Deoxyribozymes with 2'-5' RNA ligase activity

In vitro selection was used to identify deoxyribozymes that ligate two RNA substrates. In the ligation reaction, a 2'-5' RNA phosphodiester linkage is created from a 2',3'-cyclic phosphate and a 5'-hydroxyl group. The new Mg(2+)-dependent deoxyribozymes provide 50-60% yield of ligated RNA in overnight incubations at pH 7.5 and 37 degrees C, and they afford 40-50% yield in 1 h at pH 9.0 and 37 degrees C. Various RNA substrate sequences may be joined by simple Watson-Crick covaration of the DNA binding arms that interact with the two RNA substrates. The current deoxyribozymes have some RNA substrate sequence requirements at the nucleotides immediately surrounding the ligation junction (either UAUA GGAA or UAUN GGAA, where the arrow denotes the ligation site and N equals any nucleotide). One of the new deoxyribozymes was used to prepare by ligation the Tetrahymena group I intron RNA P4-P6 domain, a representative structured RNA. Nondenaturing gel electrophoresis revealed that a 2'-5' linkage between nucleotides A233 and G234 of P4-P6 does not disrupt its Mg(2+)-dependent folding (DeltaDeltaG degrees ' < 0.2 kcal/mol). This demonstrates that a 2'-5' linkage does not necessarily interfere with structure in a folded RNA. Therefore, these non-native linkages may be acceptable in modified RNAs when structure/function relationships are investigated. Deoxyribozymes that ligate RNA should be particularly useful for preparing site-specifically modified RNAs for studies of RNA structure, folding, and catalysis.     

General deoxyribozyme-catalyzed synthesis of native 3'-5' RNA linkages

An elusive goal for nucleic acid enzymology has been deoxyribozymes that ligate RNA rapidly, sequence-generally, with formation of native 3'-5' linkages, and in preparatively useful yield. Using in vitro selection, we have identified Mg2+- and Zn2+-dependent deoxyribozymes that simultaneously fulfill all four of these criteria. The new deoxyribozymes operate under practical incubation conditions and have modest RNA substrate sequence requirements, specifically D downward arrowRA for 9DB1 and A downward arrowR for 7DE5 (D = A, G, or U; R = A or G). These requirements are comparable to those of deoxyribozymes such as 10-23 and 8-17, which are already widely used as biochemical tools for RNA cleavage. We anticipate that the 9DB1 and 7DE5 deoxyribozymes will find immediate practical application for RNA ligation.     

Rational modification of a selection strategy leads to deoxyribozymes that create native 3'-5' RNA linkages

We previously used in vitro selection to identify several classes of deoxyribozymes that mediate RNA ligation by attack of a hydroxyl group at a 5'-triphosphate. In these reactions, the nucleophilic hydroxyl group is located at an internal 2'-position of an RNA substrate, leading to 2',5'-branched RNA. To obtain deoxyribozymes that instead create linear 3'-5'-linked (native) RNA, here we strategically modified the selection approach by embedding the nascent ligation junction within an RNA:DNA duplex region. This approach should favor formation of linear rather than branched RNA because the two RNA termini are spatially constrained by Watson-Crick base pairing during the ligation reaction. Furthermore, because native 3'-5' linkages are more stable in a duplex than isomeric non-native 2'-5' linkages, this strategy is predicted to favor the formation of 3'-5' linkages. All of the new deoxyribozymes indeed create only linear 3'-5' RNA, confirming the effectiveness of the rational design. The new deoxyribozymes ligate RNA with k(obs) values up to 0.5 h(-1) at 37 degrees C and 40 mM Mg2+, pH 9.0, with up to 41% yield at 3 h incubation. They require several specific RNA nucleotides on either side of the ligation junction, which may limit their practical generality. These RNA ligase deoxyribozymes are the first that create native 3'-5' RNA linkages, which to date have been highly elusive via other selection approaches.     

