The quaternary structure of proteins

Many protein molecules, particularly those with high molecular weights, consist not of a single polypeptide chain, but form a complex made up from several polypeptide chains. This structure, which can be reversibly broken down, is known as the quaternary structure. A number of metabolic phenomena can be explained on a molecular basis by invoking the quaternary structure.     

Single strand conformation polymorphism analysis of ras oncogene by capillary electrophoresis with laser-induced fluorescence detector

Single strand conformation polymorphism (SSCP) analysis of the N-ras oncogene was achieved by capillary electrophoresis with a laser-induced fluorescence detector (CE-LIF) using methylcellulose as a molecular sieving agent. The PCR-amplified N-ras oncogene, which is known to have a point mutation at codon 61 in the neuroblastoma, was investigated by CE-LIF combined with SSCP (SSCP-CE-LIF). A mixture of wild- and mutant-type single strand DNA fragments (103 bp) of the N-ras oncogene was separated by buffer solution containing 1.0% methylcellulose and 0.2 microM fluorescent dye (YO-PRO-1) at 25 degrees C. The SSCP-CE-LIF technique gave good resolution for wild- and mutant-type single strand DNA fragments with separation completed within 7 min. SSCP analysis using a CE system with a LIF detector was successfully applied to the detection of the one point mutation on the N-ras oncogene.     

The structure of intrinsic membrane proteins

Intrinsic membrane proteins are embedded in the lipid bilayer so that the polypeptides come in contact with the non-polar region of the bilayer. There are two major types of intrinsic proteins: those with most of their mass outside the cytoplasm (Type I) and those with most of their mass inside the cytoplasm (Type II). In the latter group are the membrane transport systems. The anion exchange system of the human erythrocyte is a dimer of band 3 polypeptides. These polypeptides span the bilary, have most of their mass in the cytoplasm, and are glycosylated. About 20-25% of the polypeptide, however, is in the bilayer. Arguments are presented to support the view that the intramembrane segments of the protein are alpha-helical and that the major protein-protein interactions between the subunits are in the cytoplasmic portion of the protein.     

The viscoelasticity and structure of fibrous proteins

Summary DynamicYoung's moduli of wool fibres in water have been measured over a range of two decades in rate of extension and at temperatures from 0 to 90 C. Small displacements were used, corresponding to extensions of 0.1%. These were imposed upon mean extensions of (a) 1%, (b) 15% and (c) 40%, representative of the three main extension regions of-keratin. The results obtained show great differences from the slopes of the corresponding regions of the force-extension curve carried out at the same temperature and rate of extension.Comparison of the small-strain dynamic moduli in the three regions (a), (b) and (c) indicate that there is a component of the modulus in (a) amounting to 1.3×10¹⁰ dynes/cm² which is associated with intact-helical filaments, and which is substantially constant up to at least 70 C.Approximate superposition of the dynamic moduli at different rates was achieved using theWilliams-Landel-Ferry (WFL) equation with a reference temperature of 35 C. It is thereby concluded that under the present conditions-keratin has an effective glasstransition in the vicinity of –15 C. Above 60–70 C the WLF relation was not obeyed, indicating the presence of a relaxing process with a different temperature-dependence from that of the normal viscoelastic mechanisms; it is suggested that this process may consist in the fission and re-formation of cystine groups.

