Screening of threading bis-intercalators binding to duplex DNA by electrospray ionization tandem mass spectrometry

The DNA binding of novel threading bis-intercalators V1, trans-D1, and cis-C1, which contain two naphthalene diimide (NDI) intercalation units connected by a scaffold, was evaluated using electrospray ionization mass spectrometry (ESI-MS) and DNAse footprinting techniques. ESI-MS experiments confirmed that V1, the ligand containing the -Gly3-Lys- peptide scaffold, binds to a DNA duplex containing the 5'-GGTACC-3' specific binding site identified in previous NMR-based studies. The ligand formed complexes with a ligand/DNA binding stoichiometry of 1:1, even when there was excess ligand in solution. Trans-D1 and cis-C1 are new ligands containing a rigid spiro-tricyclic scaffold in the trans- and cis- orientations, respectively. Preliminary DNAse footprinting experiments identified possible specific binding sites of 5'-CAGTGA-5' for trans-D1 and 5'-GGTACC-3' for cis-C1. ESI-MS experiments revealed that both ligands bound to DNA duplexes containing the respective specific binding sequences, with cis-C1 exhibiting the most extensive binding based on a higher fraction of bound DNA value. Cis-C1 formed complexes with a dominant 1:1 binding stoichiometry, whereas trans-D1 was able to form 2:1 complexes at ligand/DNA molar ratios >or=1 which is suggestive of nonspecific binding. Collisional activated dissociation (CAD) experiments indicate that DNA complexes containing V1, trans-D1, and cis-C1 have a unique fragmentation pathway, which was also observed for complexes containing the commercially available bis-intercalator echinomycin, as a result of similar binding interactions, marked by intercalation in addition to hydrogen bonding by the scaffold with the DNA major or minor groove.     

Strong binding in the DNA minor groove by an aromatic diamidine with a shape that does not match the curvature of the groove

A combination of biophysical techniques has been used to characterize the interaction of an antitrypanosomal agent, CGP 40215A, with DNA. The results from a broad array of methods (DNase I footprinting, surface plasmon resonance, X-ray crystallography, and molecular dynamics) indicate that this compound binds to the minor groove of AT DNA sequences. Despite its unusual linear shape that is not complementary to that of the DNA groove, a high binding affinity was observed in comparison with other similar but more curved diamidine compounds. The amidine groups at both ends of the ligand and the -NH groups on the linker are involved in extensive and dynamic H-bonds to the DNA bases. Complementary and consistent results were obtained from both the X-ray and molecular dynamics studies; both of these methods reveal direct and water-mediated H-bonds between the ligand and the DNA.     

Understanding the DNA binding of novel non-symmetrical guanidinium/2-aminoimidazolinium derivatives

Biophysical studies have been carried out on a family of asymmetric guanidinium-based diaromatic derivatives to assess their potential as DNA minor groove binding agents. To experimentally assess the binding of these compounds to DNA, solution phase biophysical studies have been performed. Thus, surface plasmon resonance, UV-visible spectroscopy and circular and linear dichroism have been utilized to evaluate binding constants, stoichiometry and mode of binding. In addition, the thermodynamics of the binding process have been determined by using isothermal titration calorimetry. These results show significant DNA binding affinity that correlates with the expected 1?:?1 binding ratio usually observed for minor groove binders. Moreover, a simple computational approach has been devised to assess the potential as DNA binders of this family of compounds.     

Design of DNA minor groove binding diamidines that recognize GC base pair sequences: a dimeric-hinge interaction motif

The classical model of DNA minor groove binding compounds is that they should have a crescent shape that closely fits the helical twist of the groove. Several compounds with relatively linear shape and large dihedral twist, however, have been found recently to bind strongly to the minor groove. These observations raise the question of how far the curvature requirement could be relaxed. As an initial step in experimental analysis of this question, a linear triphenyl diamidine, DB1111, and a series of nitrogen tricyclic analogues were prepared. The goal with the heterocycles is to design GC binding selectivity into heterocyclic compounds that can get into cells and exert biological effects. The compounds have a zero radius of curvature from amidine carbon to amidine carbon but a significant dihedral twist across the tricyclic and amidine-ring junctions. They would not be expected to bind well to the DNA minor groove by shape-matching criteria. Detailed DNase I footprinting studies of the sequence specificity of this set of diamidines indicated that a pyrimidine heterocyclic derivative, DB1242, binds specifically to a GC-rich sequence, -GCTCG-. It binds to the GC sequence more strongly than to the usual AT recognition sequences for curved minor groove agents. Other similar derivatives did not exhibit the GC specificity. Biosensor-surface plasmon resonance and isothermal titration calorimetry experiments indicate that DB1242 binds to the GC sequence as a highly cooperative stacked dimer. Circular dichroism results indicate that the compound binds in the minor groove. Molecular modeling studies support a minor groove complex and provide an inter-compound and compound-DNA hydrogen-bonding rational for the unusual GC binding specificity and the requirement for a pyrimidine heterocycle. This compound represents a new direction in the development of DNA sequence-specific agents, and it is the first non-polyamide, synthetic compound to specifically recognize a DNA sequence with a majority of GC base pairs.     