Nonenzymatic, template-directed ligation of oligoribonucleotides is highly regioselective for the formation of 3'-5' phosphodiester bonds

We have found that nonenzymatic, template-directed ligation reactions of oligoribonucleotides display high selectivity for the formation of 3'-5' rather than 2'-5' phosphodiester bonds. Formation of the 3'-5'-linked product is favored regardless of the metal ion catalyst or the leaving group, and for several different ligation junction sequences. The degree of selectivity depends on the leaving group: the ratio of 3'-5'- to 2'-5'-linked products was 10-15:1 when the 5'-phosphate was activated as the imidazolide, and 60-80:1 when the 5'-phosphate was activated by the formation of a 5'-triphosphate. Comparison of oligonucleotide ligation reactions with previously characterized single nucleotide primer extension reactions suggests that the strong preference for 3'-5'-linkages in oligonucleotide ligation is primarily due to occurence of ligation within the context of an extended Watston-Crick duplex. The ability of RNA to correctly self-assemble by template-directed ligation is an intrinsic consequence of its chemical structure and need not be imposed by an external catalyst (i.e., an enzyme polymerase); RNA therefore provides a reasonable structural basis for a self-replicating system in a prebiological world.     

Trinuclear copper(II) complex showing high selectivity for the hydrolysis of 2'-5' over 3'-5' for UpU and 3'-5' over 2'-5' for ApA ribonucleotides

The cooperative action of multiple Cu(II) nuclear centers is shown to be effective and selective in the hydrolysis of 2'-5' and 3'-5' ribonucleotides. Reported herein is the specific catalysis by two trinuclear Cu(II) complexes of L3A and L3B. Pseudo first-order kinetic studies reveal that the L3A trinuclear Cu(II) complex effects hydrolysis of Up(2'-5')U with a rate constant of 28 x 10(-)(4) min(-)(1) and Up(3'-5')U with a rate constant of 0.5 x 10(-)(4) min(-)(1). The hydrolyses of Ap(3'-5')A and Ap(2'-5')A proceed with rate constants of 24 x 10(-)(4) min(-)(1) and 0.5 x 10(-)(4) min(-)(1) respectively. The L3A trinuclear Cu(II) complex demonstrates high specificity for Up(2'-5')U and Ap(3'-5')A. Similar studies with the more rigid L3B trinuclear Cu(II) complex shows no selectivity and yields lower rate constants for hydrolysis. The selectivity observed with the L3A ligand is attributed to the geometry of the ligand-bound diribonucleotide which ultimately dictates the proximity of the attacking hydroxyl and the phosphoester to a Cu(II) center for activation and subsequent hydrolysis.     

Hydrolytic reactions of guanosyl-(3',3')-uridine and guanosyl-(3',3')-(2',5'-di-O-methyluridine)

Hydrolytic reactions of guanosyl-(3',3')-uridine and guanosyl-(3',3')-(2',5'-di-O-methyluridine) have been followed by RP HPLC over a wide pH range at 363.2 K in order to elucidate the role of the 2'-hydroxyl group as a hydrogen-bond donor upon departure of the 3'-uridine moiety. Under neutral and basic conditions, guanosyl-(3',3')-uridine undergoes hydroxide ion-catalyzed cleavage (first order in [OH(-)]) of the P-O3' bonds, giving uridine and guanosine 2',3'-cyclic monophosphates, which are subsequently hydrolyzed to a mixture of 2'- and 3'-monophosphates. This bond rupture is 23 times as fast as the corresponding cleavage of the P-O3' bond of guanosyl-(3',3')-(2',5'-di-O-methyluridine) to yield 2',5'-O-dimethyluridine and guanosine 2',3'-cyclic phosphate. Under acidic conditions, where the reactivity differences are smaller, depurination and isomerization compete with the cleavage. The effect of Zn(2+) on the cleavage of the P-O3' bonds of guanosyl-(3',3')-uridine is modest: about 6-fold acceleration was observed at [Zn(2+)] = 5 mmol L(-)(1) and pH 5.6. With guanosyl-(3',3')-(2',5'-di-O-methyluridine) the rate-acceleration effect is greater: a 37-fold acceleration was observed. The mechanisms of the partial reactions, in particular the effects of the 2'-hydroxyl group on the departure of the 3'-linked nucleoside, are discussed.     

