Theoretical studies on the interaction of proteins with base pairs. I. Ab initio calculation for the effect of H-bonding interaction of proteins on the stability of adenine–uracil pair

The hydrogen-bonding interaction of protein with the adenine–uracil base pair was investigated by the ab initio MO method (STO -3G level). We found that the stability of the base pair was greatly affected by the hydrogen-bonding interaction of several residues of protein in different ways, depending on whether the interacting species is charged or neutral, whether the interaction is made from the major groove or minor groove side, and which of the two, adenine or uracil, is hydrogen bonded. These results were interpreted as the cooperative interaction between the base pair hydrogen bonds and external ones. The implications of the present results to biological functions were also discussed.     

Replication Experiments with Nucleotide Base Analogues

The principles governing the replication fidelity of genomes are not fully understood yet. Watson and Crick's base-pairing principle for matched deoxyribonucleotide (DNA) bases can explain why the guanine–cytosine and adenine-thymine base pairs are approximately one hundred times more stable thermodynamically than mismatched combinations. In vitro, DNA polymerases reduce the number of mismatched base pairs to about 10^?6 per Watson–Crick base pair. Replication fidelity can further be enhanced to a mutation probability of 10^?10or less in vivo if optimal conditions for DNA synthesis are provided by polymerase–assisting proteins and DNA-repairing enzymes. The precise reasons for the formation of mismatched base pairs (mispairs), which are responsible for a substantial part of DNA mutations, are still in debate. Although it is agreed that a template-directed “reading” of the hydrogen-substitution pattern in the heterocyclic bases is crucial for proper base pairing during DNA synthesis, it is not clear which type of “misreading” leads to mispairs. Misreading may be due to a non-Watson–Crick base pairing as well as to a change in the hydrogen-substitution pattern, leading to Watson-Crick-like mispairs. The surprising discovery of the selective and quantitative DNA-polymerase-catalyzed formation of a pyridine-pyrimidine base pair (involving a nucleotide base analogue) indicated that rare tautomeric forms in template DNA strands can lead to Watson-Crick-like mispairings that are hardly recognized by the polymerase's proofreading activity. This reveals new pathways for substitution mutations (replication-dependent DNA point mutations) and suggests a new type of mutagen in vivo.     

Pyrrolo‐dC Metal‐Mediated Base Pairs in the Reverse Watson–Crick Double Helix: Enhanced Stability of Parallel DNA and Impact of 6‐Pyridinyl Residues on Fluorescence and Silver‐Ion Binding

Reverse Watson–Crick DNA with parallel‐strand orientation (ps DNA) has been constructed. Pyrrolo‐dC (PyrdC) nucleosides with phenyl and pyridinyl residues linked to the 6 position of the pyrrolo[2,3‐d]pyrimidine base have been incorporated in 12‐ and 25‐mer oligonucleotide duplexes and utilized as silver‐ion binding sites. Thermal‐stability studies on the parallel DNA strands demonstrated extremely strong silver‐ion binding and strongly enhanced duplex stability. Stoichiometric UV and fluorescence titration experiments verified that a single ^2pyPyrdC–^2pyPyrdC pair captures two silver ions in ps DNA. A structure for the PyrdC silver‐ion base pair that aligns 7‐deazapurine bases head‐to‐tail instead of head‐to‐head, as suggested for canonical DNA, is proposed. The silver DNA double helix represents the first example of a ps DNA structure built up of bidentate and tridentate reverse Watson–Crick base pairs stabilized by a dinuclear silver‐mediated PyrdC pair.     

Possible incorporation of the purine–purine mispairs in the DNA helix and the interpretation of the transversion-type point mutations

The stereochemical and energetic compatibility of incorporation of the non-Watson–Crick hydrogen bonded purine–purine base pairs of normal tautomers in the helical structure of B-DNA is studied here. The hydrogen bonding positions of the possible “mispairs” of the bases GA, GG, and AA are optimized first in the base plane by translational and rotational movement along the hydrogen bonds and then introduced at an appropriate position in the DNA structure. The optimum backbone geometries which can accommodate the “mispairs” are obtained by force field computations. The stereochemical and energetic aspects of the various mispairs are discussed in light of their possible incorporation in DNA and as mutational intermediates for the “transversion”-type point mutations.     

