Interaction of Zn(II) with quinolone drugs: structure and biological evaluation

Zinc complexes with the third-generation quinolone antibacterial drugs levofloxacin and sparfloxacin have been synthesized and characterized. The deprotonated quinolones act as bidentate ligands coordinated to zinc ion through the pyridone and a carboxylato oxygen atom. The crystal structures of [bis(aqua)bis(levofloxacinato)zinc(II)], 1, and [bis(sparfloxacinato)(1,10-phenanthroline)zinc(II)], 3, have been determined by X-ray crystallography. The biological activity of the complexes has been evaluated by examining their ability to bind to calf-thymus DNA (CT DNA) by UV spectroscopy and viscosity measurements. UV studies of the interaction of the complexes with DNA have revealed that they can bind to CT DNA probably by the intercalative binding mode which has also been verified by DNA solution viscosity measurements. The DNA binding constants have been also calculated. A competitive study with ethidium bromide (EB) showed that the complexes exhibit the ability to displace the DNA-bound EB indicating that they bind to DNA in strong competition with EB for the intercalative binding site. The interaction of the complexes with human and bovine serum albumin proteins has been studied by fluorescence spectroscopy showing that the complexes exhibit good binding propensity to these proteins having relatively high binding constant values. The biological properties of the complexes have been evaluated in comparison to the previously reported Zn(II) complexes with the first- and second-generation quinolones oxolinic acid and enrofloxacin.     

Structure and DNA-binding properties of bis(quinolonato)bis(pyridine)zinc(II) complexes

The novel neutral mononuclear zinc complexes with the quinolone antibacterial drugs enrofloxacin and oxolinic acid in the presence of the nitrogen donor heterocyclic ligand pyridine have been synthesized and characterized. The experimental data suggest that the quinolone ligands are on the deprotonated mode acting as bidentate ligands coordinated to the zinc(II) ion through the ketone oxygen and a carboxylato oxygen. The crystal structure of the complex bis(enrofloxacinato)bis(pyridine)zinc(II), 1, has been determined with X-ray crystallography. The biological activity of the complexes has been evaluated by examining their ability to bind to calf-thymus DNA (CT-DNA) with UV and fluorescence spectroscopies. UV spectroscopic titration studies of the interaction of the complexes with DNA have shown that they can bind to CT-DNA and the DNA binding constants have been calculated. Competitive studies with ethidium bromide (EB) have shown that the complexes exhibit the ability to displace the DNA-bound EB indicating that they can bind to DNA in strong competition with EB for the intercalative binding site.     

Structure,cyclic voltammetry and DNA-binding properties of the bis(pyridine)bis(sparfloxacinato)nickel(II) complex

The neutral mononuclear nickel(II) complex with the quinolone third-generation antibacterial drug sparfloxacin in the presence of the nitrogen-donor heterocyclic ligand pyridine has been synthesized and characterized. Sparfloxacin is deprotonated acting as a bidentate ligand coordinated to the Ni(II) ion through the ketone oxygen and a carboxylato oxygen. The crystal structure of bis(sparfloxacinato)bis(pyridine)nickel(II), 1, has been determined with X-ray crystallography. The cyclic voltammograms of the complex have been recorded in dmso solution and in 1/2 dmso/buffer (containing 150 mM NaCl and 15 mM trisodium citrate at pH 7.0) solution and the corresponding redox potentials have been estimated. The biological activity of the complex has been evaluated by examining its ability to bind to calf-thymus DNA (CT DNA) with UV and fluorescence spectroscopies and cyclic voltammetry. UV study of the DNA-interaction of the complex has shown that it can bind to CT DNA and the DNA-binding constant has also been calculated. The cyclic voltammograms of the complex in the presence of CT DNA have shown that the complex can bind to CT DNA by the intercalative mode. Competitive study with ethidium bromide (EB) has shown that the complex can displace the DNA-bound EB indicating that the complex binds to DNA in strong competition with EB for the intercalative binding site.     