Breaking up is easy to do (if you're a DNA enzyme that cleaves RNA)

In this issue of Chemistry & Biology, Cruz et al. use in vitro selection to select deoxyribozymes that collectively cleave almost any RNA dinucleotide junction. More remarkable is the finding that the new enzymes are related to the 8-17 deoxyribozyme that cleaves AG dinucleotide junctions.     

Deoxyribozymes that synthesize branched and lariat RNA

Branched RNA molecules with a 2',5'-phosphodiester linkage are important biochemical intermediates. Lariat RNA is a particular type of branched RNA that is formed during intron splicing in vivo. Synthesis of branched and lariat RNA is challenging, and there are few general approaches that are applicable in vitro. Here we report the identification of divalent metal-dependent deoxyribozymes (DNA enzymes) that synthesize branched and lariat RNA. In vitro selection was used to obtain deoxyribozymes that selectively join an internal RNA 2'-hydroxyl with a 5'-terminal triphosphate in a convenient "binding arms" format. At least 85% yield of 2',5'-branched RNA is obtained at 37 degrees C and 20 mM Mn2+, pH 7.5 in 相似文献   

Remarkable stability of hairpins containing 2',5'-linked RNA loops.

We report here the results of a comparative study of hairpin loops that differ in the connectivity of phosphodiester linkages (3',5'- versus 2',5'-linkages). In addition, we have studied the effect of changing the stem composition on the thermodynamic stability of hairpin loops. Specifically, we constructed hairpins containing one of six stem duplex combinations, i.e., DNA:DNA ("DD"), RNA:RNA ("RR"), DNA:RNA ("DR"), 2',5'-RNA:RNA ("RR"), 2',5'-RNA:DNA ("RD"), and 2',5'-RNA:2',5'-RNA ("RR"), and one of three tetraloop compositions, i.e., 2',5'-RNA ("R"), RNA ("R"), and DNA ("D"). All hairpins contained the conserved and well-studied loop sequence 5'-...C(UUCG)G...-3' [Cheong et al. Nature 1990, 346, 680-682]. We show that the 2',5'-linked loop C(UUCG)G, i.e.,...C(3'p5')U(2'p5')U(2'p5')C(2'p5')G(2'p5')G(3'p5')..., like its "normal" RNA counterpart, forms an unusually stable tetraloop structure. We also show that the stability imparted by 2',5'-RNA loops is dependent on base sequence, a property that is shared with the regioisomeric 3',5'-RNA loops. Remarkably, we find that the stability of the UUCG tetraloop is virtually independent of the hairpin stem composition (DD, RR, RR, etc.), whereas the native RNA tetraloop exerts extra stability only when the stem is duplex RNA (R:R). As a result, the relative stabilities of hairpins with a 2',5'-linked tetraloop, e.g. ggac(UUCG)gtcc (T(m) = 61.4 degrees C), are often superior to those with RNA tetraloops, e.g. ggac(UUCG)gtcc (T(m) = 54.6 degrees C). In fact, it has been possible to observe the formation of a 2',5'-RNA:DNA hybrid duplex by linking the hybrid's strands to a (UUCG) loop. These duplexes (RD), which are not stable enough to form in an intermolecular complex [Wasner et al. Biochemistry 1998, 37, 7478-7486], were stable at room temperature (T(m) approximately 50 degrees C). Thus, 2',5'-loops have potentially important implications in the study of nucleic acid complexes where structural data are not yet available. Furthermore, they may be particularly useful as structural motifs for synthetic ribozymes and nucleic acid "aptamers".     

A new class of DNA quadruplexes formed by oligodeoxyribonucleotides containing a 3'-3' or 5'-5' inversion of polarity site

Unprecedented DNA quadruplex structures containing a 3'-3' or 5'-5' inversion of polarity site in the G-tract are presented; the quadruplexes are characterized by different elements of symmetry and glycosidic angle conformations.     