Contiguous metal-mediated base pairs comprising two Ag(I) ions

The incorporation of transition‐metal ions into nucleic acids by using metal‐mediated base pairs has proved to be a promising strategy for the site‐specific functionalization of these biomolecules. We report herein the formation of Ag⁺‐mediated Hoogsteen‐type base pairs comprising 1,3‐dideaza‐2′‐deoxyadenosine and thymidine. By defunctionalizing the Watson–Crick edge of adenine, the formation of regular base pairs is prohibited. The additional substitution of the N3 nitrogen atom of adenine by a methine moiety increases the basicity of the exocyclic amino group. Hence, 1,3‐dideazaadenine and thymine are able to incorporate two Ag⁺ ions into their Hoogsteen‐type base pair (as compared with one Ag⁺ ion in base pairs with 1‐deazaadenine and thymine). We show by using a combination of experimental techniques (UV and circular dichroism (CD) spectroscopies, dynamic light scattering, and mass spectrometry) that this type of base pair is compatible with different sequence contexts and can be used contiguously in DNA double helices. The most stable duplexes were observed when using a sequence containing alternating purine and pyrimidine nucleosides. Dispersion‐corrected density functional theory calculations have been performed to provide insight into the structure, formation and stabilization of the twofold metalated base pair. They revealed that the metal ions within a base pair are separated by an Ag???Ag distance of about 2.88 Å. The Ag–Ag interaction contributes some 16 kcal mol^?1 to the overall stability of the doubly metal‐mediated base pair, with the dominant contribution to the Ag–Ag bonding resulting from a donor–acceptor interaction between silver 4d‐type and 4s orbitals. These Hoogsteen‐type base pairs enable a higher functionalization of nucleic acids with metal ions than previously reported metal‐mediated base pairs, thereby increasing the potential of DNA‐based nanotechnology.     

Protonic delocalization and quantum correlations in the H-bond dynamics of G–C and κ–π DNA base pairs

A new base pair (called κ–π) of Watson–Crick type, with a H -bond pattern different from that in A –T and G –C base pairs, has been recently synthesized and shown to be stable and incorporable into duplex DNA and RNA by polymerases. This new basepair, which contains three H -bonds, is compared with G –C , in the framework of modern dynamical theory of quantum nonlocality and quantum correlations. Connection with the traditional treatment of proton transfer in DNA base pairs, which uses the adiabatic approximation, is explicitly made. As a result, the dynamics of the H -bond pattern of G –C is shown to exhibit a specific quantum mechanical phase stability, which is clearly missing in the case of κ–π. This finding is discussed and illustrated, also in connection with recent quantum chemical calculations of proton transfers in DNA base pairs. Additionally, certain speculations concerning the “evolutionary advantage” of G –C with respect to κ–π are briefly considered. © 1993 John Wiley & Sons, Inc.     

The effect of minor-groove hydrogen-bond acceptors and donors on the stability and replication of four unnatural base pairs

The stability and replication of DNA containing self-pairs formed between unnatural nucleotides bearing benzofuran, benzothiophene, indole, and benzotriazole nucleobases are reported. These nucleobase analogues are based on a similar scaffold but have different hydrogen-bond donor/acceptor groups that are expected to be oriented in the duplex minor groove. The unnatural base pairs do not appear to induce major structural distortions and are accommodated within the constraints of a B-form duplex. The differences between these unnatural base pairs are manifest only in the polymerase-mediated extension step, not in base-pair stability or synthesis. The benzotriazole self-pair is extended with an efficiency that is only 200-fold less than a correct natural base pair. The data are discussed in terms of available polymerase crystal structures and imply that further modifications may result in unnatural base pairs that can be both efficiently synthesized and extended, resulting in an expanded genetic alphabet.     

Optimization of interstrand hydrophobic packing interactions within unnatural DNA base pairs

As part of an effort to expand the genetic alphabet, we have evaluated a large number of predominantly hydrophobic unnatural base pairs. We now report the synthesis and stability of unnatural base pairs formed between simple phenyl rings modified at different positions with methyl groups. Surprisingly, several of the unnatural base pairs are virtually as stable as a natural base pair in the same sequence context. The results show that neither hydrogen-bonding nor large aromatic surface area are required for base pair stability within duplex DNA and that interstrand interactions between small aromatic rings may be optimized for both stability and selectivity. These smaller nucleobases are not expected to induce the distortions in duplex DNA or at the primer terminus that seem to limit replication of larger unnatural base pairs, and they therefore represent a promising approach to the expansion of the genetic alphabet.     

