Identification of species formed after pyridine adsorption on iron,cobalt, nickel and silver electrodes by SERS and theoretical calculations

The adsorption of pyridine (py) on Fe, Co, Ni and Ag electrodes was studied using surface‐enhanced Raman scattering (SERS) to gain insight into the nature of the adsorbed species. The wavenumber values and relative intensities of the SERS bands were compared to the normal Raman spectrum of the chemically prepared transition metal complexes. Raman spectra of model clusters M₄(py) (four metal atoms bonded to one py moiety) and M₄(α‐pyridil) where M = Ag, Fe, Co or Ni were calculated by density functional theory (DFT) and used to interpret the experimental SERS results. The similarity of the calculated M₄(py) spectra with the experimental SERS spectra confirm the molecular adsorption of py on the surface of the metallic electrodes. All these results exclude the formation of adsorbed α‐pyridil species, as suggested previously. Copyright © 2009 John Wiley & Sons, Ltd.     

Spectroscopic and Conductance Studies of New Transition Metal Complexes with a Schiff Base Derived from 4‐Methoxybenzaldehyde and 1,2‐bis(p‐Aminophenoxy)ethane

Four new metal complexes of Cu(II), Ni(II), Zn(II) and Co(III) with Schiff base derived from 4‐methoxybenzaldehyde and 1,2‐bis(p‐aminophenoxy)ethane have been prepared and characterized by magnetic susceptibility, conductance measurements, elemental analyses, UV–Vis, ¹H NMR and IR spectra studies. The magnetic and spectroscopic data indicate an octahedral geometry for the six‐coordinate complexes. The ligand was used for complexation studies. Stability constants were measured by means of a conductometric method. Furthermore, the stability constants for complexation between ZnCl₂, Cu(NO₃)₂ and AgNO₃ salts and ligand (L) in 80% dioxane–water and pure methanol were determined from conductance measurements. In 80% dioxane–water, he stability constants (log Ke) increase inversely with the crystal radii in the order Ag(I) < Zn(II) < Cu(II).     

Raman and surface enhanced Raman scattering of a black dyed silk

The Raman and surface enhanced Raman scattering (SERS) spectra of a black dyed silk sample (BDS) were registered. The spectral analysis was performed on the basis of Raman and SERS spectral data of isolated samples of Bombyx mori silk fibroin, its motif peptide component (GAGAGS) and the synthetic reactive black 5 dye (RB5). The macro FT‐Raman spectrum of the silk sample is consistent with a silk II‐Cp crystalline fraction of Bombyx mori silk fibroin; the SERS spectrum is highly consistent with conformational modifications of the fibroin due to the interactions with the Ag nanoparticles. The GAGAGS peptide sequence dominates the Raman spectrum of the silk. The SERS spectrum of the peptide suggests a random coil conformation imposed by the surface interaction; the serine residue in the new conformation is exposed to the surface. Quantum chemical calculations for a model of the GAGAGS–Ag surface predict a nearly extended conformation at the Ag surface. The Raman spectrum of the dye was analysed, and a complete band assignment was proposed; it was not possible to propose a preferential orientation or organization of the molecule on the metal surface. Quantum chemical calculations for a model of the dye interacting with a silver surface predict a rather coplanar orientation of the RB5 on the Ag metal surface. The Raman spectrum of the BDS sample is dominated by signals from the dye; the general spectral behaviour indicates that the dye mainly interacts with the silk through the sulphone (–SO₂–) and sulphonate (–SO₂–O–) groups. Besides the presence of dye signals, mainly ascribed to the sulphone and sulphonate bands, the SERS spectrum of the BDS sample also displays bands belonging to the amino acids alanine, glycine, serine and particularly tyrosine. Copyright © 2013 John Wiley & Sons, Ltd.     

Theoretical elucidation of the origin of surface‐enhanced Raman spectra of PCB52 adsorbed on silver substrates

To better understand experimentally observed surface‐enhanced Raman Scattering (SERS) of polychlorinated biphenyls (PCBs) adsorbed on nanoscaled silver substrates, a systematic theoretical study was performed by carrying out density functional theory and time‐dependent density functional theory calculations. 2,2′,5,5′‐tetrachlorobiphenyl (PCB52) was chosen as a model molecule of PCBs, and Ag_n (n = 2, 4, 6, and 10) clusters were used to mimic active sites of substrates. Calculated normal Raman spectra of PCB52–Ag_n (n = 2, 4, 6, and 10) complexes are analogical in profile to that of isolated PCB52 with only slightly enhanced intensity. In contrast, the corresponding SERS spectra calculated at adopted incident light are strongly enhanced, and the calculated enhancement factors are 10⁴ ~ 10⁵. Thus, the experimentally observed SERS phenomenon of PCBs supported on Ag substrates should correspond to the SERS spectra rather than the normal Raman spectra. The dominant enhancement in Raman intensities origins from the charge transfer resonance enhancement between the molecule and clusters. Copyright © 2014 John Wiley & Sons, Ltd.     