Phosphodiester cleavage of guanylyl-(3',3')-(2'-amino-2'-deoxyuridine): rate acceleration by the 2'-amino function

Hydrolytic reactions of the structural analogue of guanylyl-(3',3')-uridine, guanylyl-(3',3')-(2'-amino-2'-deoxyuridine), having one of the 2'-hydroxyl groups replaced with an amino function, have been followed by RP HPLC in the pH range 0-13 at 90 degrees C. The results are compared to those obtained earlier with guanylyl-(3',3')-uridine, guanylyl-(3',3')-(2',5'-di-O-methyluridine), and uridylyl-(3',5')-uridine. Under basic conditions (pH > 8), the hydroxide ion-catalyzed cleavage of the P-O3' bond (first-order in [OH(-)]) yields a mixture of 2'-amino-2'-deoxyuridine and guanosine 2',3'-cyclic phosphate which is hydrolyzed to guanosine 2'- and 3'-phosphates. Under these conditions, guanylyl-(3',3')-(2'-amino-2'-deoxyuridine) is 10 times less reactive than guanylyl-(3',3')-uridine. Under acidic and neutral conditions (pH 3-8), where the pH-rate profile for the cleavage consists of two pH-independent regions (from pH 3 to pH 4 and from 6 to 8), guanylyl-(3',3')-(2'-amino-2'-deoxyuridine) is considerably reactive. For example, in the latter pH range, guanylyl-(3',3')-(2'-amino-2'-deoxyuridine) is more than 2 orders of magnitude more labile than guanylyl-(3',3')-(2',5'-di-O-methyluridine), while in the former pH range the reactivity difference is 1 order of magnitude. Under very acidic conditions (pH < 3), the isomerization giving guanylyl-(2',3')-(2'-amino-2'-deoxyuridine) and depurination yielding guanine (both first-order in [H(+)]) compete with the cleavage. The Zn(2+)-promoted cleavage ([Zn(2+)] = 5 mmol L(-)(1)) is 15 times faster than the uncatalyzed reaction at pH 5.6. The mechanisms of the reactions of guanylyl-(3',3')-(2'-amino-2'-deoxyuridine) are discussed, particularly focusing on the possible stabilization of phosphorane intermediate and/or transition state via an intramolecular hydrogen bonding by the 2'-amino group.     

The 4-(N-dichloroacetyl-N-methylamino)benzyloxymethyl group for 2'-hydroxyl protection of ribonucleosides in the solid-phase synthesis of oligoribonucleotides

Emerging RNA-based technologies for controlling gene expression have triggered a high demand for synthetic oligoribonucleotides and have motivated the development of ribonucleoside phosphoramidites that would exhibit coupling kinetics and coupling efficiencies comparable to those of deoxyribonucleoside phosphoramidites. To fulfill these needs, the novel 4-(N-dichloroacetyl-N-methylamino)benzyloxymethyl group for 2'-hydroxyl protection of ribonucleoside phosphoramidites 9a-d has been implemented (Schemes 1 and 2). The solid-phase synthesis of AUCCGUAGCUAACGUCAUGG was then carried out employing 9a-d as 0.2 M solutions in dry MeCN and 5-benzylthio-1H-tetrazole as an activator. The coupling efficiency of 9a-d averaged 99% within a coupling time of 180 s. Following removal of all base-sensitive protecting groups, cleavage of the remaining 2'-[4-(N-methylamino)benzyl] acetals from the RNA oligonucleotide was effected in buffered 0.1 M AcOH (pH 3.8) within 30 min at 90 degrees C. RP-HPLC and PAGE analyses of the fully deprotected AUCCGUAGCUAACGUCAUGG were comparable to those of a commercial RNA oligonucleotide sharing an identical sequence. Enzymatic digestion of the RNA oligomer catalyzed by bovine spleen phosphodiesterase and bacterial alkaline phosphatase revealed no significant amounts of RNA fragments containing (2'-->5')-internucleotidic phosphodiester linkages or noteworthy nucleobase modifications.     

