共查询到20条相似文献,搜索用时 31 毫秒
1.
Considerableefforthasbeencofltinuingtofocusonthedevelopmentofnewfluorescentdyestorecognizenucleicacids'-'.Althoughdansylisawell-knownsensitivehydrophobicprobewhichhasbeenwidelyutilizedasafluorescentprobeforthestudyofproteins,yetlittleefforthasbeenfocusedontheexploringdansylamidederivativeswhichmayhavespecificeffectsonnucleicacids.Sincethebindingaffinityofsuchfluorophorestopolynucleotideswasgreatlyaffectedbytheirsidechainsubstitutions,inthisworkseveralnewdansylderivativeswithspecificbindingtonu… 相似文献
2.
The synthesis and properties of nicked dumbbell and dumbbell DNA conjugates having A-tract base pair domains connected by rod-like stilbenedicarboxamide linkers are reported. The nicked dumbbells have one to eight dA-dT base pairs and are missing a sugar-phosphate bond either between the linker and a thymine nucleoside residue or between two thymine residues. Chemical ligation of all of the nicked dumbbells with cyanogen bromide affords the dumbbell conjugates in good yield, providing the smallest mini-dumbbells prepared to date. The dumbbells have exceptionally high thermal stability, whereas the nicked dumbbells are only marginally more stable than the hairpin structures on either side of the nick. The structures of the nicked dumbbells and dumbbells have been investigated using a combination of circular dichroism spectroscopy and molecular modeling. The base pair domains are found to adopt normal B'-DNA geometry and thus provide a helical ruler for studies of the distance and angular dependence of electronic interactions between the chromophore linkers. 相似文献
3.
Antonija Erben Igor Sviben Branka Mihaljevi Ivo Piantanida Nikola Basari 《Molecules (Basel, Switzerland)》2021,26(14)
A series of tripeptides TrpTrpPhe (1), TrpTrpTyr (2), and TrpTrpTyr[CH2N(CH3)2] (3) were synthesized, and their photophysical properties and non-covalent binding to polynucleotides were investigated. Fluorescent Trp residues (quantum yield in aqueous solvent ΦF = 0.03–0.06), allowed for the fluorometric study of non-covalent binding to DNA and RNA. Moreover, high and similar affinities of 2×HCl and 3×HCl to all studied double stranded (ds)-polynucleotides were found (logKa = 6.0–6.8). However, the fluorescence spectral responses were strongly dependent on base pair composition: the GC-containing polynucleotides efficiently quenched Trp emission, at variance to AT- or AU-polynucleotides, which induced bisignate response. Namely, addition of AT(U) polynucleotides at excess over studied peptide induced the quenching (attributed to aggregation in the grooves of polynucleotides), whereas at excess of DNA/RNA over peptide the fluorescence increase of Trp was observed. The thermal denaturation and circular dichroism (CD) experiments supported peptides binding within the grooves of polynucleotides. The photogenerated quinone methide (QM) reacts with nucleophiles giving adducts, as demonstrated by the photomethanolysis (quantum yield ΦR = 0.11–0.13). Furthermore, we have demonstrated photoalkylation of AT oligonucleotides by QM, at variance to previous reports describing the highest reactivity of QMs with the GC reach regions of polynucleotides. Our investigations show a proof of principle that QM precursor can be imbedded into a peptide and used as a photochemical switch to enable alkylation of polynucleotides, enabling further applications in chemistry and biology. 相似文献
4.