---

Zusammenfassung Die dynamischenYoung-Moduln von Wollfasern in Wasser wurden über einen Bereich von zwei Dekaden der Streckgeschwindigkeit und Temperaturen zwischen 0 und 90 gemessen. Die maximal verwendeten Auslenkungen entsprechen einer Ausdehnung von 0,1%. Diese wurden den mittleren Dehnungen von (a) 1%, (b) 15% und (c) 40% überlagert entsprechend den drei Hauptbereichen der Dehnung von-Keratin. Die erhaltenen Ergebnisse zeigen gro\e Differenzen für die Steigungen der entsprechenden Bereiche Kraft-Dehnungs-Diagramm für gleiche Temperaturen und gleiche Dehnungsgeschwindigkeit.Ein Vergleich der Dehn-Moduln für kleine Dehnungen in den drei Bereichen (a), (b) und (c) zeigen, da\ in (a) eine Komponente des Moduls von etwa 1,3×10¹⁰dyn/ cm² enthalten ist, verbunden mit den intakten-Helices der Moleküle. Und diese bleiben im wesentlichen unverändert bis zu Temperaturen von wenigstens 70 C.Näherungsweise Superposition der dynamischen Moduln bei verschiedenen Dehngeschwindigkeiten konnte mit Hilfe derWilliams-Landel-Ferry (WLF)-Gleichung hinsichtlich einer Referenz-Temperatur von 35 C erreicht werden. Hieraus folgt, da\ unter den angewandten Bedingungen das-Keratin eine effektive Glasübergangstemperatur in der Nachbarschaft von –15C besitzt. Oberhalb von 60 bis 70 C wird die WLP-Gleichung nicht befolgt. Das zeigt die Mitwirkung von Relaxations-Prozessen mit einer unterschiedlichen Temperatur-Abhängigkeit von der der normalen viscoelastischen Mechanismen an. Es ist zu vermuten, da\ dieser Proze\ auf der Aufspaltung und Wiederbildung von Cystin-Gruppen beruht.

     

Protein-associated water and secondary structure effect removal of blood proteins from metallic substrates

Removing adsorbed protein from metals has significant health and industrial consequences. There are numerous protein-adsorption studies using model self-assembled monolayers or polymeric substrates but hardly any high-resolution measurements of adsorption and removal of proteins on industrially relevant transition metals. Surgeons and ship owners desire clean metal surfaces to reduce transmission of disease via surgical instruments and minimize surface fouling (to reduce friction and corrosion), respectively. A major finding of this work is that, besides hydrophobic interaction adhesion energy, water content in an adsorbed protein layer and secondary structure of proteins determined the access and hence ability to remove adsorbed proteins from metal surfaces with a strong alkaline-surfactant solution (NaOH and 5 mg/mL SDS in PBS at pH 11). This is demonstrated with three blood proteins (bovine serum albumin, immunoglobulin, and fibrinogen) and four transition metal substrates and stainless steel (platinum (Pt), gold (Au), tungsten (W), titanium (Ti), and 316 grade stainless steel (SS)). All the metallic substrates were checked for chemical contaminations like carbon and sulfur and were characterized using X-ray photoelectron spectroscopy (XPS). While Pt and Au surfaces were oxide-free (fairly inert elements), W, Ti, and SS substrates were associated with native oxide. Difference measurements between a quartz crystal microbalance with dissipation (QCM-D) and surface plasmon resonance spectroscopy (SPR) provided a measure of the water content in the protein-adsorbed layers. Hydrophobic adhesion forces, obtained with atomic force microscopy, between the proteins and the metals correlated with the amount of the adsorbed protein-water complex. Thus, the amount of protein adsorbed decreased with Pt, Au, W, Ti and SS, in this order. Neither sessile contact angle nor surface roughness of the metal substrates was useful as predictors here. All three globular proteins behaved similarly on addition of the alkaline-surfactant cleaning solution, in that platinum and gold exhibited an increase, while tungsten, titanium, and stainless steel showed a decrease in weight. According to dissipation measurements with the QCM-D, the adsorbed layer for platinum and gold was rigid, while that for the tungsten, titanium, and stainless steel was much more flexible. The removal efficiency of adsorbed-protein by alkaline solution of SDS depended on the water content of the adsorbed layers for W, Ti, and SS, while for Pt and Au, it depended on secondary structural content. When protein adsorption was high (Pt, Au), protein-protein interactions and protein-surface interactions were dominant and the removal of protein layers was limited. Water content of the adsorbed protein layer was the determining factor for how efficiently the layer was removed by alkaline SDS when protein adsorption was low. Hence, protein-protein and protein-surface interactions were minimal and protein structure was less perturbed in comparison with those for high protein adsorption. Secondary structural content determined the efficient removal of adsorbed protein for high adsorbed amount.     