Probing the nature of three-centered hydrogen bonds in minor-groove ligand-DNA interactions: the contribution of fluorine hydrogen bonds to complex stability

Double-stranded DNA sequences have been prepared in which single atoms (the O2-carbonyls of selected thymines) have been replaced by fluorine or methyl. To maintain normal Watson-Crick hydrogen bonding with the complementary purines, these analogue derivatives have been prepared as C-nucleosides. The O2-carbonyls of interest for this study are those involved in a bifurcated (or three-centered) hydrogen bond with the minor groove binding ligand 4',6-diamidino-2-phenylindole (DAPI). TM studies of the duplexes illustrate that the DNA duplexes are destabilized when fluorine or methyl replaces one or both of the minor groove O2-carbonyls, which can in part be explained by changes in minor groove hydration. In the presence of DAPI, most of the duplexes exhibit an increased TM due to the presence of DAPI bound in the minor groove. The extent of helix overstabilization negatively correlates with the presence of one or both methyl groups in the minor groove, suggesting that ligand binding is weakened in the presence of the non-carbonyl functional groups. The presence of single fluorine appears to promote helix stabilization, and native-like stabilization occurs when both fluorines are present. KD values quantitate binding effects between DAPI and the native and analogue sequences. Sequences with one or both methyl groups exhibit very poor binding with DAPI, while those containing a single fluorine behave essentially like native carbonyl-containing sequences. With both fluorines present, KD values were observed to increase by a moderate 3-fold at 100 mM NaCl and somewhat more at 200 mM NaCl. Binding affinities with both methyl groups present were 500-1000-fold weaker than native. The results suggest that organofluorines can function as hydrogen-bond acceptors, at least in the bifurcated interaction that contributes to minor groove binding by DAPI.     

Induced fit conformational changes of a "reversed amidine" heterocycle: optimized interactions in a DNA minor groove complex

To better understand the molecular basis for recognition of the DNA minor groove by heterocyclic cations, a series of "reversed amidine" substituted heterocycles has been prepared. Amidine derivatives for targeting the minor groove have the amidine carbon linked to a central heterocyclic system, whereas in the reverse orientation, an amidine nitrogen provides the link. The reverse system has a larger dihedral angle as well as a modified spatial relationship with the groove relative to amidines. Because of the large dihedral, the reversed amidines should have reduced binding to DNA relative to similar amidines. Such a reduction is observed in footprinting, circular dichroism (CD), biosensor-surface plasmon resonance (SPR), and isothermal titration calorimetric (ITC) experiments with DB613, which has a central phenyl-furan-phenyl heterocyclic system. The reduction is not seen when a pyrrole (DB884) is substituted for the furan. Analysis of a number of derivatives defines the pyrrole and a terminal phenyl substituent on the reversed amidine groups as critical components in the strong binding of DB884. ITC and SPR comparisons showed that the better binding of DB884 was due to a more favorable binding enthalpy and that it had exceptionally slow dissociation from DNA. Crystallographic analysis of DB884 bound to an AATT site shows that the compound was bound in the minor groove in a 1:1 complex as suggested by CD solution studies. Surprisingly, unlike the amidine derivative, the pyrrole -NH of DB884 formed an H-bond with a central T of the AATT site and this accounts for the enthalpy-driven strong binding. The structural results and molecular modeling studies provide an explanation for the differences in binding affinities for related amidine and reversed amidine analogues.     