Hydrolytic reactions of the phosphorodithioate analogue of uridylyl(3',5')uridine: kinetics and mechanisms for the cleavage, desulfurization, and isomerization of the internucleosidic linkage

The hydrolytic reactions of the phosphorodithioate analogue of uridylyl(3',5')uridine [3',5'-Up(s)2U] were followed by HPLC over a wide pH range at 363.2 K. Under acidic and neutral conditions, three reactions compete: (i) desulfurization to a mixture of the (Rp)- and (Sp)-diastereomers of the corresponding 3',5'- and 2',5'-phosphoromonothioates [3',5'- and 2',5'-Up(s)U], which are subsequently desulfurized to a mixture of uridylyl(3',5')- and -(2',5')uridine [3',5'- and 2',5'-UpU], (ii) isomerization to 2',5'-Up(s)2U, and (iii) cleavage to uridine, in all likelihood via a 2',3'-cyclic phosphorodithioate (2',3'-cUMPS2). Under alkaline conditions (pH > 8), only a hydroxide ion catalyzed hydrolysis to uridine via 2',3'-cUMPS2 takes place. At pH 3-7, all three reactions are pH-independent, the desulfurization being approximately 1 order of magnitude faster than the cleavage and isomerization. At pH < 3, all the reactions are hydronium ion catalyzed. On going to very acidic solutions, the cleavage gradually takes over the desulfurization and isomerization. Accordingly, the cleavage overwhelmingly predominates at pH < 0. The overall hydrolytic stability of 3',5'-Up(s)2U is comparable to that of (Sp)- and (Rp)-3',5'-Up(s)U (and to that of 3',5'-UpU, except at pH < 2). The rate of the hydroxide ion catalyzed hydrolysis of 3',5'-Up(s)2U is 37% and 53% of that of (Sp)- and (Rp)-3',5'-Up(s)U, respectively. The reactions, however, differ with the respect of the product accumulation. While the phosphoromonothioates produce a mixture of 2'- and 3'-thiophosphates as stable products, 3',5'-Up(s)2U is hydrolyzed to uridine without accumulation of the corresponding dithiophosphates. At pH < 3, where the hydrolysis is hydronium ion catalyzed, the kinetic thio-effect of the second thio substitution is small: under very acidic conditions (Ho -0.69), (Sp)-3',5'-Up(s)U reacts 1.6 times as fast as 3',5'-Up(s)2U, but the reactivity difference decreases on going to less acidic solutions. In summary, the hydrolytic stability of 3',5'-Up(s)2U closely resembles that of the corresponding phosphoromonothioate. While replacing one of the nonbridging phosphate oxygens of 3',5'-UpU with sulfur stabilizes the phosphodiester bond under acidic conditions by more than 1 order of magnitude, the replacement of the remaining nonbridging oxygen has only a minor influence on the overall hydrolytic stability.     

Synthesis of adenylyl-(3'----5')-guanosine and some analogues as probes to explore the molecular mechanism of stimulation of influenza virus RNA polymerase

Influenza virus mRNA synthesis is primed by a capped oligonucleotide which is cleaved off from a cellular mRNA by a viral protein. The dinucleotide A3'p5'G can be used as a primer for the viral RNA polymerase mediated RNA synthesis in a cell-free system. Analogues of A3'p5'G have therefore been synthesized using the phosphotriester approach, and their priming ability for the influenza virus mRNA synthesis has been determined. An absence of the 2'-hydroxyl function in the guanosine residue in the dinucleotide, as in A3'p5'dG, drastically decreased its priming ability. Similarly, an alteration of the 3'----5' phosphate linkage to a 2'----5' phosphodiester linkage affected the priming ability quite severely. However a dinucleotide, with the 2'-hydroxyl function omitted in the adenosine moiety, as in dA3'p5'G, could still stimulate the mRNA synthesis. None of the modified dinucleotides inhibited A3'p5'G or globin mRNA primed influenza mRNA synthesis.     

Investigations on the interferon-induced 2'-5' oligoadenylate system using analytical capillary isotachophoresis

The activity of the interferon inducible enzyme 2'-5' oligoadenylate synthetase (2-5A synthetase, E.C. 2.7.7) which converts ATP into a series of 2'-5' oligoadenylates was measured using analytical capillary isotachophoresis. The turnover rate of ATP during the reaction was monitored by determination of its concentration at the beginning and the end of the 2-5A synthetase reaction. The enzyme was analysed in extracts of peripheral blood mononuclear cells either pretreated or not with interferon.     