Structures and DNA-binding and cleavage properties of ternary copper(II) complexes of glycine with phenanthroline, bipyridine, and bipyridylamine

The crystal structures of the series of three complexes, [Cu(Gly)(bpy)Cl].2H2O (1) (Gly=glycine; bpy=2,2'-bipyridine), [Cu(Gly)(phen)Cl]2.7H2O (2) (phen=1,10-phenanthroline), and [Cu(Gly)(bpa)(H2O)Cl] (3) (bpa=2,2'-bipyridylamine) were determined, and the coordination modes of Cu(II) ternary complexes were compared. The central Cu(II) atoms of complexes 1 and 3 have a similar distorted octahedral coordination geometry, while the Cu(II) atom of complex 2 has a distorted square pyramidal coordination. In all complexes, the aromatic heterocyclic compounds bpy, phen, and bpa, behave as a bidentate N,N' ligand, and Gly behaves as a bidentate N,O ligand. DNA-binding properties of the complexes to calf thymus (CT) DNA were studied by using the fluorescence method. Each of the complexes showed binding propensity to CT DNA with the relative order 2>3> or =1. DNA cleavage studies indicate that each of the complexes, especially 2, can cleave plasmid supercoiled pBR322 DNA in the presence of H2O2 and ascorbic acid with cleavage efficiency in the order 2>3 approximately 1. The degradation of the conformation of CT DNA by the complexes was also reflected in the decrease in the intensities of the characteristic CD bands with the relative order 2>3 approximately 1.     

Structures and interaction with DNA of ternary palladium(II) complexes: [Pd(Gly)(X)] (Gly=glycine; X=2,2'-bipyridine, 1,10-phenanthroline and 2,2'-bi-pyridylamine)

The structures of the ternary palladium(II) complexes of the formulations [Pd(Gly)(bpy)](+)Cl(-).4H(2)O (Gly=glycine; bpy=2,2'-bipyridine) (1), [Pd(Gly)(phen)](+)Cl(-).4H(2)O (2) (phen=1,10-phenanthroline) and {[Pd(Gly)(bpa)](+)Cl(-)}(2).6H(2)O (3) (bpa=2,2'-bipyridylamine) were determined. All complexes are positively charged and neutralized by the chloride anion located nearby the complexes. The central Pd(II) atoms of the complexes 1, 2 and 3 have a similar distorted square planar coordination geometry, in which each Pd(II) atom is coordinated to two N atoms of the bidentate heterocyclic ligand, and N and O atoms of the bidentate glycine ligand. The interaction of the complexes with calf thymus (CT) DNA was also studied using the fluorescence method. All complexes showed the inhibition of ethidium bromide binding to CT DNA, and the DNA-binding strengths were reflected as the relative order 2>1>3. The remarkable reduction of UV absorption intensity of 2 caused in the presence of DNA suggests the presence of pi-pi stacking interaction between the heterocyclic ring of the phen ligand and nucleobases. The intercalative DNA-binding of 2 is suggested by UV and CD measurements. DNA cleavage studies indicated that the cleavage of the plasmid supercoiled pBR322 DNA in the presence of H(2)O(2) and ascorbic acid could be enhanced by the complexes.     

Characterization and biological activities of two copper(II) complexes with diethylenetriamine and 2,2'-bipyridine or 1,10-phenanthroline as ligands

Two new mixed ligand copper(II) complexes with diethylenetriamine, 2,2'-bipyridine and 1,10-phenanthroline have been synthesized. The crystal and molecular structures of [Cu(dien)(phen)](ClO(4))(2) and [Cu(dien)(bipy)](BF(4))(2) (dien=diethylenetriamine, phen=1,10-phenanthroline, bipy=2,2'-bipyridine) were determined by X-ray crystallography from single crystal data. These two complexes have similar structures. The EPR spectral data also suggest that these complexes have distorted square pyramidal geometry about copper(II). Anti-microbial and superoxide dismutase activities of these complexes have also been measured. They show the higher SOD activity than the corresponding simple Cu(II)-dien/Cu(II)-PMDT (PMDT=N,N,N',N',N'-pentamethyldiethylenetriamine) complexes because of a strong axial bond of one of the nitrogen atoms of the alpha-diimine. Both the complexes have been found to cleave plasmid DNA in the presence of co-reductants such as ascorbic acid and glutathione.     