Lewis FD Wu Y Zhang L Zuo X Hayes RT Wasielewski MR 《Journal of the American Chemical Society》2004,126(26):8206-8215
The synthesis, steady-state spectroscopy, and transient absorption spectroscopy of DNA conjugates possessing both stilbene electron donor and electron acceptor chromophores are described. These conjugates are proposed to form nicked DNA dumbbell structures in which a stilbenedicarboxamide acceptor and stilbenediether donor are separated by variable numbers of A-T or G-C base pairs. The nick is located either adjacent to one of the chromophores or between two of the bases. Thermal dissociation profiles indicate that stable structures are formed possessing as few as two A-T base pairs. Circular dichroism (CD) spectra in the base pair region are characteristic of B-DNA duplex structures, whereas CD spectra at longer wavelengths display two bands attributed to exciton coupling between the two stilbenes. The sign and intensity of these bands are dependent upon both the distance between the chromophores and the dihedral angle between their transition dipoles [Deltaepsilon approximately Rda(-2) sin(2theta)]. Pulsed laser excitation of the stilbenediamide results in creation of the acceptor-donor radical ion pair, which decays via charge recombination. The dynamics of charge separation and charge recombination display an exponential distance dependence, similar to that observed previously for systems in which guanine serves as the electron donor. Unlike exciton coupling between the stilbenes, there is no apparent dependence of the charge-transfer rates upon the dihedral angle between donor and acceptor stilbenes. The introduction of a single G-C base pair between the donor and acceptor results in a change in the mechanism for charge separation from single step superexchange to hole hopping. 相似文献
5.
Sequence specific fluorescence detection of double strand DNA 总被引:2,自引:0,他引:2
Rucker VC Foister S Melander C Dervan PB 《Journal of the American Chemical Society》2003,125(5):1195-1202
Methods for the fluorescent detection of specific sequences of double strand DNA in homogeneous solution may be useful in the field of human genetics. A series of hairpin polyamides with tetramethyl rhodamine (TMR) attached to an internal pyrrole ring were synthesized, and the fluorescence properties of the polyamide-fluorophore conjugates in the presence and absence of duplex DNA were examined. We observe weak TMR fluorescence in the absence of DNA. Addition of >/=1:1 match DNA affords a significant fluorescence increase over equimolar mismatch DNA for each polyamide-TMR conjugate. Polyamide-fluorophore conjugates offer a new class of sensors for the detection of specific DNA sequences without the need for denaturation. The polyamide-dye fluorescence-based method can be used to screen in parallel the interactions between aromatic ring pairs and the minor groove of DNA even when the binding site contains a non-Watson-Crick DNA base pair. A ranking of the specificity of three polyamide ring pairs-Py/Py, Im/Py, and Im/Im-was established for all 16 possible base pairs of A, T, G, and C in the minor groove. We find that Im/Im is an energetically favorable ring pair for minor groove recognition of the T.G base pair. 相似文献
6.
As part of an effort to expand the genetic alphabet, we have been examining the ability of predominately hydrophobic nucleobase analogues to pair in duplex DNA and during polymerase-mediated replication. We previously reported the synthesis and thermal stability of unnatural base pairs formed between nucleotides bearing simple methyl-substituted phenyl ring nucleobase analogues. Several of these pairs are virtually as stable and selective as natural base pairs in the same sequence context. Here, we report the characterization of polymerase-mediated replication of the same unnatural base pairs. We find that every facet of replication, including correct and incorrect base pair synthesis, as well as continued primer extension beyond the unnatural base pair, is sensitive to the specific methyl substitution pattern of the nucleobase analogue. The results demonstrate that neither hydrogen bonding nor large aromatic surface area is required for polymerase recognition, and that interstrand interactions between small aromatic rings may be optimized for replication. Combined with our previous results, these studies suggest that appropriately derivatized phenyl nucleobase analogues represent a promising approach toward developing a third base pair and expanding the genetic alphabet. 相似文献
7.
8.
Ken Hosoya Yoshiyuki Iwakoshi Kimihiro Yoshizako Kazuhiro Kimata Nobuo Tanaka Hisako Takehira Jun Haginaka 《Journal of separation science》1999,22(5):256-260
A non-covalent type of molecular imprinting effect toward a polyaromatic hydrocarbon (PAH), viz. anthracene, was studied utilizing uniformly sized ethylene dimethacrylate (EDMA) polymer particles without functional host monomers. Although polymerization at 0°C initiated by a redox initiation system was expected to afford larger molecular imprinting effect due to stronger and more effective intermolecular interaction between the template and surface functional groups of the polymer, almost no imprinting effect was observed, while a much higher polymerization temperature of 70°C unexpectedly afforded a larger molecular imprinting effect for the template anthracene. In order to determine the unexpected imprinting effects observed, uniformly sized, macroporous un-imprinting EDMA polymer particles (base particles) were prepared by various polymerization techniques at different polymerization temperature as well as with different initiation systems. The careful studies proved that each kind of base polymer particle showed different molecular recognition ability, especially toward anthracene, which is depends upon the physical properties of each kind of base polymer particle. On the basis of these facts, we would propose that the potential molecular recognition ability of the un-imprinted base polymer particles is another important factor for realization of effective molecular imprinting alongside the factors reported previously. 相似文献
9.