Phosphoester-transfer mechanism of an RNA-cleaving acidic deoxyribozyme revealed by radioactivity tracking and enzymatic digestion

A convenient method involving 32P-labeling of an RNA substrate at the cleavage site and subsequent enzymatic digestion of cleavage products via phosphatases reveals that pH4DZ1--an RNA-cleaving deoxyribozyme with optimal activity at pH 4--forms a 5'-cleavage fragment with 2',3'-cyclic phosphate group and a 3'-cleavage fragment with 5'-OH group.     

Ligating DNA with DNA

Cloning DNA typically involves the joining of target DNAs with vector constructs by enzymatic ligation. A commonly used enzyme for this reaction is bacteriophage T4 DNA ligase, which requires ATP as the energy source to catalyze the otherwise unfavorable formation of a phosphodiester bond. Using in vitro selection, we have isolated a DNA sequence that catalyzes the ligation of DNA in the absence of protein enzymes. We have used the action of two catalytic DNAs, an ATP-dependent self-adenylating deoxyribozyme (AppDNA) and a self-ligating deoxyribozyme, to create a ligation system that covalently joins oligonucleotides via the formation of a 3',5'-phosphodiester linkage. The two-step process is conducted in separate reaction vessels wherein the products of deoxyribozyme adenylation are purified before their use as substrates for deoxyribozyme ligation. The final ligation step of the deoxyribozyme-catalyzed sequence of reactions mimics the final step of the T4 DNA ligase reaction. The initial rate constant (k(obs)) of the optimized deoxyribozyme ligase was found to be 1 x 10(-)(4) min(-)(1). Under these conditions, the ligase deoxyribozyme promotes DNA ligation at least 10(5)-fold faster than that generated by a simple DNA template. The self-ligating deoxyribozyme has also been reconfigured to generate a trans-acting construct that joins separate DNA oligonucleotides of defined sequence. However, the sequence requirements of the AppDNA and that of the 3' terminus of the deoxyribozyme ligase limit the range of sequences that can be ligated.     

Total synthesis of 2',3',4',5',5' '-(2)h(5)-ribonucleosides: the key building blocks for NMR structure elucidation of large RNA

The diastereospecific chemical syntheses of uridine-2',3',4',5',5' '-(2)H(5) (21a), adenosine-2',3',4',5',5' '-(2)H(5) (21b), cytidine-2',3',4',5',5' '-(2)H(5)(2)H(5) (21c), and guanosine-2',3',4',5',5' '-(2)H(5) (21d) (>97 atom % (2)H at C2', C3', C4', and C5'/C5' ') have been achieved for their use in the solution NMR structure determination of oligo-RNA by the Uppsala "NMR-window" concept (refs 4a-c, 5a, 6), in which a small (1)H segment is NMR-visible, while the rest is made NMR-invisible by incorporation of the deuterated blocks 21a-d. The deuterated ribonucleosides 21a-d have been prepared by the condensation of appropriately protected aglycone with 1-O-acetyl-2,3,5-tri-O-(4-toluoyl)-alpha/beta-D-ribofuranose-2,3,4,5,5'-(2)H(5) (19), which has been obtained via diastereospecific deuterium incorporation at the C2 center of appropriate D-ribose-(2)H(4) derivatives either through an oxidation-reduction-inversion sequence or a one-step deuterium-proton exchange in high overall yield (44% and 24%, respectively).     

Sugar conformational effects on the photochemistry of thymidylyl(3'-5')thymidine

The synthesis and conformational analysis of 2'-O,5-dimethyluridylyl(3'-5')-2'-O,5-dimethyluridine (1a), the analogue of thymidylyl(3'-5')thymidine (TpT; 1b) in which a methoxy group replaces each 2'-alpha-hydrogen atom, are described. In comparison with TpT, such modification increases the population of the C3'-endo conformer of the sugar ring puckering at the 5'- and 3'-ends from 30 to 75% and from 37 to 66%, respectively. Photolyses of 1a and TpT at 254 nm are qualitatively comparable (the cis-syn cyclobutane pyrimidine dimer and the (6-4) photoproduct are formed), although it is significantly faster in the case of 1a. These results are explained by the increased propensity of the modified dinucleotide to adopt a base-stacked conformation geometry reminiscent of that for TpT.