035501
Vibrational lifetimes of hydrogen and deuterium related bending modes in semiconductors are measured by transient bleaching spectroscopy and high-resolution infrared absorption spectroscopy. We find that the vibrational lifetimes follow a universal frequency-gap law; i.e., the decay time increases exponentially with increasing decay order, with values ranging from 1 ps for a one-phonon process to 265 ps for a four-phonon process. The temperature dependence of the lifetime shows that the bending mode decays by lowest-order multiphonon process. Our results provide new insights into vibrational decay and the giant isotope effect of hydrogen in semiconductor systems. 相似文献
11.
We report steady state fluorescence and lifetime emission studies of d(GGTTGGTGTGGTTGG) (TBA) and d(GGGTTAGGGTTAGGGTTAGGG)
(Htelom) oligonucleotides labeled with pyrene through a 3-aminopropyl linker. Such G-rich sequences are able to self-assemble
into G-quadruplexes, especially in the presence of specific cations like potassium. A comparative studies with single- and
double-labeled G-quadruplexes were carried out. For each probe we have measured fluorescence decays for emission wavelength
of 390 and 480 nm in the varying concentration of potassium ion. We have calculated average lifetimes <τ> for every system
as well as the fractional distribution αi of emitting species. 相似文献
12.
L. Arizmendi V. De Andrés E. M. De Miguel-Sanz M. Carrascosa 《Applied physics. B, Lasers and optics》2005,80(3):351-354
In this paper the thermal fixing of holographic gratings with K-vectors perpendicular to the crystallographic c-axis of LiNbO3 is considered in order to obtain information about anisotropy of the proton thermal diffusion in this crystal. Specifically, thermal decays of fixed holograms in particular crystallographic directions are measured and related with proton diffusion. The values obtained are compared with previous data of decays of fixed holograms with K-vector parallel to the c-axis. The results show a high anisotropy of the thermal diffusion of protons in lithium niobate crystals. 相似文献
13.
Acosta D Adelman J Affolder T Akimoto T Albrow MG Ambrose D Amerio S Amidei D Anastassov A Anikeev K Annovi A Antos J Aoki M Apollinari G Arisawa T Arguin JF Artikov A Ashmanskas W Attal A Azfar F Azzi-Bacchetta P Bacchetta N Bachacou H Badgett W Barbaro-Galtieri A Barker GJ Barnes VE Barnett BA Baroiant S Barone M Bauer G Bedeschi F Behari S Belforte S Bellettini G Bellinger J Ben-Haim E Benjamin D Beretvas A Bhatti A Binkley M Bisello D Bishai M Blair RE Blocker C Bloom K Blumenfeld B Bocci A 《Physical review letters》2005,94(10):101803
We present measurements of the lifetimes and polarization amplitudes for B(0)(s)-->J/psiphi and B(0)(d)-->J/psiK(*0) decays. Lifetimes of the heavy and light mass eigenstates in the B(0)(s) system are separately measured for the first time by determining the relative contributions of amplitudes with definite CP as a function of the decay time. Using 203+/-15 B(0)(s) decays we obtain tau(L) = (1.05(+0.16)(-0.13) +/- 0.02) ps and tau(H) = (2.07(+0.58)(-0.46) +/- 0.03) ps. Expressed in terms of the difference DeltaGamma(s) and average Gamma(s), of the decay rates of the two eigenstates, the results are DeltaGamma(s)/Gamma(s) = (65(+25)(-33) +/- 1)% and DeltaGamma(s) = (0.47(+0.19)(-0.24) +/- 0.01) ps(-1). 相似文献
14.
Joseph R. Lakowicz Henryk Cherek Józef Kuśba Ignacy Gryczynski Michael L. Johnson 《Journal of fluorescence》1993,3(2):103-116
This didactic paper summarizes the mathematical expressions needed for analysis of fluorescence anisotropy decays from polarized frequency-domain fluorescence data. The observed values are the phase angle difference between the polarized components of the emission and the modulated anisotropy, which is the ratio of the polarized and amplitude-modulated components of the emission. This procedure requires a separate measurement of the intensity decay of the total emission. The expressions are suitable for any number of exponential components in both the intensity decay and the anisotropy decay. The formalism is generalized for global analysis of anisotropy decays measured at different excitation wavelengths and for different intensity decay times as the result of quenching. Additionally, we describe the expressions required for associated anisotropy decays, that is, anisotropy decays where each correlation time is associated with a decay time present in the anisotropy decay. And finally, we present expressions appropriate for distributions of correlation times. This article should serve as a reference for researchers using frequency-domain fluorometry. 相似文献
15.