Leconte AM Hwang GT Matsuda S Capek P Hari Y Romesberg FE 《Journal of the American Chemical Society》2008,130(7):2336-2343
DNA is inherently limited by its four natural nucleotides. Efforts to expand the genetic alphabet, by addition of an unnatural base pair, promise to expand the biotechnological applications available for DNA as well as to be an essential first step toward expansion of the genetic code. We have conducted two independent screens of hydrophobic unnatural nucleotides to identify novel candidate base pairs that are well recognized by a natural DNA polymerase. From a pool of 3600 candidate base pairs, both screens identified the same base pair, dSICS:dMMO2, which we report here. Using a series of related analogues, we performed a detailed structure-activity relationship analysis, which allowed us to identify the essential functional groups on each nucleobase. From the results of these studies, we designed an optimized base pair, d5SICS:dMMO2, which is efficiently and selectively synthesized by Kf within the context of natural DNA. 相似文献
10.
Fluorescence resonance energy transfer (FRET) between the extrinsic dye labels Cyanine 3 (Cy3), Cyanine 5 (Cy5), Carboxytetramethyl Rhodamine (TAMRA), Iowa Black Fluorescence Quencher (IabFQ), and Iowa Black RQ (IabRQ) has been studied. The F?rster distances for these FRET-pairs in single- and double-stranded DNA conjugates have been determined. In particular, it should be noted that the quantum yield of the donors Cy3 and TAMRA varies between single- and double-stranded DNA. While this alters the F?rster distance for a donor-acceptor pair, this also allows for detection of thermal denaturation events with a single non-intercalating fluorophore. The utility of FRET in the development of nucleic acid biosensor technology is illustrated by using TAMRA and IabRQ as a FRET pair in selectivity experiments. The differential quenching of TAMRA fluorescence by IabRQ in solution has been used to discriminate between 0 and 3 base pair mismatches at 60 degrees C for a 19 base sequence. At room temperature, the quenching of TAMRA fluorescence was not an effective indicator of the degree of base pair mismatch. There appears to be a threshold of duplex stability at room temperature which occurs beyond two base pair mismatches and reverses the observed trend in TAMRA fluorescence prior to that degree of mismatch. When this experimental system is transferred to a glass surface through covalent coupling and organosilane chemistry, the observed trend in TAMRA fluorescence at room temperature is similar to that obtained in bulk solution, but without a threshold of duplex stability. In addition to quenching of fluorescence by FRET, it is believed that several other quenching mechanisms are occurring at the surface. 相似文献
11.
Naphthalene Imide Conjugates: Formation of Supramolecular Assemblies,and the Encapsulation and Release of Dyes through DNA‐Mediated Disassembly
下载免费PDF全文
![点击此处可从《Chemistry (Weinheim an der Bergstrasse, Germany)》网站下载免费的PDF全文](/ch/ext_images/free.gif)
Balaraman H. Shankar Dr. Dhanya T. Jayaram Dr. Danaboyina Ramaiah 《Chemistry (Weinheim an der Bergstrasse, Germany)》2015,21(49):17657-17663
We report the synthesis of two new amphiphilic conjugates 1 and 2 based on naphthalene di‐ and monoimide chromophores and the investigation of their photophysical, self‐assembly and DNA‐binding properties. These conjugates showed aqueous good solubility and exhibited strong interactions with DNA and polynucleotides such as poly(dG?dC)–poly(dG?dC) and poly(dA?dT)–poly(dA?dT). The interaction of these conjugates with DNA was evaluated by photo‐ and biophysical techniques. These studies revealed that the conjugates interact with DNA through intercalation with association constants in the order of 5–8×104 M ?1. Of these two conjugates, bolaamphiphile 1 exhibited a supramolecular assembly that formed vesicles with an approximate diameter of 220 nm in the aqueous medium at a critical aggregation concentration of 0.4 mM , which was confirmed by SEM and TEM. These vesicular structures showed a strong affinity for hydrophobic molecules such as Nile red through encapsulation. Uniquely, when exposed to DNA the vesicles disassembled, and therefore this transformation could be utilised for the encapsulation and release of hydrophobic molecules by employing DNA as a stimulus. 相似文献
12.