Influence of spin-orbit coupling on vibronic spectra of metalocomplexes porphin: Manifestation of out-of-plane vibrations

In fine-structure phosphorescence spectra of metallocomplexes of porphin with ions of the Pd(II) and Pt(II) and their meso-deuterated derivatives additional lines have been detected which have no analogs in fluorescence and resonance Raman spectra of metalloporphyrins and in phosphorescence spectra of metallocomplexes of porphin with light ions of the Mg(II) and Zn(II). For Zn-porphin, quantum-chemical calculations of frequencies and forms of in-plane and out-of-plane vibrations have been performed. Based on experimental data and calculation results it has been found, that in vibronic phosphorescence spectra of metallocomplexes of porphin, out-of-plane gerade modes of the E _g symmetry (D _4h symmetry group) are manifested. The activity of out-of-plane vibrations increases with enhancing spin-orbital coupling upon changing to heavier chelated metal ions. Vibronic transitions with participation of out-of-plane gerade E _g vibrations manifest in the T ₁ → S ₀ transition through the vibronic intensity borrowing from the triplet-triplet ³ E _u -³ E _g transition.     

The influence of divalent metal ions on low pH induced LacDNA structural changes as probed with UV resonance Raman spectroscopy

UV (275 nm) resonance Raman spectra of LacDNA 22‐mer duplex [d(TAATGTGAGTTAGCTCACTCAT) · d(ATGAGTGAGCTAACTCACATTA)], which contain protein binding sites within the E. coli lac promoter, were measured at two pH values (6.4 and 3.45) in the absence and presence of Mn²⁺ and Ca²⁺ metal ions, respectively. Also, the UV (275 nm) resonance Raman markers of the corresponding oligonucleotide d(TAATGTGAGTTAGCTCACTCAT) and of its complementary anti‐sense strand d(ATGAGTGAGCTAACTCACATTA) were established and tentatively assigned. Large changes in the UV (275 nm) resonance Raman spectra of LacDNA duplex were observed at pH 3.45 as compared with the corresponding spectrum at pH 6.4, in the absence of divalent metal ions and at low concentrations of Ca²⁺ ions, respectively. Major changes comprise: adenine protonation, GC base pair protonation, DNA bases unstacking and changes in the hydrogen bonding strength between the strands of different LacDNA complexes, respectively. Divalent metal ions (Mn²⁺ and Ca²⁺) were found to inhibit LacDNA protonation even at low concentrations. Manganese(II) ions are much more effective in this regard, as compared with calcium(II) ions. Binding of Mn²⁺ ions to N7 of guanine and, possibly, in a lesser extent to adenine was observed as judging from the difference Raman bands at 1315, 1354 and 1493 cm⁻¹. Copyright © 2013 John Wiley & Sons, Ltd.     

Preparation,Chemical Characterization and Electronic Spectra of 6-(2-Pyridylazo)-3-Acetamidophenol and Its Metal Complexes

The stereochemistry of new iron (III), cobalt (II), nickel (II), copper (II), zinc (II) and cadmium (II) complexes of 6-(2-pyridylazo)-3-acetamidophenol (H2L) was studied on the basis of their analytical, spectroscopic, magnetic and conductance data. the dissociation constant of the ligand, as well as the stability constants of its metal complexes had been determined by spectrophotometric method. on the basis of infrared spectra, the coordination behaviour of the ligand to the metal ions was investigated. Magnetic susceptibility and solid reflectance spectra measurements were used to infer the structure. the isolated complexes were found to have the general formulae [M (HL). xH₂O] (A).yH₂O, M = Cu (II), Zn (II), Cd (II) and Fe (HI); HL = 6-(2-pyridylazo)-3-acetamido-phenol; a = acetate in the case of Cu (II) and Zn (II) or chloride in the case of Cd (II) and Fe (Ill), x = 1-3 and y=0-5. for [M (H₂L).xH₂O]Cl₂.yH₂O, M = Ni (II) and Co (II); HL = 6-(2-pyridyl-azo)-3-acetamidophenol, x=3 and y=5-6).     