Nanoswitches based on DNA base pairs: why adenine-thymine is less suitable than guanine-cytosine.

Substituted Watson–Crick guanine–cytosine (GC) base pairs were recently shown to yield robust three‐state nanoswitches. Here, we address the question: Can such supramolecular switches also be based on Watson–Crick adenine‐thymine (AT) base pairs? We have theoretically analyzed AT pairs in which purine‐C8 and/or pyrimidine‐C6 positions carry a substituent X=NH^?, NH₂, NH₃⁺ (N series), O^?, OH or OH₂⁺ (O series), using the generalized gradient approximation (GGA) of density functional theory at the BP86/TZ2P level. Thus, we explore the trend in geometrical shape and hydrogen bond strengths in AT pairs along a series of stepwise protonations of the substituents. Introducing a charge on the substituents leads to substantial and characteristic changes in the individual hydrogen bond lengths when compared to the neutral AT pair. However, the trends along the series of negative, neutral, and positive substituents are less systematic and less pronounced than for GC. In certain instances, internal proton transfer from thymine to adenine occurs. Our results suggest that AT is a less suitable candidate than GC in the quest for chemically controlled nanoswitches.     

Ab initio study of the structure of isocytosine–cytosine standard Watson–Crick base pairs in the gas phase and in water

Ab initio quantum chemical studies at the HF and MP2 levels with the 6-31G* basis set were performed for H-bonded isocytosine–cytosine standard Watson–Crick base pairs (denoted as iCC1) in the gas phase and in a water solution. Full geometry optimizations at the HF level without any constraints on the planarity of these complexes were carried out. The water solution was modeled by the explicit inclusion of one, two, four, and six water molecules. Six waters create the first full coordination sphere around the iCC1 base pair. All potentially possible hydration positions of the iCC1 base pair with one and two water molecules were considered. The interaction and solvation energies were corrected for the basis-set superposition error by using the full Boys–Bernardi counterpoise correction scheme. It was shown that inclusion of six instead of one, two, or four water molecules has a crucial effect on the geometry of the iCC1 base pair. In the case of six water molecules, the iCC1 moiety becomes strongly nonplanar, while in the case of a smaller number of water molecules, it deviates only slightly from the planar conformation as is adopted in the gas phase. Based on the results of these calculations, the nature of the specific H-bonding interactions, solvation effects, and the interaction energies are discussed. © 1998 John Wiley & Sons, Inc. Int J Quant Chem 69: 37–47, 1998     

5-Aza-7-deazaguanine–Isoguanine and Guanine–Isoguanine Base Pairs in Watson–Crick DNA: The Impact of Purine Tracts,Clickable Dendritic Side Chains,and Pyrene Adducts

The Watson–Crick coding system depends on the molecular recognition of complementary purine and pyrimidine bases. Now, the construction of hybrid DNAs with Watson–Crick and purine–purine base pairs decorated with dendritic side chains was performed. Oligonucleotides with single and multiple incorporations of 5-aza-7-deaza-2′-deoxyguanosine, its tripropargylamine derivative, and 2′-deoxyisoguanosine were synthesized. Duplex stability decreased if single modified purine–purine base pairs were inserted, but increased if pyrene residues were introduced by click chemistry. A growing number of consecutive 5-aza-7-deazaguanine–isoguanine base pairs led to strong stepwise duplex stabilization, a phenomenon not observed for the guanine–isoguanine base pair. Spacious residues are well accommodated in the large groove of purine–purine DNA tracts. Changes to the global helical structure monitored by circular dichroism spectroscopy show the impact of functionalization to the global double-helix structure. This study explores new areas of molecular recognition realized by purine base pairs that are complementary in hydrogen bonding, but not in size, relative to canonical pairs.     