13.
Deoxynucleic guanidine (DNG), a DNA analogue in which positively charged guanidine replaces the phosphodiester linkages, tethering to Hoechst 33258 fluorophore by varying lengths has been synthesized. A pentameric thymidine DNG was synthesized on solid phase in the 3' --> 5' direction that allowed stepwise incorporation of straight chain amino acid linkers and a bis-benzimidazole (Hoechst 33258) ligand at the 5'-terminus using PyBOP/HOBt chemistry. The stability of (DNA)(2).DNG-H triplexes and DNA.DNG-H duplexes formed by DNG and DNG-Hoechst 33258 (DNG-H) conjugates with 30-mer double-strand (ds) DNA, d(CGCCGCGCGCGCGAAAAACCCGGCGCGCGC)/d(GCGGCGCGCGCGCTTTTTGGGCCGCGCGCG), and single-strand (ss) DNA, 5'-CGCCGCGCGCGCGAAAAACCCGGCGCGCGC-3', respectively, has been evaluated by thermal melting and fluorescence emission experiments. The presence of tethered Hoechst ligand in the 5'-terminus of the DNG enhances the (DNA)(2).DNG-H triplex stability by a DeltaT(m) of 13 degrees C. The fluorescence emission studies of (DNA)(2).DNG-H triplex complexes show that the DNG moiety of the conjugates bind in the major groove while the Hoechst ligand resides in the A:T rich minor groove of dsDNA. A single G:C base pair mismatch in the target site decreases the (DNA)(2).DNG triplex stability by 11 degrees C, whereas (DNA)(2).DNG-H triplex stability was decreased by 23 degrees C. Inversion of A:T base pair into T:A base pair in the center of the binding site, which provides a mismatch selectively for DNG moiety, decreases the triplex stability by only 5-6 degrees C. Upon hybridization of DNG-Hoechst conjugates with the 30-mer ssDNA, the DNA.DNG-H duplex exhibited significant increase in the fluorescence emission due to the binding of the tethered Hoechst ligand in the generated DNA.DNG minor groove, and the duplex stability was enhanced by DeltaT(m) of 7 degrees C. The stability of (DNA)(2).DNG triplexes and DNA.DNG duplexes is independent of pH, whereas the stability of (DNA)(2).DNG-H triplexes decreases with increase in pH. 相似文献
14.
Lewis FD Zhang L Liu X Zuo X Tiede DM Long H Schatz GC 《Journal of the American Chemical Society》2005,127(41):14445-14453
The structure and properties of oligonucleotide conjugates possessing stilbenedicarboxamide chromophores at both ends of a poly(dA):poly(dT) base-pair domain of variable length have been investigated using a combination of spectroscopic and computational methods. These conjugates form capped hairpin structures in which one stilbene serves as a hairpin linker and the other as a hydrophobic end-cap. The capping stilbene stabilizes the hairpin structures by ca. 2 kcal/mol, making possible the formation of a stable folded structure containing a single A:T base pair. Exciton coupling between the stilbene chromophores has little effect on the absorption bands of capped hairpins. However, exciton-coupled circular dichroism (EC-CD) can be observed for capped hairpins possessing as many as 11 base pairs. Both the sign and intensity of the EC-CD spectrum are sensitive to the number of base pairs separating the stilbene chromophores, as a consequence of the distance and angular dependence of exciton coupling. Calculated spectra obtained using a static vector model based on canonical B-DNA are in good agreement with the experimental spectra. Molecular dynamics simulations show that conformational fluctuations of the capped hairpins result in large deviations of the averaged spectra in both the positive and negative directions. These results demonstrate for the first time the ability of B-DNA to serve as a helical ruler for the study of electronic interactions between aligned chromophores. Furthermore, they provide important tests for atomistic theoretical models of DNA. 相似文献
15.