Synthesis,Characterization, DNA Binding Properties,Fluorescence Studies and Antioxidant Activity of Transition Metal Complexes with Hesperetin-2-hydroxy Benzoyl Hydrazone

A novel Schiff-base ligand (H₅L), hesperetin-2-hydroxy benzoyl hydrazone, and its copper (II), zinc (II) and nickel (II) complexes (M·H₃L) [M(II) = Cu, Zn, Ni], have been synthesized and characterized. The ligand and Zn (II) complex exhibit green and blue fluorescence under UV light and the fluorescent properties of the ligand and Zn (II) complex in solid state and different solutions were investigated. In addition, DNA binding properties of the ligand and its metal complexes have been investigated by electronic absorption spectroscopy, fluorescence spectra, ethidium bromide displacement experiments, iodide quenching experiments, salt effect and viscosity measurements. Results suggest that all the compounds bind to DNA via an intercalation binding mode. Furthermore, the antioxidant activity of the ligand and its metal complexes was determined by superoxide and hydroxyl radical scavenging methods in vitro. The metal complexes were found to possess potent antioxidant activity and be better than the free ligand alone and some standard antioxidants like vitamin C and mannitol.     

Surface‐enhanced Raman scattering on colloid gels originated from low molecular weight gelator

Surface‐enhanced Raman scattering (SERS) on silver and gold colloid gels formed by a low molecular weight organic gelator, bis‐(S‐phenylalanine) oxalyl amide, was obtained. Strong Raman signals dominate in the SERS spectra of hydrogels containing silver nanoparticles prepared by citrate and borohydride reduction methods, whereas broad bands of low intensity are detected in the spectra of gold colloid gels. Resemblance between Raman spectrum of the crystalline substance and the SERS spectra of the silver nanoparticle–hydrogel composites implies the electromagnetic nature of the signal enhancement. A change in Raman intensity of the benzene and amide II bands caused by an increase in temperature and concentration indicates that the gelling molecules are strongly attached through the benzene moieties to the metal nanoparticles while participating in gel formation by intermolecular hydrogen bonding between the adjacent oxalyl amide groups. Transmission electron microscopy reveals a dense gel structure in the close vicinity of the enhancing metal particles for both silver colloid gels. Copyright © 2008 John Wiley & Sons, Ltd.     

Identification of two Ag‐2,2′:6′,2″‐terpyridine surface species on Ag nanoparticle surfaces by excitation wavelength dependence of SERS spectra and factor analysis: evidence for chemical mechanism contribution to SERS of Ag(0)–tpy

Measurement and interpretation of the excitation wavelength dependence of surface‐enhanced Raman scattering (SERS) spectra of molecules chemisorbed on plasmonic, e.g. Ag nanoparticle (NP) surfaces, are of principal importance for revealing the charge transfer (CT) mechanism contribution to the overall SERS enhancement. SERS spectra, their excitation wavelength dependence in the 445–780‐nm range and factor analysis (FA) were used for the identification of two Ag‐2,2′:6′,2″‐terpyridine (tpy) surface species, denoted Ag⁺–tpy and Ag(0)–tpy, on Ag NPs in systems with unmodified and/or purposefully modified Ag NPs originating from hydroxylamine hydrochloride‐reduced hydrosols. Ag⁺–tpy is a spectral analogue of [Ag(tpy)]⁺ complex cation, and its SERS shows virtually no excitation wavelength dependence. By contrast, SERS of Ag(0)–tpy surface complex generated upon chloride‐induced compact aggregate formation and/or in strongly reducing ambient shows a pronounced excitation wavelength dependence attributed to a CT resonance (the chemical mechanism) contribution to the overall SERS enhancement. Both the resonance (λ_exc = 532 nm) and off‐resonance (λ_exc = 780 nm) pure‐component spectra of Ag(0)–tpy obtained by FA are largely similar to surface‐enhanced resonance Raman scattering (λ_exc = 532 nm in resonance with singlet metal to ligand CT (¹ MLCT) transition) and SERS (λ_exc = 780 nm) spectra of [Fe(tpy)₂]²⁺ complex dication. Copyright © 2014 John Wiley & Sons, Ltd.     

