Synthesis of novel C4-linked imidazole ribonucleoside phosphoramidites for probing general acid and base catalysis in ribozyme

We describe the synthesis of novel C4-linked imidazole ribonucleoside phosphoramidite (PA) 1a by which the imidazole moiety is incorporated into VS ribozyme to study its role in general acid and base catalysis. Investigation of protecting groups for the imidazole-N first indicated that pivaloyloxymethyl (POM) was adequate as an N-protecting group for the imidazole nucleoside, which could be readily removed under mild basic conditions. Further, the synthetic method was extended to synthesis of 2′-deoxy- and 2′-O-allyl nucleoside PAs 1b and 1c.     

Chemical synthesis of oligoribonucleotides containing 2-aminopurine: substrates for the investigation of ribozyme function

The chemical synthesis of a fully protected ribonucleoside phosphoramidite, containing 2-aminopurine as the base component, and its incorporation into short oligoribonucleotides as substrates for an engineered ribozyme from Tetrahymena is described.     

A general method for the synthesis of 2'-O-cyanoethylated oligoribonucleotides having promising hybridization affinity for DNA and RNA and enhanced nuclease resistance

[reaction: see text] An effective method for the synthesis of 2'-O-cyanoethylated oligoribonucleotides as a new class of 2'-O-modified RNAs was developed. The reaction of appropriately protected ribonucleoside derivatives with acrylonitrile in t-BuOH in the presence of Cs2CO3 gave 2'-O-cyanoethylated ribonucleoside derivatives in excellent yields, which were converted by a successive selective deprotection/protection strategy to 2'-O-cyanoethylated 5'-O-dimethoxytritylribonucleoside 3'-phosphoramidite derivatives in high yields. Fully 2'-O-cyanoethylated oligoribonucleotides, (Uce)12 and (GceAceCceUce)3, were successfully synthesized in the phosphoramidite approach by use of the phosphoramidite building blocks. It was also found that oligoribonucleotides having a 2'-O-cyanoethylated ribonucleoside (Uce, Cce, Ace, or Gce) could be obtained by the selective removal of the TBDMS group from fully protected oligoribonucleotide intermediates without loss of the cyanoethyl group by use of NEt3 x 3HF as a desilylating reagent. The detailed T(m) experiments revealed that oligoribonucleotides containing 2'-O-cyanoethylated ribonucleosides have higher hybridization affinity for both DNA and RNA than the corresponding unmodified and 2'-O-methylated oligoribonucleotides. In addition, introduction of a cyanoethyl group into the 2'-position of RNA resulted in significant increase of nuclease resistance toward snake venom and bovine spleen phosphodiesterases compared with that of the methyl group.     

Large scale synthesis of oligoribonucleotides on PEG by the phosphite triester approach

Large scale synthesis of oligoribonucleotides has been successfully performed on PEG support by the phosphoramidite approach using t-butyldimethylsilyl to protect the 2'-hydroxyl group of ribonucleoside. By means of this procedure, the dodecamer r(AGUGGUCUUUGU) was synthesized in 98.1% average coupling yield, and 55 mg pure product was obtained from one gram of functionalized PEG.     

Regio- and stereoselective glycosylation: synthesis of 5-haloimidazole alpha-ribonucleosides

We describe the synthesis of novel 5-haloimidazole ribonucleosides as precursors of modified cobalamins. A regio- and stereoselective glycosylation of protected ribose with silylated 4(5)-haloimidazoles produces 5-haloimidazole ribonucleosides predominantly in the alpha-configuration (60-75%) without any 4-substituted imidazole ribonucleoside. The structure of the 5-fluoroimidazole ribonucleoside was confirmed by X-ray crystallography and 2D NMR spectroscopy.     