The binding interactions of three naphthalimide derivatives with heteropoly nucleic acids have been evaluated using fluorescence, absorption and circular dichroism spectroscopies. Mono- and bifunctionalized naphthalimides exhibit sequence-dependent variations in their affinity toward DNA. The heteropoly nucleic acids, [Poly(dA-dT)]2 and [Poly(dG-dC)]2, as well as calf thymus (CT) DNA, were used to understand the factors that govern binding strength and selectivity. Sequence selectivity was addressed by determining the binding constants as a function of polynucleotide composition according to the noncooperative McGhee-von Hippel binding model. Binding affinities toward [poly(dA-dT)](2) were the largest for spermine-substituted naphthalimides (Kb = 2-6 x 10(6) M(-1)). The association constants for complex formation between the cationic naphthalimides and [poly(dG-dC)]2 or CT DNA (58% A-T content) were 2-500 times smaller, depending on the naphthalimide-polynucleotide pair. The binding modes were also assessed using a combination of induced circular dichroism and salt effects to determine whether the naphthalimides associate with DNA through intercalative, electrostatic or groove-binding. The results show that the monofunctionalized spermine and pyridinium-substituted naphthalimides associate with DNA through electrostatic interactions. In contrast, intercalative interactions are predominant in the complex formed between the bifunctionalized spermine compound and all of the polynucleotides. 相似文献
16.
Effect of loop distortion on the stability and structural dynamics of DNA hairpin and dumbbell conjugates 总被引:1,自引:0,他引:1
McCullagh M Zhang L Karaba AH Zhu H Schatz GC Lewis FD 《The journal of physical chemistry. B》2008,112(36):11415-11421
The thermal stability and conformational dynamics of DNA hairpin and dumbbell conjugates having short A-tract base pair domains connected by tri- or hexa(ethylene glycol) linkers is reported. The formation of stable base-paired A-tract hairpins having oligo(ethylene glycol) linkers requires a minimum of four or five A-T base pairs. The formation of base-paired dumbbells having oligo(ethylene glycol) linkers by means of chemical ligation of nicked dumbbells requires a minimum of two A-T base pairs on either side of the nick. Molecular modeling indicates that the hexa(ethylene glycol) linker is sufficiently long to permit formation of strain-free loop regions and B-DNA base pair domains. In contrast, the tri(ethylene glycol) is too short to permit Watson-Crick base pairing between the bases attached to the linker. The shorter linker distorts the duplex, resulting in fluxional behavior in which the base pairs adjacent to the linker and at the open end of the hairpin dissociate on the nanosecond time scale. The loss of interstrand binding energy caused by these fluctuations leads to a difference of approximately 5 degrees C in melting temperature between EG3 and EG6 hairpins. An analysis of the fluxional behavior of the EG3 adjacent base-pair has been used to study the pathways for base flipping and base stacking, including the identification of rotated base (partially flipped) intermediates that have not been described previously for A-T base pairs. 相似文献
17.
Sasaki S Bando T Minoshima M Shinohara K Sugiyama H 《Chemistry (Weinheim an der Bergstrasse, Germany)》2008,14(3):864-870
To extend the target DNA sequence length of the hairpin pyrrole-imidazole (Py-Im) polyamide 1, we designed and synthesized Y-shaped and tandem hairpin Py-Im polyamides 2 and 3, which possess 1-(chloromethyl)-5-hydroxy-1,2-dihydro-3H-benz[e]indole (seco-CBI) as DNA-alkylating moieties. High-resolution denaturing polyacrylamide gel electrophoresis by using 5'-Texas-Red-labeled 465 base pair (bp) DNA fragments revealed that conjugates 2 and 3 alkylated the adenine of the target DNA sequences at nanomolar concentrations. Conjugate 2 alkylated adenine N3 at the 3' end of two 8 bp match sequences, 5'-AATAACCA-3' (site A) and 5'-AAATTCCA-3' (site C), while conjugate 3 recognized one 10 bp match sequence, 5'-AGAATAACCA-3' (site A) in the 465 bp DNA fragments. These results demonstrate that seco-CBI conjugates of Y-shaped and tandem hairpin polyamides have extended their target alkylation sequences. 相似文献
18.