Adenine–Au and adenine–uracil–Au. Non-conventional hydrogen bonds of the anions and donator–acceptor properties of the neutrals

This is a study of adenine–Au and adenine–uracil–Au (neutral, anionic and cationic), applying the B3LYP density-functional approach. In these systems, the interaction is directly related to the charge; so that as the metal atomic charge increases, the bond strength also increases. Neutral molecules are weakly bonded, the interaction in the case of cations is mainly electrostatic and in the case of the anions, the extra electron is localized on the metal atom and consequently, non-conventional hydrogen bonds are formed. In the case of adenine–Au (anion), the H dissociation energy is similar to the electron dissociation energy, and therefore both reactions may be possible. Moreover, the Au anionic atom modifies the hydrogen bonds of the uracil–adenine base pair. This may be significant in the study of point mutations that may occur in the Watson–Crick dimmer of nucleic basis. The electron-donator properties of these compounds are analyzed with the aid of the donator–acceptor map (DAM), previously described. Adenine–Au, uracil–Au and adenine–uracil–Au are more effective electron donors, but poorer electron acceptors than adenine, uracil and adenine–uracil. If the electron acceptor properties of carotenoids such as β-carotene and astaxanthin are compared, there are indications that astaxanthin may act as an oxidant instead of an antioxidant with the uracil–adenine base pair. The oxidation of nucleic acid bases by carotenoids may have important consequences, as oxidative damage of DNA and RNA appears to be linked to cancer. This is something that demands further studies and for this reason, work concerning the reactivity of carotenoids with DNA-nitrogen bases is in progress.     

Silver-Mediated Homochiral and Heterochiral α-dC/β-dC Base Pairs: Synthesis of α-dC through Glycosylation and Impact of Consecutive,Isolated, and Multiple Metal Ion Pairs on DNA Stability

Isolated and consecutive heterochiral α-dC– base pairs have been incorporated into 12-mer oligonucleotide duplexes at various positions, thereby replacing Watson–Crick pairs. To this end, a new synthesis of the α-d anomer of dC has been developed, and oligonucleotides containing α-dC residues have been synthesized. Silver-mediated base pairs were formed upon the addition of silver ions. Furthermore, we have established that heterochiral α-dC–dC base pairs can approach the stability of a Watson–Crick pair, whereas homochiral dC–dC pairs are significantly less stable. A positional change of the silver-mediated base pairs affects the duplex stability and reveals the nearest-neighbor influence. When the number of silver ions was equivalent to the number of duplex base pairs (12), non-melting silver-rich complexes were formed. Structural changes have been supported by circular dichroism (CD) spectra, which showed that the B-DNA structure was maintained whilst the silver ion concentration was low. At high silver ion concentration, silver-rich complexes displaying different CD spectra were formed.     

Molecular Switching Behavior in Isosteric DNA Base Pairs

The structures and proton‐coupled behavior of adenine–thymine (A‐T) and a modified base pair containing a thymine isostere, adenine–difluorotoluene (A‐F), are studied in different solvents by dispersion‐corrected density functional theory. The stability of the canonical Watson–Crick base pair and the mismatched pair in various solvents with low and high dielectric constants is analyzed. It is demonstrated that A‐F base pairing is favored in solvents with low dielectric constant. The stabilization and conformational changes induced by protonation are also analyzed for the natural as well as the mismatched base pair. DNA sequences capable of changing their sequence conformation on protonation are used in the construction of pH‐based molecular switches. An acidic medium has a profound influence in stabilizing the isostere base pair. Such a large gain in stability on protonation leads to an interesting pH‐controlled molecular switch, which can be incorporated in a natural DNA tract.     

Hydrogen bonding effect on the structure and vibrational spectra of complementary pairs of nucleic acid bases. I. Adenine-uracil

Vibrational spectra of the adenine—uracil complementary pair of nucleic acid bases (NAB) in the isolated state are calculated in the B3LYP/6-311++G(d,p) approximation and analyzed. The hydrogen bonding effect on frequency positions and intensities of normal vibrations of NAB pairs is shown in comparison with isolated uracil and adenine molecules.     