Easily attainable new approach to mass yield ferrocenyl Schiff base and different metal complexes of ferrocenyl Schiff base through convenient ultrasonication‐solvothermal method

A new alternative approach with crucial mass yield and high reaction rates is proposed for the synthesis of ferrocenyl Schiff bases using an ultrasonication‐solvothermal method. Equimolar condensation of ferrocenecarboxaldehyde and 2‐aminophenol interact with each other, giving 1‐(1‐[2‐hydroxyphenyl‐2‐imino]methyl)‐ferrocene (FcOH). Furthermore, this ligand forms 1:1 complexes with cobalt(II), nickel(II), copper(II), and palladium(II) ions. From the different spectral data, it is found that metal ions coordinate with ligands through the azomethine group and the deprotonated oxygen of the phenol groups. Moreover, FcOH and their complexes were characterized by elemental analysis, Fourier transform infrared, ¹H nuclear magnetic resonance, and UV‐visible spectrophotometry. The spectral data of FcOH and its metal complexes were discussed in connection with the structural changes due to complexation. Meanwhile, the information about geometric structures can be concluded from the electronic spectra and the magnetic moments. Plainly, electron spin resonance spectra of the Cu(II) complex revealed d_x2?y2 as a ground state, suggesting a square planar geometry around the Cu(II) center. The direct optical band gap energy E_g values of cobalt, nickel, copper, and palladium complexes of FcOH are found to be 3.7, 3.9, 4.6, and 3.65 eV, respectively. 1‐(1‐[2‐Hydroxyphenyl‐2‐imino]methyl)‐ferrocene and its metal complexes were screened for antibacterial activity. The results depict that the metal complexes were found to be more strongly antibacterial than the guardian Schiff base ligand (FcOH) against one or more bacterial species. The minimum inhibitory concentrations of antimicrobial properties of the purified compound were determined using the broth microdilution method.     

Synthesis,Thermal Behavior,and Antimicrobial Activity of a Novel Macrocycle and its Transition Metal Complexes Derived from Thiosemicarbazide

The present study reports the synthesis of Co(II), Ni(II), Mn(II), Cu(II), and Zn(II) complexes with a new macrocyclic ligand (L₂)- 1,2,8,9,11,14-hexaazacyclopentadeca-12,13-dioxo-10,15-dithione-2,7-diene. The macrocycle was derived from thiosemicabazone (L₁) and diethyloxalate that were prepared by the reaction of thiosemicarbazide and glutaraldehyde in the ratio of 2:1. The synthesized complexes and ligands were characterized by elemental analysis and molar conductance, magnetic susceptibility, ¹HNMR, IR, electronic, and thermogravimetric analyses. The molar conductance values confirmed that the Ni(II), Cu(II), Zn(II), Mn(II) and Co(II) complexes were 1:2 electrolytes. On the basis of electronic spectral studies and molar conductance measurements, the authors proposed an octahedral structure for Ni(II), Mn(II), and Co(II) complexes, tetrahedral geometry for Zn(II) complex, and square planar geometry for Cu(II) complex. The thermal behavior of the compounds was studied by TGA in a nitrogen atmosphere up to 750°C at the rate of 20°C/min. The TGA results revealed that the complexes had higher thermal stability than the macrocycle. All the synthesized compounds were screened against 4 bacteria (i.e., Streptococcus aureus, Escherichia coli, Bacillus subtillis, Salmonella typhimurium) and 2 fungi (i.e., Fusarium oryzae, Candida albicans). The results showed that the metal complexes inhibited the growth of bacteria to a greater extent as compared to the ligand.     

Vibrational Spectroscopic Studies of 3,4-Lutidine Metal (II) Tetracyanonickelate Complexes

Infrared and Raman spectra of seven new metal (II) 3,4-lutidine tetracyanonickelate complexes, M(3,4 L)₂ Ni(CN)₄ [where 3,4 L = 3,4 - dimethyl-pyridine or 3,4-lutidine; M = Mn, Fe, Co, Zn, Ni, Cu or Cd] (abbreviated to M - Ni - 3,4 L) have been investigated. Spectroscopic and magnetic susceptibility measurements indicate that the compounds have the structure of Hofmann-type complexes. The copper complex has spectral features different from the other compounds.     