Elongation method was applied to determine the electronic structures of B-type poly(dG).poly(dC) DNA at the ab initio molecular orbital level as a first step toward the calculation of aperiodic DNA. The discrepancy in total energy between the elongation method and a conventional calculation was negligibly small in the order of 10(-8) hartreeat. for 14 G-C base pair model. The local density of states for 10 G-C base pair model estimated by the elongation method well reproduced the results by the conventional calculation. It was found that the band gap of the whole system is mainly due to the energy difference between the valence band of guanine and the conduction band of cytosine. Moreover, the electron transfer path through stacking G-C base pairs rather than sugar-phosphate backbones has been confirmed by the authors' calculations. 相似文献
19.
Egli M Tereshko V Mushudov GN Sanishvili R Liu X Lewis FD 《Journal of the American Chemical Society》2003,125(36):10842-10849
Synthetic conjugates possessing bis(2-hydroxyethyl)stilbene-4,4'-diether linkers (Sd2) form the most stable DNA hairpins reported to date. Factors that affect stability are length and flexibility of the linkers and pi-stacking of the stilbene moiety on the adjacent base pair. The crystal structure of the hairpin d(GT(4)G)-Sd2-d(CA(4)C) was determined at 1.5 A resolution. The conformations of the two molecules in the asymmetric unit differ both in the linker and the stem portions. One of them shows a planar stilbene that is stacked on the adjacent G:C base pair. The other displays considerable rotation between the phenyl rings and an unprecedented edge-to-face orientation of stilbene and base pair. The observation of considerable variations in the conformation of the Sd moiety in the crystal structure allows us to exclude restriction of motion as the reason for the absence of Sd photoisomerization in the hairpins. Conformational differences in the stem portion of the two hairpin molecules go along with different Mg(2+) binding modes. Most remarkable among them is the sequence-specific coordination of a metal ion in the narrow A-tract minor groove. The crystal structure provides unequivocal evidence that a fully hydrated Mg(2+) ion can penetrate the narrow A-tract minor groove, causing the groove to further contract. Overall, the structural data provide a better understanding of the origins of hairpin stability and their photochemical behavior in solution. 相似文献
20.
A density functional study of the effects of microhydration on the guanine-cytosine (GC) base pair and its anion radical is presented. Geometries of the GC base pair in the presence of 6 and 11 water molecules were fully optimized in the neutral (GC-nH2O) and anion radical [(GC-nH2O)*-] (n = 6 and 11) states using the B3LYP method and the 6-31+G** basis set. Further, vibrational frequency analysis at the same level of theory (B3LYP/6-31+G**) was also performed to ensure the existence of local minima in these hydrated structures. It was found that water molecules surrounding the GC base pair have significant effects on the geometry of the GC base pair and promote nonplanarity in the GC base pair. The calculated structures were found to be in good agreement with those observed experimentally and obtained in molecular dynamics (MD) simulation studies. The water molecules in neutral GC-nH2O complexes lie near the ring plane of the GC base pair where they undergo hydrogen bonding with both GC and each other. However, in the GC anion radical complexes (GC-nH2O, n = 6, 11), the water molecules are displaced substantially from the GC ring plane. For GC-11H2O*-, a water molecule is hydrogen-bonded with the C6 atom of the cytosine base. We found that the hydration shell initially destabilizes the GC base pair toward electron capture as a transient anion. Energetically unstable diffuse states in the hydration shell are suggested to provide an intermediate state for the excess electron before molecular reorganization of the water molecules and the base pair results in a stable anion formation. The singly occupied molecular orbital (SOMO) in the anion radical complexes clearly shows that an excess electron localizes into a pi orbital of cytosine. The zero-point-energy (ZPE-) corrected adiabatic electron affinities (AEAs) of the GC-6H2O and GC-11H2O complexes, at the B3LYP/6-31+G** level of theory, were found to be 0.74 and 0.95 eV, respectively. However, the incorporation of bulk water as a solvent using the polarized continuum model (PCM) increases the EAs of these complexes to 1.77 eV. 相似文献