The intrinsic structure of the water surface

An operational procedure to obtain the intrinsic structure of liquid surfaces is applied here to a molecular dynamics simulation of water, with a model of point charges for the molecular interactions. The method, which had been recently proposed and used for simple fluids, is successfully extended to a molecular liquid with the complex bond structure of water. The elimination of the capillary wave fluctuations, in the intrinsic density and orientation profiles, gives a new overall view of the water surface, at the sharpest molecular level, and without the size-dependent broadening observed in the mean profiles. The molecules belonging to the outer liquid layer are clearly identified, and we find that only these molecules exhibit a clear preferential orientation to lie flat on the surface. Moreover, there is a strong correlation between the dipolar structure and the local curvatures of the intrinsic surface, so that at the extrusions of the intrinsic surface the molecular dipoles point preferentially toward the vapor side of the interface. Finally, we have found an intrinsic density layering structure, although the inner structure is strongly damped beyond the second layer.     

Modal dynamics of proteins in water

We studied a dynamical model for the motion of the large scales of proteins in water. The model was obtained by projecting the (averaged) Newton equations onto some set of harmonic modes. We compared the statistics of the so‐obtained trajectories with those obtained by standard techniques, and concluded that our dynamical model is able to fairly reproduce the average properties of the large‐scale motion of the protein, and at the same time allow time steps one order of magnitude larger than the standard ones. © 2000 John Wiley & Sons, Inc. J Comput Chem 21: 1274–1282, 2000     

The structure of adsorbed water in cellulose acetate membranes

 The structure of water adsorbed in cellulose acetate membranes is determined by the fundamental and overtone IR spectra. Water is weakly H-bonded to ester and ether groups of the membrane, at low water contents. With increasing water content, more and more liquid-like water is observed. In addition, a small amount of a third type of water is present. The amounts of these three species are estimated from the spectra. At high water contents, the amount of liquid-like water increases strongly. The H-bond cooperativity of such water may be the cause for this increase and for the common anomalous water adsorption isotherms. The H-bond energy of the first hydration shell is relatively small, contrary to the anomalous large adsorption heats ΔH _ad. This could be described by larger van der Waals interactions between this type of water and the membrane groups as a result of a higher coordination number compared with Z=4.4 of liquid-like water. This model is in agreement with the decrease of ΔH _ad with increasing water sorption reaching the evaporization enthalpy of pure water at high water contents. Received: 24 May 1997 Accepted: 1 July 1997     

Conserving energy during molecular dynamics simulations of water,proteins, and proteins in water

Molecular dynamics simulations have been carried out for a series of systems of increasing complexity including: pure water, a model polypeptide (α-helical decaglycine) in vacuo, a protein (Pancreatic Trypsin Inhibitor, PTI) in vacuo, and a fully solvated protein (PTI in water). The equations of motion were integrated using Andersen's velocity version of the Verlet algorithm with internal contraints (the RATTLE algorithm). The accuracy with which the equations of motion are integrated has been analyzed for several different simulation conditions. The effects of various nonbonded interaction truncation schemes on the conservation of energy have been examined, including the use of atomic cutoffs, and (neutral group) residue cutoffs. The use of a smoothing function to eliminate the discontinuities in the potential at the cutoff leads to a significant improvement in the accuracy of the integration for each of the systems studied. The accuracy with which the equations of motion are integrated using the RATTLE algorithm for pure water and for the solvated protein are found to be comparable when the nonbonded interactions are tapered with a smoothing function at the cutoff.     

The three-dimensional structure of water confined in nanoporous vycor glass

Neutron diffraction data, in conjunction with isotopic substitution of deuterium (D) for hydrogen (H), have been analyzed to determine the three-dimensional structure of water confined in vycor, an archetypal hydrophilic porous silica glass containing channels or pores of approximately 40 A diameter. The data have been incorporated into a Monte Carlo computer simulation of the confined water system, and the site-site potentials have been iteratively refined in order to produce a model ensemble which is consistent with both the neutron diffraction data and two possible geometries of the vycor pores (cylindrical and spherical). This approach has allowed us to investigate in detail the contributions to the experimentally accessible partial pair correlation functions, and ascertain whether particular features arise from interactions of the water molecules with the substrate surface, or from purely geometrical confinement effects. We observe a significant decrease in the first shell water oxygen-oxygen co-ordination number, and a decrease in the number of hydrogen bonds per water molecule from approximately 3.6 in bulk water to approximately 2.2 in confinement. In addition, we observe a significant shift inward of the second peak in the water oxygen-water oxygen coordination shell. Overall, we therefore find that the structure of the water in vycor is strongly perturbed relative to the bulk.     