Theoretical study of the interaction between a high-valent manganese porphyrin oxyl-(hydroxo)-Mn(IV)-TMPyP and double-stranded DNA

Cationic porphyrin derivatives such as meso-tetrakis(4-N-methylpyridinium)porphyrin, TMPyP, have been shown to interact with double-stranded DNA. The manganese derivative, Mn(III)-TMPyP, activated by an oxygen donor like potassium monopersulfate, provides an efficient DNA-cleaving system. Previous experimental work1 has shown that DNA cleavage by the Mn(III)-TMPyP/KHSO(5) system was due to an oxidative attack, within the minor groove of B-DNA, at the C5' or C1' carbons of deoxyribose units. The aim of this study was to use molecular modeling to elucidate the specificity of the interactions between the transient active species oxyl-Mn(IV)-TMPyP and the DNA target. Geometric parameters, charges, and force field constants consistent with the AMBER 98 force field were calculated by DFT methods. Molecular modeling (mechanics and dynamic simulations) were performed for oxyl-(hydroxo)-Mn(IV)-TMPyP bound in the minor groove of the dodecamer d(5'-TCGTCAAACCGC)-d(5'-GCGGTTTGACGA). Geometry, interactions, and binding energy of the metalloporphyrin located at the A.T triplet region of the dodecamer were analyzed. These studies show no significant structural change of the DNA structure upon ligand binding. Mobility of the metalloporphyrin in the minor groove was restrained by the formation of a hydrogen bond between the hydroxo ligand trans to the metal-oxyl and a DNA phosphate, restricting the access of the oxyl group to the (pro-S) H atom at C5'.     

Toward an Understanding of the Chemical Etiology for DNA Minor‐Groove Recognition by Polyamides

Crescent‐shaped polyamides composed of aromatic amino acids, i.e., 1‐methyl‐1H‐imidazole Im , 1‐methyl‐1H‐pyrrole Py , and 3‐hydroxy‐1H‐pyrrole Hp , bind in the minor groove of DNA as 2 : 1 and 1 : 1 ligand/DNA complexes. DNA‐Sequence specificity can be attributed to shape‐selective recognition and the unique corners or pairs of corners presented by each heterocycle(s) to the edges of the base pairs on the floor of the minor groove. Here we examine the relationship between heterocycle structure and DNA‐sequence specificity for a family of five‐membered aromatic amino acids. By means of quantitative DNase‐I footprinting, the recognition behavior of polyamides containing eight different aromatic amino acids, i.e., 1‐methyl‐1H‐pyrazole Pz , 1H‐pyrrole Nh , 5‐methylthiazole Nt , 4‐methylthiazole Th , 3‐methylthiophene Tn , thiophene Tp , 3‐hydroxythiophene Ht , and furan Fr , were compared with the polyamides containing the parent‐ring amino acids Py, Im , and Hp for their ability to discriminate between the four Watson? Crick base pairs in the DNA minor groove. Analysis of the data and molecular modeling showed that the geometry inherent to each heterocycle plays a significant role in the ability of polyamides to differentiate between DNA sequences. Binding appears sensitive to changes in curvature complementarity between the polyamide and DNA. The Tn / Py pair affords a modest 3‐fold discrimination of T?A vs. A?T and suggests that an S‐atom in the thiophene ring prefers to lie opposite T not A.     

Solid-phase synthesis of positively charged deoxynucleic guanidine (DNG) tethering a Hoechst 33258 analogue: triplex and duplex stabilization by simultaneous minor groove binding