Structural, vibrational, thermal and magnetic investigation of novel Co(II), Cu(II), Zn(II) and Hg(II) crystalline metal complexes with 2-amino-5-benzylmercapto-1,3,4-thiadiazole: a low weight model of protonated copolymer resin

The 2-amino-5-benzylmercapto-1,3,4-thiadiazole (C₉H₉N₃S₂) is a low weight model of a protonated copolymer resin used as a metal uptake agent. New monomeric crystalline metal complexes of C₉H₉N₃S₂ with Co(II), Cu(II), Zn(II) and Hg(II) were synthesized and investigated in order to facilitate the interpretation of the metal/resin binding mode. These materials have been studied by single crystal X-ray Diffraction and FTIR Spectroscopy at room temperature. Crystal data for these triclinic phases are reported. All frameworks consist of discrete monomeric units that provide crystalline stability through a network of hydrogen bond interactions. The Co(II), Zn(II) and Hg(II) ions are surrounded by a tetrahedral arrangement of two thioether monodentate ligands (each one coordinating by a N(1)_thiadiazole atom) and two chlorine atoms. The Cu(II) ion is coordinated by four thioether monodentate ligands (each one coordinating by a N(1)_thiadiazole atom) and one chlorine atom as nearest neighbor in a distorted square pyramidal polyhedron. The spectroscopic data are consistent with the structural model. FTIR spectra evidence changes in the H-bonds in the crystal packing when coordination with these divalent ions is present. Magnetic susceptibility at room temperature for Cu(II) and Co(II) complexes, EPR spectrum at room temperature for Cu(II) complex and thermal properties for all complexes were measured. These results could be useful for the interpretation of the binding mode of M(II)/1,3,4-thiadiazole-2-amino-5-thiol in protonated copolymer resin which are used as uptake agents of toxic metallic ions.     

EPR investigations of structure of humic acids from compost, soil, peat and soft brown coal upon oxidation and metal uptake

Free radical concentration and theirg-values in humic acids (HA) isolated from various sources were studied by quantitative EPR technique. EPR data for HA formed during composting and natural humification processes occurring in soil, peat and brown coal are given. In more detail the EPR data were analyzed for brown coal HA under carbonization, air oxidation (150°C) as well as metal uptake (Ca(II), Zn(II), Cd(II), Hg(II), Co(II), Ni(II) and Cu(II)) and NO₂ reaction. Two groups of metal complexes were distinguished on the basis of their interaction with free radicals in HA. Ca(II), Zn(II), Cd(II) and Hg(II) ions increase free radical concentration, while Co(II), Ni(II) and Cu(II) ions quench the radicals compared to the raw HA. This phenomenon can be explained either by the strong interaction of the metal ions with active centres responsible for the quinone-hydroquinone-semiquinone equilibria, and/or by the antiferromagnetic interaction between radical spins and metal d orbitals. Gaseous ammonia was found to be a very useful base easily penetrating the solid matrix of HA and strongly influencing the equilibria. β-Diketone groups present in HA react with NO₂ yielding iminoxy radicals. In the HA-metal complexes these structural units are engaged in metal coordination which lowers effectiveness of the iminoxyl synthesis.     

Metal–organic frameworks: a novel SERS substrate

We report the direct observation of surface‐enhanced Raman scattering (SERS) effect using metal–organic frameworks (MOFs) as substrates. Without the aid of any metal colloids or enhancing agents, the SERS signals of methyl orange (MO) adsorbed in MOFs were observed and even remained active if the organic linkers in MOFs were completely removed by high temperature and O₂ plasma treatments. It implies that the SERS active site is at the metal oxide clusters. The ultraviolet‐visible spectra of MO, MOFs, and MO–MOF complexes show that absorption peaks are far from laser excitation line. Thus, conventional resonance enhancement effect should be ruled out, and charge‐transfer mechanism is the most likely scenario responsible for the observed SERS effect. Density functional theory (DFT) was used to interpret the chemical enhancement mechanism and the adsorption orientation‐dependent SERS spectra in our observation. The preferred adsorption orientations calculated by DFT method are consistent with the observed SERS results. Copyright © 2013 John Wiley & Sons, Ltd.     