The structure of H-bonded clusters in sub- and supercritical water

The structure of H-bonded complexes in sub- and supercritical water in regions close to and remote from the saturation curve was studied. The Car-Parrinello method was used to calculate water dipole moment distributions in 11 thermodynamic states. The dependence of the mean dipole moment of water molecules on the size of clusters and number of H-bonds was obtained.     

The structure of water in p-sulfonatocalix[4]arene

Tetrasodium p-sulfonatocalix[4]arene exists as a hydrate with approximately 14 water molecules and has three polymorphic modifications, all of which contain a water molecule in the molecular cavity that is engaged in OH···π interactions. Single-crystal neutron structures are reported for two of these three forms and reveal a "compressed" water molecule with short OH bonds. Partial atomic charges and hardness analysis (PACHA) calculations based on the neutron coordinates give an OH···π interaction energy of 6.9-7.5 kJ mol(-1). The PACHA analysis also reveals the dominance of the charge-assisted hydrogen bonds from the Na(+)-coordinated water molecules. The instability of the crystal towards dehydration can be traced to an uncoordinated lattice water site. The remarkable calixarene-Na(+)-hydrate motif is conserved almost unchanged across all three polymorphs. A single-crystal neutron structure is also reported for pentasodium p-sulfonatocalix[4]arene·12H(2)O, which exhibits an intracavity water molecule that is engaged in both OH···π and OH···O hydrogen bonding. The shorter covalent bond to the hydrogen atom that forms the interaction with the aromatic ring is again apparent.     

The structure of liquid water at room temperature

Full details are given of a recent time-of-flight neutron diffraction experiment in which partial pair correlation functions for liquid water are extracted by isotope substitution. Measurements of differential cross sections of mixtures of heavy and light water are made, and by performing the experiment at the high neutron energies available at a pulsed neutron source (Los Alamos) the magnitude of dynamic corrections to the data is reduced. The problematic hydrogen incoherent scattering is removed by a subtraction technique which avoids reference to dynamic models of the liquid. The results, although they show good agreement with computer simulations, show serious qualitative differences with other neutron experiments on water, and it is suggested these discrepancies are a result of lack of attention to the unusual properties of hydrogen as a scatterer of neutrons.     

Putative DNA quadruplex formation within the human c-kit oncogene

The DNA sequence, d(AGGGAGGGCGCTGGGAGGAGGG), occurs within the promoter region of the c-kit oncogene. We show here, using a combination of NMR, circular dichroism, and melting temperature measurements, that this sequence forms a four-stranded quadruplex structure under physiological conditions. Variations in the sequences that intervene between the guanine tracts have been examined, and surprisingly, none of these modified sequences forms a quadruplex arrangement under these conditions. This suggests that the occurrence of quadruplex-forming sequences within the human and other genomes is less than was hitherto expected. The c-kit quadruplex may be a new target for therapeutic intervention in cancers where there is elevated expression of the c-kit gene.     

Lipidated ras and rab peptides and proteins--synthesis, structure, and function

Chemical biology can be defined as the study of biological phenomena from a chemical approach. Based on the analysis of relevant biological phenomena and their structural foundation, unsolved problems are identified and tackled through a combination of chemistry and biology. Thus, new synthetic methods and strategies are developed and employed for the construction of compounds that are used to investigate biological procedures. Solid-phase synthesis has emerged as the preferred method for the synthesis of lipidated peptides, which can be chemoselectively ligated to proteins of the Ras superfamily. The generated peptides and proteins have solved biological questions in the field of the Ras-superfamily GTPases that are not amendable to chemical or biological techniques alone.