Deoxynucleic guanidine (DNG), a DNA analogue in which positively charged guanidine replaces the phosphodiester linkages, tethering to Hoechst 33258 fluorophore by varying lengths has been synthesized. A pentameric thymidine DNG was synthesized on solid phase in the 3' --> 5' direction that allowed stepwise incorporation of straight chain amino acid linkers and a bis-benzimidazole (Hoechst 33258) ligand at the 5'-terminus using PyBOP/HOBt chemistry. The stability of (DNA)(2).DNG-H triplexes and DNA.DNG-H duplexes formed by DNG and DNG-Hoechst 33258 (DNG-H) conjugates with 30-mer double-strand (ds) DNA, d(CGCCGCGCGCGCGAAAAACCCGGCGCGCGC)/d(GCGGCGCGCGCGCTTTTTGGGCCGCGCGCG), and single-strand (ss) DNA, 5'-CGCCGCGCGCGCGAAAAACCCGGCGCGCGC-3', respectively, has been evaluated by thermal melting and fluorescence emission experiments. The presence of tethered Hoechst ligand in the 5'-terminus of the DNG enhances the (DNA)(2).DNG-H triplex stability by a DeltaT(m) of 13 degrees C. The fluorescence emission studies of (DNA)(2).DNG-H triplex complexes show that the DNG moiety of the conjugates bind in the major groove while the Hoechst ligand resides in the A:T rich minor groove of dsDNA. A single G:C base pair mismatch in the target site decreases the (DNA)(2).DNG triplex stability by 11 degrees C, whereas (DNA)(2).DNG-H triplex stability was decreased by 23 degrees C. Inversion of A:T base pair into T:A base pair in the center of the binding site, which provides a mismatch selectively for DNG moiety, decreases the triplex stability by only 5-6 degrees C. Upon hybridization of DNG-Hoechst conjugates with the 30-mer ssDNA, the DNA.DNG-H duplex exhibited significant increase in the fluorescence emission due to the binding of the tethered Hoechst ligand in the generated DNA.DNG minor groove, and the duplex stability was enhanced by DeltaT(m) of 7 degrees C. The stability of (DNA)(2).DNG triplexes and DNA.DNG duplexes is independent of pH, whereas the stability of (DNA)(2).DNG-H triplexes decreases with increase in pH.     

Interaction with plasmid DNA of Hoechst-TACN conjugates

ABSTRACT

A new family of conjugates between the Hoechst minor groove binder and the TACN metal ion ligand connected through hydrophobic alkyl or more hydrophilic oxyethyl linkers of different length has been prepared. The linkers are connected to the convex side of the Hoechst skeleton thus forcing the TACN ligand to exit the minor groove and interact with the phosphate backbone of DNA. The conjugates preserve the binding mode of Hoechst with an affinity influenced by the nature of the linker, the more hydrophobic being the more efficient. Coordination of Cu(II) or Zn(II) poorly affect these parameters. Nevertheless, the Zn(II) complex bearing a C6 linear alkyl linker induced a modest but reproducible acceleration of the hydrolytic cleavage of DNA which can be ascribed to the ability of the conjugate to deliver the hydrolytic subunit close to the DNA phosphodiester bonds.     

Comparison of the binding stoichiometries of positively charged DNA-binding drugs using positive and negative ion electrospray ionization mass spectrometry

Positive and negative ion electrospray ionization (ESI) mass spectra of complexes of positively charged small molecules (distamycin, Hoechst 33258, [Ru(phen)2dpq]Cl2 and [Ru(phen)2dpqC]Cl2) have been compared. [Ru(phen)2dpq]Cl2 and [Ru(phen)2dpqC]Cl2 bind to DNA by intercalation. Negative ion ESI mass spectra of mixtures of [Ru(phen)2dpq]Cl2 or [Ru(phen)2dpqC]Cl2 with DNA showed ions from DNA-ligand complexes consistent with solution studies. In contrast, only ions from free DNA were present in positive ion ESI mass spectra of mixtures of [Ru(phen)2dpq]Cl2 or [Ru(phen)2dpqC]Cl2 with DNA, highlighting the need for obtaining ESI mass spectra of non-covalent complexes under a range of experimental conditions. Negative ion spectra of mixtures of the minor groove binder Hoechst 33258 with DNA containing a known minor groove binding sequence were dominated by ions from a 1:1 complex. In contrast, in positive ion spectra there were also ions present from a 2:1 (Hoechst 33258: DNA) complex, suggesting an alternative binding mode was possible either in solution or in the gas phase. When Hoechst 33258 was mixed with a DNA sequence lacking a high affinity minor groove binding site, the negative ion ESI mass spectra showed that 1:1 and 2:1 complexes were formed, consistent with existence of binding modes other than minor groove binding. The data presented suggest that comparison of positive and negative ion ESI-MS spectra might provide an insight into various binding modes in both solution and the gas phase.     