Ultraviolet spectrophotometric characterization of copper(II) complexes with imidazole N-methyl derivatives of L-histidine in aqueous solution

In this study we considered pi-methyl-L-histidine (pi-methis) and tau-methyl-L-histidine (tau-methis) as ligands for copper(II) ion, in order to clarify, by means of ultraviolet (UV) spectroscopy in aqueous solution (T = 25 degrees C, I = 0.1 M), some aspects of the co-ordination mode with respect to other ligands of a previous study in which copper(II) complexes of L-histidine, N-acetyl-L-histidine, histamine, L-histidine methyl ester or carnosine were investigated. Particularly, UV spectra (300-400 nm) were recorded on solutions at various pH values, containing each binary system Cu-L; afterwards, an UV absorption spectrum for single complexes was calculated, taking into account the chemical model previously assessed, in order to fulfil a correct spectrum-structure correlation. The problem related to the eventual superimposition of the CT shoulder (approximately 330 nm) to copper(II) of OH- and imidazole pyridine nitrogen groups were now solved by means of a comparison of the UV spectra of dimer species formed by both pi-methis or tau-methis. Finally, copper(II) complex formation with 2,2'-bipyridine was taken into account to compare the behaviour of pyridine (from 2,2'-bipyridine) and pyridine imidazole nitrogens (from pi-methis or tau-methis) with respect to the UV charge transfer process to copper(II) ion.     

Synthesis, characterization, DNA binding and cytotoxic studies of platinum(II) and palladium(II) complexes of the 2,2'-bipyridine and an anion of 1,1-cyclobutanedicarboxylic acid.

Two neutral complexes of formula [M(bpy)(cbdca)] [where M is palladium(II) (Pd(II)) or platinum(II) (Pt(II)), bpy is 2,2'-bipyridine and cbdca is anion of 1,1-cyclobutanedicarboxylic acid] have been synthesized. These water soluble complexes have been characterized by chemical analysis and conductivity measurements as well as 1H-NMR, ultraviolet-visible and infrared spectroscopy. In these complexes the ligand cbdca coordinates to Pt(II) or Pd(II) as bidentate with two oxygen atoms. They are nonelectrolyte in conductivity water. These complexes inhibit the growth of P388 lymphocytic leukemia cells and their targets are DNA. They invariably show ID50 values less than cisplatin. [Pt(bpy)(cbdca)] and [Pd(bpy)(cbdca)] have been interacted with calf thymus DNA and bind to DNA through coordinate covalent bond. In addition, the influence of binding of these complexes on the intensity of EtBr-DNA have been studied. They bind to DNA via a nonintercalating mode.     

Mechanistic investigation of CO2 hydrogenation by Ru(II) and Ir(III) aqua complexes under acidic conditions: two catalytic systems differing in the nature of the rate determining step

Ruthenium aqua complexes [(eta(6)-C(6)Me(6))Ru(II)(L)(OH(2))](2+) {L = bpy (1) and 4,4'-OMe-bpy (2), bpy = 2,2'-bipyridine, 4,4'-OMe-bpy = 4,4'-dimethoxy-2,2'-bipyridine} and iridium aqua complexes [Cp*Ir(III)(L)(OH(2))](2+) {Cp* = eta(5)-C(5)Me(5), L = bpy (5) and 4,4'-OMe-bpy (6)} act as catalysts for hydrogenation of CO(2) into HCOOH at pH 3.0 in H(2)O. The active hydride catalysts cannot be observed in the hydrogenation of CO(2) with the ruthenium complexes, whereas the active hydride catalysts, [Cp*Ir(III)(L)(H)](+) {L = bpy (7) and 4,4'-OMe-bpy (8)}, have successfully been isolated after the hydrogenation of CO(2) with the iridium complexes. The key to the success of the isolation of the active hydride catalysts is the change in the rate-determining step in the catalytic hydrogenation of CO(2) from the formation of the active hydride catalysts, [(eta(6)-C(6)Me(6))Ru(II)(L)(H)](+), to the reactions of [Cp*Ir(III)(L)(H)](+) with CO(2), as indicated by the kinetic studies.     

First palladium(II) and platinum(II) complexes from employment of 2,6-diacetylpyridine dioxime: synthesis, structural and spectroscopic characterization, and biological evaluation