Synthesis, thermal and optical properties of metal(II) complexes with a novel ligand derived from pyrazolone-5

Three novel metal(II) complexes, CoL₂, NiL₂ and CuL₂ (L = (Z)-4-(2-(1,3-dimethyl-5-oxo-1H-pyrazol-4(5H)-ylidene)hydrazinyl)-1,5-dimethyl-2-phenyl-1,2-dihydropyrazol-3-one were synthesized. Their structures were postulated based on elemental analyses, ¹H NMR, ESI-MS, FT-IR spectra and UV-vis spectra. The effect of different central metal(II) ions on absorption bands of the metal(II) complexes in CHCl₃ solutions was researched. The result indicates that the bathochromic shift is CuL₂ > NiL₂ > CoL₂. The absorption properties of thin films and thermal stability of these complexes are also discussed. In addition, the optical constants (complex refractive index N=n+ik) and thickness of the complex thin films on polished single-crystal silicon substrates were measured by spectroscopic ellipsometry. Results indicate that the metal(II) complexes would be a promising recording medium candidate for blu-ray recordable optical storage system due to good absorption at 405 nm, high thermal stability and sharp thermal decomposition, and a high n values of 1.35–1.45 and a low k values of 0.33–0.39.     

Study of Infrared and Electronic Spectra Of N-Exadecyl-8-hydroxy-2-quinolinecarboxamide Complexes

The infrared and electronic spectra of twelve amphiphilic complexes of N-hexadecyl-8-hydroxy-2-quinoline carboxamide (HL) have been investigated. In IR spectra a linear relationship between the v (C-O) frequency in C-O-M bond of the complexes and the relative atomic weight of the central metal ions and a linear relationship between the v (C-O) frequency and the ionization potential of the central metal (M →M²⁺(g)+2e) were obtained. These complexes appeared to fall into two groups. One is the complexes of closed-shell metal ions such as Ca(II), Mg(II), Zn(II), Cd(II), Al(III), La(III) and Gd(III) ion, the other is the complexes of transitional metal ions such as Mn(II), Co(II), Ni(II) and Cu(II) ion. All these complexes can form stable monolayer and can be deposited as uniform LB films.     

DNA Binding and Photocleavage Study of Cationic Metalloporphyrins by Spectral Methods

The DNA binding and photocleavage specificities of the Zn(II), Cu(II), Co(III), Mn(III) complexes of 5,10,15-tris(1-methylpyridinium-4-yl)-20-(4-propionoxyphenyl)porphyrin have been studied by using a combination of absorption, fluorescence titration, surface-enhanced Raman spectroscopy (SERS), induced circular dichroism (ICD) spectroscopy, thermal DNA denaturation as well as gel electrophoresis experiment. It is found that Cu(II) porphyrin has comparable binding ability with the free base porphyrin while the axial-coordinated Zn(II), Co(III), and Mn(III) porphyrins have lower K_b because of the molecular steric hindrance. However, those metalloporphyrins with lower K_b have similar DNA cleavage efficiencies with the free base porphyrin. This could be best understood by the enhancement of the ¹O₂ productivity which may also result from the steric hindrance of the axial-coordinated metalloporphyrins.     

Metal–metal bonding and structures of trinickel and tricobalt dipyridylamido complexes from surface‐enhanced Raman spectra

We recorded surface‐enhanced Raman scattering (SERS) spectra of metal‐string complexes Co₃(dpa)₄ Cl₂ [di(2‐pyridyl)amido (dpa)], Ni₃(dpa)₄ Cl₂ and the oxidized form of the Ni₃ complex to determine their vibrational wavenumbers and to investigate their structures. For SERS measurements these complexes were adsorbed on silver nanoparticles in aqueous solution to eliminate the constraint of a crystal lattice and the complexes remain in thermal equilibrium. From our analysis of the vibrational normal modes we assigned the SERS lines at 242 and 276 cm⁻¹ to Ni₃ and Co₃ symmetric‐stretching modes of the symmetric form. For Co₃ (dpa)₄Cl₂ a Raman line at 383 cm⁻¹ was assigned to the Co Co stretching mode of the unsymmetric form. The wavenumber of the Ni₃ symmetric‐stretching mode of the oxidized form [Ni₃(dpa)₄]³⁺ is 274 cm⁻¹, greater than that for neutral Ni₃(dpa)₄Cl₂, in agreement with a prediction of delocalized molecular‐orbital theory that an electron is removed from an antibonding orbital after oxidation. The experimental data show that the SERS technique serves as an excellent tool to observe the variation of metal–metal bonding during an oxidation or reduction reaction. Copyright © 2010 John Wiley & Sons, Ltd.