Short lexitropsin that recognizes the DNA minor groove at 5'-ACTAGT-3': understanding the role of isopropyl-thiazole

Isopropyl-thiazole ((iPr)Th) represents a new addition to the building blocks of nucleic acid minor groove-binding molecules. The DNA decamer duplex d(CGACTAGTCG)(2) is bound by a short lexitropsin of sequence formyl-PyPy(iPr)Th-Dp (where Py represents N-methyl pyrrole, (iPr)Th represents thiazole with an isopropyl group attached, and Dp represents dimethylaminopropyl). NMR data indicate ligand binding in the minor groove of DNA to the sequence 5'-ACT(5)AG(7)T-3' at a 2:1 ratio of ligand to DNA duplex. Ligand binding, assisted by the enhanced hydrophobicity of the (iPr)Th group, occurs in a head-to-tail fashion, the formyl headgroups being located toward the 5'-ends of the DNA sequence. Sequence reading is augmented through hydrogen bond formation between the exocyclic amine protons of G(7) and the (iPr)Th nitrogen, which lies on the minor groove floor. The B(I)/B(II) DNA backbone equilibrium is altered at the T(5) 3'-phosphate position to accommodate a B(II) configuration. The ligands bind in a staggered mode with respect to one another creating a six base pair DNA reading frame. The introduction of a new DNA sequence-reading element into the recognition jigsaw, combined with an extended reading frame for a small lexitropsin with enhanced hydrophobicity, holds great promise in the development of new, potentially commercially viable drug lead candidates for gene targeting.     

Alternative heterocycles for DNA recognition: the benzimidazole/imidazole pair

Boc-protected benzimidazole-pyrrole, benzimidazole-imidazole, and benzimidazole-methoxypyrrole amino acids were synthesized and incorporated into DNA binding polyamides, comprised of N-methyl pyrrole and N-methyl imidazole amino acids, by means of solid-phase synthesis on an oxime resin. These hairpin polyamides were designed to determine the DNA recognition profile of a side-by-side benzimidazole/imidazole pair for the designated six base pair recognition sequence. Equilibrium association constants of the polyamide-DNA complexes were determined at two of the six base pair positions of the recognition sequence by quantitative DNase I footprinting titrations on DNA fragments each containing matched and single base pair mismatched binding sites. The results indicate that the benzimidazole-heterocycle building blocks can replace pyrrole-pyrrole, pyrrole-imidazole, and pyrrole-hydroxypyrrole constructs while retaining relative site specifities and subnanomolar match site affinities. The benzimidazole-containing hairpin polyamides represent a novel class of DNA binding ligands featuring tunable target recognition sequences combined with the favorable properties of the benzimidazole type DNA minor groove binders.     

Quantitative footprinting analysis of drug-DNA interactions: Fe(III) methidium-propyl-EDTA as a probe

Quantitative footprinting studies involving a 139-base pair restriction fragment from pBR322 DNA, a lexitropsin ligand and two different DNA cleavage agents, the enzyme DNase I and the footprinting reagent Fe(III) methidium-propyl-EDTA (Fe-MPE), are described. The autoradiographic data showed that the ligand, an analogue of netropsin possessing two N-methylimidazole groups, binds to four regions on the 139-mer which are rich in GC. Analysis of the data leading to individual binding constants for each of the four loading events on the 139-mer revealed that Fe-MPE and DNase I report the same binding constants for the lexitropsin bound to its interaction sequences. The fact that the data from both probes can be analyzed using a common model indicates that the DNA cleavage specificity of the probe and not its binding/cleavage mechanism is the important factor in reporting of site loading information in the footprinting experiment. The study also showed that under certain conditions it is possible to gain information on the density of ligand binding sites on carrier DNA by monitoring site loading events on the labeled fragment.     

NMR structure of a cyclic polyamide-DNA complex

The solution structure of a cyclic polyamide ligand complexed to a DNA oligomer, derived from NMR restrained molecular mechanics, is presented. The polyamide, cyclo-gamma-ImPyPy-gamma-PyPyPy-, binds to target DNA with a nanomolar dissociation constant as characterized by quantitative footprinting previously reported. 2D (1)H NMR data were used to generate distance restraints defining the structure of this cyclic polyamide with the DNA duplex d(5'-GCCTGTTAGCG-3'):d(5'-CGCTAACAGGC-3'). Data interpretation used complete relaxation matrix analysis of the NOESY cross-peak intensities with the program MARDIGRAS. The NMR-based distance restraints (276 total) were applied in restrained molecular dynamics calculations using a solvent model, yielding structures with an rmsd for the ligand and binding site of approximately 1 A. The resulting structures indicate some distortion of the DNA in the binding site. The constraints from cyclization lead to altered stacking of the rings in the halves of the cyclic ligand relative to unlinked complexes. Despite this, the interactions with DNA are very similar to what has been found in unlinked complexes. Measurements of ligand amide and DNA imino proton exchange rates indicate very slow dissociation of the ligand and show that the DNA can undergo opening fluctuations while the ligand is bound although the presence of the ligand decreases their frequency relative to the free DNA.     

