Measurement of gastric emptying in man using deuterated octanoic acid.

Gamma scintigraphy is considered the gold standard for the measurement of gastric emptying in humans. Recently, it has been proposed that a [(13)C]octanoate breath test can be used as an alternative technique for measuring gastric emptying of the solid phase, but the results from the two methods are not directly equivalent since in the breath test the label is subject to post-absorptive processing and consequently the emptying functions cannot be observed directly. This work investigates an alternative stable isotope method using deuterated octanoate where the kinetics of redistribution between and elimination from the various body pools are much more easily modelled. Gastric emptying was studied in healthy human volunteers by simultaneous measurement using both [(13)C]octanoate and [(2)H]octanoate as well as gamma scintigraphy. Comparison of the gastric emptying functions from the deuterium method and scintigraphy indicated that the two methods gave equivalent results. The new method can therefore be used in populations considered too vulnerable to ionising radiation to allow gamma scintigraphy to be performed, or as a proxy gold standard in laboratories where scintigraphic methods are unavailable, allowing further comparisons with the breath test method to be made to validate the latter in different population groups.     

Advantages of deuterium-labelled mixed triacylglycerol in studies of intraluminal fat digestion

The (13)C-mixed triacylglcerol (MTG, 1,3-distearyl, 2-[1-(13)C]octanoyl glycerol) breath test is a non-invasive measure of intraluminal fat digestion. Recovery of (13)C in breath CO(2) is incomplete (<50%) owing to sequestration of (13)C into organic molecules via the tricarboxylic acid (TCA) cycle. In addition lack of knowledge of CO(2) production rate (VCO(2)) during the test leads to errors in the calculated percentage dose recovered (PDR). (2)H sequestration into organic molecules is low ( approximately 4%) and is not influenced by factors that affect VCO(2) such as food intake or physical activity. After oxidation of (2)H-labelled macromolecules, the label appears in body water, which can be sampled non-invasively in urine or saliva. After an overnight fast, two healthy adults consumed [(2)H]MTG (1,3-distearyl, 2-[(2)H(15)]octanoyl glycerol) and [(13)C]MTG (1,3 distearyl, 2-[1-(13)C]octanoyl glycerol) simultaneously. Total body water (TBW) was measured by (18)O dilution and also estimated from height and weight. Urine and saliva were sampled at baseline and for 10 h after consumption of the test meal. The abundance of (2)HOH and H(2) (18)O in urine and saliva was measured by continuous-flow isotope-ratio mass spectrometry. Cumulative PDR of (2)H and (18)O was calculated from the plateau enrichment, which was reached by 6 h in both saliva and urine. Recovery of (2)H calculated using measured TBW was compared with that using an estimated value of TBW. Mean recovery of (2)H in saliva was 99.3% and in urine was 96.4%. Errors introduced by estimating TBW were <5%. [(2)H]MTG could provide a simpler, more robust, indirect test of intraluminal fat digestion compared with the (13)C-breath test. Further studies are required in pancreatic insufficient patients.     

On the theory of thermometric titration

The general equation defining the change in solution temperature DeltaT during a thermometric titration is DeltaT = T - T(0) = - AV 1 + BV where A and B are constants, V is the volume of titrant used to produce temperature T, and T(0) is the initial temperature. There is a linear relation between the inverse values of DeltaT and V: 1 Delta T = - a V - b where a = 1/A and b = B/A, both a and b being constants. A linear relation between DeltaT and V is usually a special case of this general relation, and is valid only over a narrow range of V. Graphs of 1/DeltaTvs. 1/V are more suitable for practical calculations than the usual graphs of DeltaTvs. V.     

Novel benzamides as selective and potent gastrokinetic agents. III. Synthesis and structure-activity relationships of 4-amino-5-chloro-2-methoxy- and 2-ethoxy-N-[(4-substituted 2-morpholinyl)methyl]-benzamides.

A series of 4-amino-5-chloro-2-methoxy- and 2-ethoxy-N-[(4-substituted 2-morpholinyl)methyl]benzamides (11-64) were prepared and evaluated for gastrokinetic activity by determining their effects on the gastric emptying of phenol red semisolid meal in rats. The N-4 substituent includes alkyl, phenoxyalkyl, (4-fluorobenzoyl)alkyl, and heteroarylmethyl groups. The benzamide derivatives, having an isopropyl, isoamyl, neopentyl, 3-(4-chlorophenoxy)-propyl, or pyridylmethyl group at N-4, showed potent in vivo gastric emptying activity. In particular, 4-amino-5-chloro-2-ethoxy-N-[[4-(3-pyridylmethyl)-2- morpholinyl]methyl]benzamide (57b) was equipotent to the 4-fluorobenzyl analogue 1b (AS-4370 as its citrate) in the gastrokinetic activity on phenol red semisolid meal in rats and mice, and on resin pellet solid meal in rats. Moreover, compound 57b was free from dopamine D2 receptor antagonistic activity in both in vitro ([3H]spiperone binding) and in vivo (apomorphine-induced emesis in dogs) tests. Structure-activity relationships of compounds with various substituents at N-4 are also discussed.     