Covalently Cross-Linked Watson–Crick Base Pair Models

Structural characteristics of Watson–Crick hydrogen-bonded base pairs are displayed by methylene-bridged base pairs of type A . The shown superposition of the X-ray structure obtained for the base pair A (Rib¹=Et; Rib²=Me) over that of a C–G base pair illustrates that A occupies an area similar to that occupied by a traditional Watson–Crick hydrogen-bonded base pair. Temperature-dependent ¹H NMR studies indicate that the energy barrier for rotation along its CH₂ bridge is about 10 kcal mol⁻¹, and that it exists predominantly in one conformer at −70°C.     

The catalytic power of uracil DNA glycosylase in the opening of thymine base pairs

Uracil DNA glycosylase (UNG) locates uracil and its structural congener thymine in the context of duplex DNA using a base flipping mechanism. NMR imino proton exchange measurements were performed on free and UNG-bound DNA duplexes in which a single thymine (T) was paired with a series of adenine analogues (X) capable of forming one, two, or three hydrogen bonds. The base pair opening equilibrium for the free DNA increased 55-fold as the number of hydrogen bonds decreased, but the opening rate constants were nearly the same in the absence and presence of UNG. In contrast, UNG was found to slow the base pair closing rate constants (kcl) compared to each free duplex by a factor of 3- to 23-fold. These findings indicate that regardless of the inherent thermodynamic stability of the TX pair, UNG does not alter the spontaneous opening rate. Instead, the enzyme holds the spontaneously expelled thymine (or uracil) in a transient extrahelical sieving site where it may partition forward into the enzyme active site (uracil) or back into the DNA base stack (thymine).     

Spatial,Hysteretic, and Adaptive Host–Guest Chemistry in a Metal–Organic Framework with Open Watson–Crick Sites

Biological and artificial molecules and assemblies capable of supramolecular recognition, especially those with nucleobase pairing, usually rely on autonomous or collective binding to function. Advanced site‐specific recognition takes advantage of cooperative spatial effects, as in local folding in protein–DNA binding. Herein, we report a new nucleobase‐tagged metal–organic framework (MOF), namely ZnBTCA (BTC=benzene‐1,3,5‐tricarboxyl, A=adenine), in which the exposed Watson–Crick faces of adenine residues are immobilized periodically on the interior crystalline surface. Systematic control experiments demonstrated the cooperation of the open Watson–Crick sites and spatial effects within the nanopores, and thermodynamic and kinetic studies revealed a hysteretic host–guest interaction attributed to mild chemisorption. We further exploited this behavior for adenine–thymine binding within the constrained pores, and a globally adaptive response of the MOF host was observed.     

Spatial,Hysteretic, and Adaptive Host–Guest Chemistry in a Metal–Organic Framework with Open Watson–Crick Sites

Biological and artificial molecules and assemblies capable of supramolecular recognition, especially those with nucleobase pairing, usually rely on autonomous or collective binding to function. Advanced site‐specific recognition takes advantage of cooperative spatial effects, as in local folding in protein–DNA binding. Herein, we report a new nucleobase‐tagged metal–organic framework (MOF), namely ZnBTCA (BTC=benzene‐1,3,5‐tricarboxyl, A=adenine), in which the exposed Watson–Crick faces of adenine residues are immobilized periodically on the interior crystalline surface. Systematic control experiments demonstrated the cooperation of the open Watson–Crick sites and spatial effects within the nanopores, and thermodynamic and kinetic studies revealed a hysteretic host–guest interaction attributed to mild chemisorption. We further exploited this behavior for adenine–thymine binding within the constrained pores, and a globally adaptive response of the MOF host was observed.     

Temperature dependence of internucleotide nitrogen–nitrogen scalar couplings in RNA

The temperature dependence of internucleotide nitrogen–nitrogen scalar couplings ^2hJ(N,N) across hydrogen bonds in adenine–uracil (A–U) and guanine–cytosine (G–C) base pairs of the 22 nucleotide RNA oligomer GGCGAAGUCGAAAGAUGGCGCC was studied between 280 and 310 K. The value of ^2hJ(N,N) was observed to decrease monotonically for all four base pairs with increasing temperature. The temperature dependence of ^2hJ(N,N) was found to be more pronounced for the A–U base pair than for G–C base pairs. An earlier study of cross‐correlation effects at 296 K appeared to indicate a reduced mobility of the A–U base pair, as evidenced by small contributions of chemical shift modulation to relaxation rates. Copyright © 2002 John Wiley & Sons, Ltd.