DNA sequence dependent monomer-dimer binding modulation of asymmetric benzimidazole derivatives

A number of studies indicate that DNA sequences such as AATT and TTAA have significantly different physical and interaction properties. To probe these interaction differences in detail and determine the influence of charge, we have synthesized three bisbenzimidazole derivatives, a diamidine, DB185, and monoamidines, DB183 and DB210, that are related to the well-known minor groove agent, Hoechst 33258. Footprinting studies with several natural and designed DNA fragments indicate that the synthetic compounds bind at AT sequences in the minor groove and interact more weakly at sites with TpA steps relative to sites without such steps. Circular dichroism spectroscopy also indicates that the compounds bind in the DNA minor groove. Surprisingly, Tm studies as a function of ratio indicate that the monoamidines bind to TTAA sequences as dimers, whereas the diamidine binds as a monomer. Biosensor-surface plasmon resonance (SPR) studies allowed us to quantitate the interaction differences in more detail. SPR results clearly show that the monoamidine compounds bind to the TTAA sequence in a cooperative 2:1 complex but bind as monomers to AATT. The dication binds to both sequences in monomer complexes but the binding to AATT is significantly stronger than binding to TTAA. Molecular dynamics simulations indicate that the AATT sequence has a narrow time-average minor groove width that is a very good receptor site for the bisbenzimidazole compounds. The groove in TTAA sequences is wider and the width must be reduced to form a favorable monomer complex. The monocations thus form cooperative dimers that stack in an antiparallel orientation and closely fit the structure of the TTAA minor groove. The amidine groups in the dimer are oriented in the 5' direction of the strand to which they are closest. Charge repulsion in the dication apparently keeps it from forming the dimer. It instead reduces the TTAA groove width, in an induced fit process, sufficiently to form a minor groove complex. The dimer-binding mode of DB183 and DB210 is a new DNA recognition motif and offers novel design concepts for selective targeting of DNA sequences with a wider minor groove, including those with TpA steps.     

DNA recognition by the anthracycline antibiotic respinomycin D: NMR structure of the intercalation complex with d(AGACGTCT)2

Respinomycin D is a member of the anthracycline family of antitumour antibiotics that interact with double stranded DNA through intercalation. The clinical agents daunomycin and doxorubicin are the most well-studied of this class but have a relatively simple molecular architecture in which the pendant daunosamine sugar resides in the DNA minor groove. Respinomycin D, which belongs to the nogalamycin group of anthracyclines, possesses additional sugar residues at either end of the aglycone chromophore that modulate the biological activity but whose role in molecular recognition is unknown. We report the NMR structure of the respinomycin D-d(AGACGTCT)2 complex in solution derived from NOE restraints and molecular dynamics simulations. We show that the drug threads through the DNA double helix forming stabilising interactions in both the major and minor groove, the latter through a different binding geometry to that previously reported. The bicycloaminoglucose sugar resides in the major groove and makes specific contacts with guanine at the 5'-CpG intercalation site, however, the disaccharide attached at the C4 position plays little part in drug binding and DNA recognition and is largely solvent exposed.     

Relative DNA binding affinity of helix 3 homeodomain analogues, major groove binders, can be rapidly screened by displacement of prebound ethidium bromide. A comparative study

The binding affinity for a 12-bp dsDNA of Antennapedia helix 3 analogues, major groove binders, has been measured by displacement of prebound ethidium bromide, a fluorescent displacement assay proposed for minor groove binders by Boger et al.(J. Am. Chem. Soc., 2000, 122, 6382-6394). Relative binding affinities determined by this method were compared to those obtained by gel mobility shift and footprinting assays for the 12-bp dsDNA and a 178-bp DNA fragment. The present work demonstrates that the fluorescence displacement assay is suitable for rapid screening of major groove binders, even though about 60 to 70% of the prebound ethidium bromide is displaced by these peptides. Total (100%) displacement of ethidium bromide was serendipitously achieved by addition in the peptide sequence, at the N-terminus, of a S-3-nitro-2-pyridinesulfenyl-N-acetyl-cysteine residue. S-3-nitro-2-pyridinesulfenylcysteine was shown to (i) bind to dsDNA with a micromolar affinity and (ii) direct within DNA grooves a peptide with no affinity for dsDNA.