An improved phosphoramidite approach for the chemical synthesis of 3′,5′-cyclic diguanylic acid

3′,5′-Cyclic diguanylic acid (c-di-GMP) plays important roles as a signaling and effector molecule in prokaryotes as well as inducing innate and adaptive immune responses in mammalian cells through activation of cell death pathways. An improved phosphoramidite method for the synthesis of c-di-GMP is reported herein. The method is based on the use of an unprecedented 5′-O-formyl ester, which can efficiently and chemoselectively be cleaved from a dinucleotide phosphoramidite intermediate to permit a 1H-tetrazole-mediated cyclocondensation reaction leading to a fully protected c-di-GMP product in a yield of 78%. The native c-di-GMP is isolated in an overall yield of 36% based on the commercial ribonucleoside used as starting material.     

Phosphoramidite coupling to oligonucleotides bearing unprotected internucleosidic phosphate moieties

The coupling of 2-cyanoethyl thymidine phosphoramidite to solid-support-bound, phosphate-unprotected oligothymidylates and their phosphorothioate analogues was studied. The yield of the coupling reaction depended on the pK(BH)()+ values of protonated nitrogen bases that served as counterions to the phosphodiester functions of oligonucleotides. To maximize the coupling efficiency, the oligonucleotides were detritylated and washed with a mixture of 0.1 M DMAP and 0.1 M 1H-tetrazole, which resulted in a 98+% coupling efficiency. The utility of the results was demonstrated in the preparation of oligonucleotides with a mixed backbone that required the successive use of H-phosphonate and phosphoramidite methods of synthesis. Using this approach, 20-mer antisense oligonucleotides containing 2'-O-(2-methoxyethyl) ribonucleoside residues and phosphorothioate and phosphoramidate internucleosidic linkages were synthesized in high yield.     

Synthesis and analysis of RNA containing 6-trifluoromethylpurine ribonucleoside

We report the synthesis of a 5'-DMT-2'-TBDMS-protected phosphoramidite of 6-trifluoromethylpurine ribonucleoside ((TFM)P) and its use in the site-specific incorporation of 6-trifluoromethylpurine into RNA. Properties of (TFM)P-substituted RNA suggest it will be valuable in the study of RNA structure and the binding of RNA-modifying enzymes, particularly the RNA-editing adenosine deaminases. Reaction: see text.     

Synthesis of 2'-N-methylamino-2'-deoxyguanosine and 2'-N,N-dimethylamino-2'-deoxyguanosine and their incorporation into RNA by phosphoramidite chemistry

The 2'-hydroxyl groups within RNA contribute in essential ways to RNA structure and function. Previously, we designed an atomic mutation cycle (AMC) that uses ribonucleoside analogues bearing different C-2'-substituents, including -OCH(3), -NH(2), -NHMe, and -NMe(2), to identify hydroxyl groups within RNA that donate functionally significant hydrogen bonds. To enable AMC analysis of the nucleophilic guanosine cofactor in the Tetrahymena ribozyme reaction and at other guanosines whose 2'-hydroxyl groups impart critical functional contributions, we describe here the syntheses of 2'-methylamino-2'-deoxyguanosine (G(NHMe)) and 2'-N,N-dimethylamino-2'-deoxyguanosine (G(NMe(2))) and their corresponding phosphoramidites. The key step in obtaining the nucleosides involved S(N)2 displacement of 2'-β-triflate from an appropriate guanosine derivative by methylamine or dimethylamine. We readily obtained the G(NMe(2)) phosphoramidite and incorporated it into RNA. However, the G(NHMe) phosphoramidite posed a significantly greater challenge due to lack of a suitable -2'-NHMe protecting group. After testing several strategies, we established that allyloxycarbonyl (Alloc) provided suitable protection for 2'-N-methylamino group during the phosphoramidite synthesis and the subsequent RNA synthesis. This work enables AMC analysis of guanosine's 2'-hydroxyl group within RNA.     