Employment of the monoanion of 2,6-diacetylpyridine dioxime (dapdoH(2)) as a tridentate chelate in palladium(II) and platinum(II) chemistry is reported. The syntheses, crystal structures, spectroscopic and physicochemical characterization, and biological evaluation are described of [PdCl(dapdoH)] (1) and [PtCl(dapdoH)] (2). Reaction of PdCl(2) with 2 equivs of dapdoH(2) in MeOH under reflux gave 1, whereas the same reaction with PtCl(2) in place of PdCl(2) gave 2 in comparable yields (70-80%). The divalent metal center in both compounds is coordinated by a terminal chloro group and a N,N',N"-tridentate chelating (η(3)) dapdoH(-) ligand. Thus, each metal ion is four coordinate with a distorted square planar geometry. Characterization of both complexes with (1)H and (13)C NMR and UV-vis and electrospray ionization mass spectroscopies confirmed their integrity in DMSO solutions. Interaction of the complexes with human and bovine serum albumin has been studied with fluorescence spectroscopy, revealing their affinity for these proteins with relatively high values of binding constants. UV study of the interaction of the complexes with calf-thymus DNA (CT DNA) has shown that they can bind to CT DNA, and the corresponding DNA binding constants have been evaluated. Cyclic voltammograms of the complexes in the presence of CT DNA solution have shown that the interaction of the complexes with CT DNA is mainly through intercalation, which has been also shown by DNA solution viscosity measurements. Competitive studies with ethidium bromide (EB) have revealed the ability of the complexes to displace the DNA-bound EB, suggesting competition with EB. The combined work demonstrates the ability of pyridyl-dioxime chelates not only to lead to polynuclear 3d-metal complexes with impressive structural motifs and interesting magnetic properties but also to yield new, mononuclear 4d- and 5d-metal complexes with biological implications.     

Electron donor-acceptor dyads based on ruthenium(II) bipyridine and terpyridine complexes bound to naphthalenediimide

Two series of photosensitizer-electron acceptor complexes have been synthesized and fully characterized: ruthenium(II) tris(bipyridine) ([Ru(II)(bpy)(2)(bpy-X-NDI)], where X = -CH(2)-, tolylene, or phenylene, bpy is 2,2'-bipyridine, and NDI is naphthalenediimide) and ruthenium(II) bis(terpyridine) ([Ru(II)(Y-tpy)(tpy-X-NDI)], where Y = H or tolyl and X = tolylene or phenylene, and tpy = 2,2':6',2' '-terpyridine). The complexes have been studied by cyclic and differential pulse voltammetry and by steady state and time-resolved absorption and emission techniques. Rates for forward and backward electron transfer have been investigated, following photoexcitation of the ruthenium(II) polypyridine moiety. The terpyridine complexes were only marginally affected by the linked diimide unit, and no electron transfer was observed. In the bipyridine complexes we achieved efficient charge separation. For the complexes containing a phenyl link between the ruthenium(II) and diimide moieties, our results suggest a biphasic forward electron-transfer reaction, in which 20% of the charge-separated state was formed via population of the naphthalenediimide triplet state.     

Bridged bis(beta-cyclodextrin)s possessing coordinated metal center(s) and their inclusion complexation behavior with model substrates: enhanced molecular binding ability by multiple recognition.

To investigate quantitatively the cooperative binding ability of several beta-cyclodextrin oligomers bearing single or multiligated metal center(s), the inclusion complexation behavior of four bis(beta-cyclodextrin)s (2-5) linked by 2,2'-bipyridine-4,4'-dicarboxy tethers and their copper(II) complexes (6-9) with representative dye guests, i.e., methyl orange (MO), acridine red (AR), rhodamine B (RhB), ammonium 8-anilino-1-naphthalenesulfonic acid (ANS), and sodium 6-(p-toludino)-2-naphthalenesulfonate (TNS), have been examined in aqueous solution at 25 degrees C by means of UV-vis, circular dichroism, fluorescence, and 2D NMR spectroscopy. The results obtained indicate that bis(beta-cyclodextrin)s 2-5 can associate with one or three copper(II) ion(s) producing 2:1 or 2:3 bis(beta-cyclodextrin)-copper(II) complexes. These metal-ligated oligo(beta-cyclodextrin)s can bind two model substrates to form intramolecular 2:2 host-guest inclusion complexes and thus significantly enhance the original binding abilities of parent beta-cyclodextrin and bis(beta-cyclodextrin) toward model substrates through the cooperative binding of two guest molecules by four tethered cyclodextrin moieties, as well as the additional binding effect supplied by ligated metal center(s). Host 6 showed the highest enhancement of the stability constant, up to 38.3 times for ANS as compared with parent beta-cyclodextrin. The molecular binding mode and stability constant of substrates by bridged bis- and oligo(beta-cyclodextrin)s 2-9 are discussed from the viewpoint of the size/shape-fit interaction and molecular multiple recognition between host and guest.     