Albani JR 《Journal of fluorescence》2011,21(4):1683-1687
Origin of tryptophan residues fluorescence in β-lactoglobulin is analyzed. Fluorescence lifetimes and spectra of β-lactoglobulin
solution are measured at pH going from 2 to 12 and in 6 M guanidine. Tryptophan residues emit with three lifetimes at all
conditions. Two lifetimes (0.4–0.5 ns and 2–4 ns) are in the same range of those measured for tryptophan free in solution.
Lifetimes in the denatured states are lower than those measured in the native state. Pre-exponential values are modified with
the protein structure. Data are identical to those already obtained for other proteins. Fluorescence lifetimes characterize
internal states of the tryptophan residues (Tryptophan sub-structures) independently of the tryptophan environments, the third
lifetime results from the interaction that is occurring between the Trp residues and its environment. Pre-exponential values
characterize substructures populations. In conclusion, tryptophan mission occurs from substates generated in the excited state.
This is in good agreement with the theory we described in recent works. 相似文献
16.
A quadrupole moment of 37?8+14 b has been deduced for the 40 ps shape isomer in 236Pu. The value has been derived from a measured delayed fission fragment angular distribution with an anisotropy of 1.48 ± 0.15 for the isomeric decays at 30°. The deformation of the second minimum expressed by the axes ratio of a spheroid is found to be 2.0 ± 0.3. 相似文献
17.
After purification to homogeneity by Bio-Rex 70 ion exchange chromatography, micromolar solutions ofNaja nigricollis cardiotoxin were found to contain significant amounts of aggregates, as detected by time-resolved polarized fluorescence of its single tryptophan residue. The level of cardiotoxin aggregation depends strongly and reversibly on the protein concentration and pH. However, supplementary reverse-phase HPLC completely suppresses this aggregation, resulting in all cases in fluorescence anisotropy decays characteristic of the pure cardiotoxin monomer. The self-association properties of cardiotoxin, in the presence of a possible cofactor eliminated by the HPLC step, may be functionally relevant, and would deserve further investigation. The physical heterogeneity of the cardiotoxin samples required an appropriate model for the analysis of fluorescence depolarization, which was iteratively improved by comparison with experimental results. In this way, an approximate molar fraction of 10–15% aggregated cardiotoxin at a 90M total protein concentration, pH 7, was determined. The fluorescence of the partly aggregated samples is significantly perturbed as compared to the HPLC-treated monomer, indicating that the cardiotoxin aggregate must have an increased average fluorescence lifetime and a strongly decreased initial anisotropy. The decrease in initial anisotropy suggests either an increased mobility of the tryptophan residue upon aggregation or fast energy transfers between residues of different cardiotoxin molecules brought within a short distance in the aggregate. This study illustrates the high sensitivity of the time-resolved fluorescence technique, through both total fluorescence and anisotropy parameters, to low levels of physical or chemical heterogeneity in a protein sample. 相似文献
18.
Human serum albumin consists of a single polypeptide of 585 amino acid residues with 1 Trp residue. In the present work, we
measured fluorescence lifetimes of the protein in both native and denatured states. The results indicate that Trp emission
occurs with three lifetimes in both states. Lifetimes values and contribution to the global emission decay differ between
the two states. Data are interpreted as the results of an emission occurring from three substructures of the tryptophan formed
in the excited state. Two of these substructures are already present for the tryptophan free in solution. The third lifetime
is the result of the interaction between the tryptophan residue and surrounding microenvironment. The populations of these
substructures characterized by the pre-exponential parameters of the fluorescence lifetimes are dependent on the fluorophore
microenvironment and on the global protein structure. 相似文献
19.
The line shape of the 773 keV emission line emitted by187Re depends on the slowing down of the recoil the atom receives in the precedingβ transition. Using the nuclear resonance fluorescence method the line profile was studied for sources where the radioactive atoms are embedded in single crystals of W and WSe2 and in polycrystalline samples of Nb. The experimental results for W and Nb are in complete agreement with predictions by a theory in which the slowing down is calculated starting from a Born-v. Karman lattice model. The temperature dependence of the line shape yields the phonon lifetimes in W and Nb (W) to beτ(300 K)=(2.4±0.3)ps andτ(300 K)=(1.7±0.2) ps, respectively. Measurements for the slowing down of the recoiling atoms perpendicularly to and along the hexagonal axis of WSe2 yielded an anisotropy in qualitative agreement with expected values. 相似文献
20.
The S
n
-state lifetime is determined from two-step excited S
n
-S0fluorescence yield measurements with picosecond light pulses. The theoretical analysis includes single pulse and double pulse consecutive excitation and takes into account the anisotropy of excitation and emission. Experimental results of the single pulse two-step excitation technique are presented for the S4-state lifetimes of the three mode-locking dyes 5, 9740 and 9860 for Nd-glass lasers. 相似文献