2-(4-Tolylsulfonyl)ethoxymethyl (TEM)-a new 2'-OH protecting group for solid-supported RNA synthesis

The 2-(4-tolylsulfonyl)ethoxymethyl (TEM) as a new 2'-OH protecting group is reported for solid-supported RNA synthesis using phosphoramidite chemistry. The usefulness of the 2'-O-TEM group is exemplified by the synthesis of 12 different oligo-RNAs of various sizes (14-38 nucleotides long). The stepwise coupling yield varied from 97-99% with an optimized coupling time of 120 s. The synthesis of all four pure phosphoramidite building blocks is also described. Two new reliable parameters, delta(C2')-delta(C3') and delta(H2')-delta(H3'), have been suggested for the characterization of isomeric 2'-O-TEM and 3'-O-TEM as well as other isomeric mono 2'/3'-protected ribonucleoside derivatives. The most striking feature of this strategy is that the crude RNA prepared using our 2'-O-TEM strategy is sufficiently pure (>90%) for molecular biology research without any additional purification step, thereby making oligo-RNAs easily available at a relatively low cost, saving both time and lab resources.     

Synthesis of Phospholipid?Ribavirin Conjugates

New conjugates of antiviral nucleoside Ribavirin (=1‐(β‐D ‐ribofuranosyl)‐1H‐1,2,4‐triazole‐3‐carboxamide; 1 ) with 1,2‐ and 1,3‐diacyl glycerophosphates have been synthesized by the phosphoramidite method. A combination of 2′,3′‐phenylboronate protecting group for the sugar moiety of the ribonucleoside 1 and 2‐cyanoethyl protection for the phosphate fragment ensured the preparation of the desired compounds with reasonable yields via a small number of synthetic steps.     

Phosphonate-free phosphorylation of alcohols using bis-(tert-butyl) phosphoramidite with imidazole·hydrochloride and imidazole as the activator

A variety of commercially available alcohols were converted to their bis-(tert-butyl) protected mono-phosphate pro-drugs. The improved procedure uses the unique combination of imidazole·hydrochloride and imidazole as the activator to suppress the formation of undesired phosphonate by-product frequently encountered with the bis-(tert-butyl) phosphoramidite reagents. The new activation procedure eliminates the need to use excess reagents.     

Acid/azole complexes as highly effective promoters in the synthesis of DNA and RNA oligomers via the phosphoramidite method

The utility of various kinds of acid salts of azole derivatives as promoters for the condensation of a nucleoside phosphoramidite and a nucleoside is investigated. Among the salts, N-(phenyl)imidazolium triflate, N-(p-acetylphenyl)imidazolium triflate, N-(methyl)benzimidazolium triflate, benzimidazolium triflate, and N-(phenyl)imidazolium perchlorate have shown extremely high reactivity in a liquid phase. These reagents serve as powerful activators of deoxyribonucleoside 3'-(allyl N,N-diisopropylphosphoramidite)s or 3'-(2-cyanoethyl N,N-diisopropylphosphoramidite)s employed in the preparation of deoxyribonucleotides, and 3'-O-(tert-butyldimethylsilyl)ribonucleoside 2'-(N,N-diisopropylphosphoramidite)s or 2'-O-(tert-butyldimethylsilyl)ribonucleoside 3'-(N,N-diisopropylphosphoramidite)s used for the formation of 2'-5' and 3'-5' internucleotide linkages between ribonucleosides, respectively. The azolium salt has allowed smooth and high-yield condensation of the nucleoside phosphoramidite and a 5'-O-free nucleoside, in which equimolar amounts of the reactants and the promoter are employed in the presence of powdery molecular sieves 3A in acetonitrile. It has been shown that some azolium salts serve as excellent promoters in the solid-phase synthesis of oligodeoxyribonucleotides and oligoribonucleotides. For example, benzimidazolium triflate and N-(phenyl)imidazolium triflate can be used as effective promoters in the synthesis of an oligodeoxyribonucleotide, (5')CGACACCCAATTCTGAAAAT(3') (20mer), via a method using O-allyl/N-allyloxycarbonyl-protected deoxyribonucleoside 3'-phosphoramidites or O-(2-cyanoethyl)/N-phenoxyacetyl-protected deoxyribonucleotide 3'-phosphoramidite as building blocks, respectively, on high-cross-linked polystyrene resins. Further, N-(phenyl)imidazolium triflate is useful for the solid-phase synthesis of oligoribonucleotides, such as (5')AGCUACGUGACUACUACUUU(3') (20mer), according to an allyl/allyloxycarbonyl-protected strategy. The utility of the azolium promoter has been also demonstrated in the liquid-phase synthesis of some biologically important substances, such as cytidine-5'-monophosphono-N-acetylneuraminic acid (CMP-Neu5Ac) and adenylyl(2'-5')adenylyl(2'-5')adenosine (2-5A core).     