New pyrazolino- and pyrrolidino[60]fullerenes with transition-metal chelating pyridine substitutents: synthesis and complexation to Ru(II)

Three pyridine-substituted fullerene adducts, bis(2,2'-bipyridine)(2'-phenyl-5'-(2-pyridinyl)-2'H-[5,6]fullereno(C(60)-I(h))[1,9]pyrazole)ruthenium-bis(hexafluorophosphate) (1), bis(2,2'-bipyridine)(2'-phenyl-5'-(4-(4'-methyl-2,2'-bipyridinyl))-2'H-[5,6]fullereno(C(60)-I(h))[1,9]pyrazole)ruthenium-bis(hexafluorophosphate) (2), and bis(2,2'-bipyridine)(1',5'-dihydro-3'-methyl-2'-(4-(4'-methyl-2,2'-bipyridinyl))-2'H-[5,6]fullereno(C(60)-I(h))[1,9]pyrrole)ruthenium-bis(hexafluorophosphate) (3), have been prepared. The common features for these complexes are the short bridges between the fullerene and the pyridine moieties. [structure: see text]     

Inert benzothiazole functionalised ruthenium(II) complexes; potential DNA hairpin binding agents

The two enantiomers of [Ru(bpy)2(bbtb)]2+{bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the Lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+{Me(2)bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association with hairpin oligonucleotides, again with the Lambda enantiomer binding more strongly. A (1)H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.     

Organoplatinum(IV) tris-chelate complexes, each having a cyclic metallacarbonate ring: synthesis, characterization and kinetic studies of the formation

The complexes [Pt[(CH2)4](NN)], 1a (NN = 2,2'-bipyridine) and 1b (NN = 1,10-phenanthroline) react with 2,3-epoxypropylphenyl ether in the presence of CO2 to give tris-chelate platina(IV)cyclopentane complexes characterized by 1H and 13C NMR spectroscopy as [Pt[(CH2)4](CH2CHCH2OPhOCO2)(NN)], 2. The reactions proceed by the SN2 mechanism and the rates were independent of concentration of CO2. It is demonstrated that for 1a, the reaction proceeds 2.32 times faster than the similar reaction in which the dimethyl analog, [PtMe2(2,2'-bipyridine)], is used. The analog tris-chelate complex [Pt[(CH2)4](CH2CHPhOCO2)(phen)], 3a, was similarly synthesized.     

Metal-assisted red light-induced DNA cleavage by ternary L-methionine copper(II) complexes of planar heterocyclic bases

Ternary copper(II) complexes [Cu(l-met)B(Solv)](ClO4) (1-4), where B is a N,N-donor heterocyclic base like 2,2'-bipyridine (bpy, 1), 1,10-phenanthroline (phen, 2), dipyrido[3,2-d:2',3'-f]quinoxaline (dpq, 3) and dipyrido[3,2-a:2'],3'-c]phenazene (dppz, 4), are prepared and their DNA binding and photo-induced DNA cleavage activity studied (L-Hmet =L-methionine). Complex 2, structurally characterized by X-ray crystallography, shows a square pyramidal (4 + 1) coordination geometry in which the N,O-donor L-methionine and N,N-donor heterocyclic base bind at the basal plane and a solvent molecule is coordinated at the axial site. The complexes display a d-d band at approximately 600 nm in DMF and exhibit a cyclic voltammetric response due to the Cu(II)/Cu(I) couple near -0.1 V in DMF-Tris-HCl buffer. The complexes display significant binding propensity to the calf thymus DNA in the order: 4(dppz) > 3(dpq) > 2(phen> 1(bpy). Control cleavage experiments using pUC19 supercoiled DNA and distamycin suggest major groove binding for the dppz and minor groove binding for the other complexes. Complexes 2-4 show efficient DNA cleavage activity on UV (365 nm) or red light (632.8 nm) irradiation via a mechanistic pathway involving formation of singlet oxygen as the reactive species. The DNA cleavage activity of the dpq complex is found to be significantly more than its dppz and phen analogues.     

Ruthenium(II) complexes containing bis(2-(diphenylphosphino)phenyl) ether and their catalytic activity in hydrogenation reactions