Convenient Synthesis of Nucleoside‐5′‐Diphosphates from the Corresponding Ribonucleoside‐5′‐phosphoroimidazole

The reaction of ribonucleoside‐5′‐phosphoroimidazolide with a tributylammonium orthophosphate in anhydrous dimethylformamide at room temperature provides a general method for the synthesis of nucleoside‐5′‐diphosphates. The novelty of the approach is to use the triethylammonium salt of 5′‐monophosphate nucleoside derivative prior to the imidazolate reaction with imidazole, triphenylphosphine, and 2,2′‐dithiodipyridine. Deprotection, followed by displacement of the imidazole moiety using tributylammonium orthophosphate and a catalytic amount of zinc chloride in dimethylformamide gave the desired 5′‐diphosphate products. The triethyl ammonium salt of 5′‐diphosphate nucleosides was purified by flash chromatography using DEAE (diethylaminoethyl weak anion exchange resin) Sepharosa fast flow packed in an XK 50/60 column on an Akta FPLC (Fast Protein Liquid Chromatography). Synthesis procedures are reported for adenosine‐5′‐diphosphate, uridine‐5′‐diphosphate, cytidine‐5′‐diphosphate, and guanosine‐5′‐diphosphate. Yields for the displacement reactions ranged from 95 to 97%. Thus, this method offers the advantages of shorter reaction time, greater product yield, and a more cost‐effective synthetic route.     

Synthesis of 2'-O-[2-(N-methylcarbamoyl)ethyl]ribonucleosides using oxa-Michael reaction and chemical and biological properties of oligonucleotide derivatives incorporating these modified ribonucleosides

To develop oligonucleotides containing new 2'-O-modified ribonucleosides as nucleic acid drugs, we synthesized three types of ribonucleoside derivatives modified at the 2'-hydroxyl group with 2-(methoxycarbonyl)ethyl (MOCE), 2-(N-methylcarbamoyl)ethyl (MCE), and 2-(N,N-dimethylcarbamoyl)ethyl (DMCE) groups, as key intermediates, via the oxa-Michael reaction of the appropriately protected ribonucleoside (U, C, A, and G) derivatives. Among them, the 2'-O-MCE ribonucleosides were found to be the most stable under basic conditions. To study the effects of the 2'-O-modification on the nuclease resistance of oligonucleotides incorporating the 2'-O-modified ribonucleosides and their hybridization affinities for the complementary RNA and DNA strands, 2'-O-MCE-ribonucleoside phosphoramidite derivatives were successfully synthesized and subjected to the synthesis of 2'-O-MCE-oligonucleotides and 2'-O-methyl-oligonucleotides incorporating 2'-O-MCE-ribonucleosides. The 2'-O-MCE-oligonucleotides and chimeric oligomers with 2'-O-MCE and 2'-O-methyl groups thus obtained demonstrated complementary RNA strands and much higher nuclease resistances than the corresponding 2'-O-methylated species. Finally, we incorporated the 2'-O-MCE-ribonucleosides into antisense 2'-O-methyl-oligoribonucleotides to examine their exon-skipping activities in splicing reactions related to pre-mRNA of mouse dystrophin. The exon-skipping assay of these 2'-O-methyl-oligonucleotide incorporating 2'-O-MCE-uridines showed better efficacies than the corresponding 2'-O-methylated oligoribonucleotide phosphorothioate derivatives.     

Recent application of acidic 1,3-azolium salts as promoters in the solution-phase synthesis of nucleosides and nucleotides

Acidic 1,3-azolium salts are prepared from Brønsted acids and 1,3-azoles such as imidazole, thiazole, and oxazole. Acidic imidazolium salts are frequently employed as promoters for the synthesis of nucleotides using the phosphoramidite method in a solution phase. Recently, it was revealed that thiazolium and oxazolium salts catalyzed Vorbrüggen-type N-glycosylation reactions to give nucleosides. These reactivities are attributed to the stronger Brønsted acidities of the thiazolium and oxazolium salts relative to those of the imidazolium salts. This digest focuses on recent progress in the applicability of acidic 1,3-azolium salts as promoters in the solution-phase synthesis of nucleosides and nucleotides.     

Synthesis,Molecular Recognition,and Enzymology of Oligonucleotides Containing the Non-standard Base Pair between 5-Aza-7-deazaisoguanine and 6-Amino-3-methylpyrazin-2(1H)-one,a Donor-Acceptor-Acceptor Purine Analog and an Acceptor-Donor-Donor Pyrimidine Analog

A 6-aminopyrazin-2(1H)-one (pyADD), when incorporated as a pyrimidine-base analog into an oligonucleotide chain, presents a H-bond acceptor-donor-donor pattern to 5-aza-7-deazaisoguanine (puDAA), the complementrary donor-acceptor-acceptor purine analog. Reported here are the syntheses of the phosphoramidite of the 2′-deoxyribonucleoside bearing the puDAA base, oligonucleotides containing this nucleoside unit, the enzyme-assisted synthesis of oligoribonucleotides containing the pyADD ribonucleoside, and the molecular-recognition properties of this non-standard base pair in an oligonucleotide context. A series of melting experiments suggests that the pyADD · puDAA base pair contributes to the relative stability of a duplex structure approximately the same as an A · T base pair, and significantly more than mismatches between these non-standard bases and certain standard nucleobases. The pyADD nucleoside bisphosphate is accepted by T4 RNA ligase, but the triphosphate of the pyADD nucleoside was not incorported by T7 RNA polymerase opposite the puDAA nucleobase in a template. Oligonucleotides containing the pyADD base slowly undergo a reversible first-order reaction, presumably an epimerization process to give the α-D -anomer. These experiments provide the tools for laboratory-based use of the pyADD · puDAA base pair as a component of an oligonucleotide-like molecular-recognition system based on an expanded genetic alphabet.     

The Mechanism of Nonenzymatic Template Copying with Imidazole‐Activated Nucleotides

The emergence of the replication of RNA oligonucleotides was a critical step in the origin of life. An important model for the study of nonenzymatic template copying, which would be a key part of any such pathway, involves the reaction of ribonucleoside‐5′‐phosphorimidazolides with an RNA primer/template complex. The mechanism by which the primer becomes extended by one nucleotide was assumed to be a classical in‐line nucleophilic‐substitution reaction in which the 3′‐hydroxyl of the primer attacks the phosphate of the incoming activated monomer with displacement of the imidazole leaving group. Surprisingly, this simple model has turned out to be incorrect, and the dominant pathway has now been shown to involve the reaction of two activated nucleotides with each other to form a 5′–5′‐imidazolium bridged dinucleotide intermediate. Here we review the discovery of this unexpected intermediate, and the chemical, kinetic, and structural evidence for its role in template copying chemistry.     

Asymmetric Ir-catalyzed hydrogenation of 1,5-benzodiazepinones using mixtures of ligands

The catalytic hydrogenation of benzodiazepinones using metal complexes with phosphite and phosphoramidite ligands was carried out for the first time. The mixed-ligand catalytic systems containing a chiral phosphoramidite or phosphite in combination with an achiral phosphine were shown to exhibit a higher enantioselectivity compared to catalysts containing homocombinations of chiral ligands.     

Synthesis of selenium-derivatized cytidine and oligonucleotides for X-ray crystallography using MAD

Synthesis of the novel 2'-Se-cytidine phosphoramidite was achieved via transformation of the uridine analogue to the cytidine derivative in high yield. This 2'-Se-cytidine phosphoramidite was used to synthesize selenium-derivatized DNA and RNA oligonucleotides for X-ray crystallography using MAD. The nucleotide coupling yield using this novel phosphoramidite was over 99% when 5-benzylmercaptotetrazole (5-BMT) was used as the coupling reagent.