The half-sandwich complexes [(eta5-C5H5)RuCl(DPEphos)] (1) and [{(eta6-p-cymene)RuCl2}2(mu-DPEphos)] (2) were synthesized by the reaction of bis(2-(diphenylphosphino)phenyl) ether (DPEphos) with a mixture of ruthenium trichloride trihydrate and cyclopentadiene and with [(eta6-p-cymene)RuCl2]2, respectively. Treatment of DPEphos with cis-[RuCl2(dmso)4] afforded fac-[RuCl2(kappa3-P,O,P-DPEphos)(dmso)] (3). The dmso ligand in 3 can be substituted by pyridine, 2,2'-bipyridine, 4,4'-bipyridine, and PPh3 to yield trans,cis-[RuCl2(DPEphos)(C5H5N)2] (4), cis,cis-[RuCl2(DPEphos)(2,2'-bipyridine)] (5), trans,cis-[RuCl2(DPEphos)(mu-4,4'-bipyridine)]n (6), and mer,trans-[RuCl2(kappa3-P,P,O-DPEphos)(PPh3)] (7), respectively. Refluxing [(eta6-p-cymene)RuCl2]2 with DPEphos in moist acetonitrile leads to the elimination of the p-cymene group and the formation of the octahedral complex cis,cis-[RuCl2(DPEphos)(H2O)(CH3CN)] (8). The structures of the complexes 1-5, 7, and 8 are confirmed by X-ray crystallography. The catalytic activity of these complexes for the hydrogenation of styrene is studied.     

Coordination properties of a diarylaza crown ether appended with a luminescent [Ru(bipy)3]2+ unit

The [Ru(bipy)(2)(1)](PF(6))(2) (bipy refers to 2,2'-bipyridine) complex, comprising a ruthenium(II) tris(2,2'-bipyridine) luminophore covalently linked to a di[(o-triethyleneglycoxy)phenyl]amine crown ether 1, has been synthesized and fully characterized. The photophysical properties of this metal complex have been examined in solution at ambient temperature. Luminescence from the metal complex is enhanced significantly in the presence of various adventitious cations, including protons. In particular, Li(+) cations bind to the crown ether, as evidenced by (1)H NMR and luminescence spectroscopy. Cation binding serves to decrease the rate of reductive quenching of the triplet state of the metal complex, thereby increasing the extent of luminescence. The solution-phase conformation of [Ru(bipy)(2)(1)](PF(6))(2), with and without encapsulated Li(+), has been examined by 2-D NMR and by molecular dynamics simulations.     

Structurally diverse copper(II)-carboxylato complexes: neutral and ionic mononuclear structures and a novel binuclear structure

The copper complexes with the commercial auxin herbicides MCPA, 2,4-D, and 2,4,5-T in the presence of a nitrogen donor heterocyclic ligand, phen or bipyam, were prepared and characterized. The available evidence supports a dimeric structure for the 2,4-D complex in the presence of bipyam while phen leads to monomeric forms. The EPR spectrum of Cu2(2,4-D)4(bipyam)2 at 4 K in the solid state exhibits an axial signal which corresponds to almost isolated S = 1/2 magnetic ions. Magnetic data for the dimer show a weak antiferromagnetic interaction between the two metal ions with J = -08 cm-1. The crystal structures of tetrakis[(2,4-dichlorophenoxy)acetato]bis(2,2'-bipyridylamine)dicopper(II), 1, bis(1,10-phenanthroline)[(2,4,5-trichlorophenoxy)acetato]copper(II) chloride, 2, and aqua(1,10-phenanthroline)bis[((2-methyl-4-chlorophenoxyacetato]copper(II), 3, were determined and refined by least-squares methods using three-dimensional MoK alpha data. 1 crystallizes in space group P1, in a cell of dimensions a = 10813(1) A, b = 12138(1) A, c = 11909(1) A, alpha = 86448(3) degrees, beta = 80127(3) degrees, and gamma = 63982(3) degrees, and V = 13837(2) A3, with Z = 1 2 crystallizes in space group I2/a, in a cell of dimensions a = 29958(9) A, b = 11342(3) A, c = 21196(7) A, beta = 10794(1) degrees, and V = 68522(4) A3, with Z = 8 3 crystallizes in space group P1, in a cell of dimensions a = 87419(8) A, b = 12512(1) A, c = 14598(1) A, alpha = 110737(1) degrees, beta = 95742(2) degrees, gamma = 103286(2) degrees, V = 14241(2) A3, with Z = 2.     

Amino acid recognition of pyridine bis(oxazoline)-copper(II) complex in aqueous solvent

Enantioselective recognition of amino acids has been studied with C₂-symmetric chiral pyridine bis(oxazoline)-copper(II) complexes at physiological pH condition. UV-visible titration revealed strong binding of submillimolar dissociation constant between pyridine bis(oxazoline)-copper(II) complex and amino acids in aqueous solution. Moderate selectivity of up to 2:1 between d- and l-amino acids was achieved. The enantiomers were baseline resolved by capillary electrophoresis, using the bis(l-lysine)-copper(II) complex as a chiral selector.