Translational diffusion in sucrose benzoate near the glass transition: probe size dependence in the breakdown of the Stokes-Einstein equation

The translational diffusion coefficient D(trans) for rubrene, 9,10-bis(phenylethynyl)anthracene (BPEA), and tetracene in the fragile molecular glass-former sucrose benzoate (SB) (Tg=337 K) was studied as a function of temperature from Tg+3 K to Tg+71 K by use of the holographic fluorescence recovery after photobleaching technique. The values of D(trans) vary by five to six orders of magnitude in this temperature range. Contrary to the predictions of the Stokes-Einstein equation, the temperature dependence of probe diffusion in SB over the temperature range of the measurements is weaker than that of T/eta, where eta is the shear viscosity. In going from the crossover temperature Tx approximately 1.2Tg to Tg, D(trans)eta/T increases by factors of 2.4+/-0.2 decades for rubrene, 3.4+/-0.2 decades for BPEA, and 3.8+/-0.4 decades for tetracene. The decoupling between probe diffusion in SB and viscosity is characterized by the scaling law D(trans) approximately T/eta(xi), with xi=0.621 for tetracene, 0.654 for BPEA, and 0.722 for rubrene. Data for probe diffusion in SB are combined with data from the literature for probe diffusion in ortho-terphenyl and alphaalphabeta-tris(naphthyl)benzene in a plot of enhancement versus the relative probe size parameter rho(m)=(m(p)m(h))(1/3), where m(p) and m(h) are, respectively, the molecular weights of the probe and host solvent. The plot clearly shows a sharp increase in enhancement of translational diffusion at rho(m) approximately 1. By applying temperature shifts, D(trans) for probe diffusion in SB and the dielectric relaxation time tau(D) can be superimposed on a single master curve based on the Williams-Landel-Ferry equation. This suggests that the dynamics of probe diffusion in SB is described by the scaling relationship D(trans) approximately 1/tau(D)(T+DeltaT), where tau(D)(T+DeltaT) is the temperature-shifted dielectric relaxation time. The results from this study are discussed within the context of dynamic heterogeneity in glass-forming liquids.     

Thermodynamics of adsorption of imidacloprid at constant charge hydrophobic surfaces: physicochemical aspects of bioenvironmental activity

Adsorption of the insecticide 1-(6-chloro-3-pyridylmethyl)-N-nitroimidazolidin-2-ylideneamine (Imidacloprid) on the hanging mercury drop electrode (HMDE) surface was studied by temperature-dependent stripping voltammetry (TD-SV). At near physiological pH, under reducing conditions, the Gibbs free energy of adsorption, DeltaGADS, shows two distinct temperature-dependent regimes. (a) At 0 degrees < T < 10 degrees C a temperature-independent mechanism occurs with a constant DeltaGADS = -40.5 kJ/mol, resulting in strong chemisorption at high surface coverage. For T < 10 degrees C a considerable enthalpy gain is estimated, and this represents the driving force for the adsorption of Imidacloprid onto the electrode surface. (b) At T > 10 degrees C a temperature-dependent mechanism is operative with DeltaGADS/DeltaT = -91.4 J/K mol, resulting in a rapid weakening of adsorption and low surface coverage. On the basis of the present findings we suggest that the strong chemisorption at T < 10 degrees C at physiological pH under reducing conditions is related to the high specific insecticide activity of Imidacloprid in cool-blooded insects as contrasted to its low efficiency in warm-blooded organisms.     

Alignment behaviour of the discotic nematic phase of 2,3,6,7,10,11-hexa(4-n-octyloxybenzoyloxy)triphenylene on polyimide and cetyltrimethylammonium bromide coated substrates

The orientational behaviour of the nematic discotic phase of 2,3,6,7,10,11-hexa(4-n-octyloxybenzoyloxy)triphenylene (C8OBT) on substrates coated with a polyimide or cetyltrimethylammonium bromide (CTAB) was investigated by polarizing optical microscopy. The averaged order parameters and directions of the triphenylene core and the carbonyl groups of C8OBT were evaluated by an infrared dichroic method. The discotic nematic (N_D) phase of C8OBT exhibits a homeotropic alignment on a polyimide film, a typical nematic schlieren texture on a glass substrate, and a tilted or planar homogeneous alignment on a CTAB-coated substrate. The order parameter of the triphenylene core is higher on a polyimide film (S = 0.6) than on a CTAB-coated substrate (S = 0.2), whereas that of the carbonyl groups remains roughly constant at 0.2 to 0.3 independent of the substrate for the N_D phase.     

Solid-phase synthesis of positively charged deoxynucleic guanidine (DNG) tethering a Hoechst 33258 analogue: triplex and duplex stabilization by simultaneous minor groove binding

Deoxynucleic guanidine (DNG), a DNA analogue in which positively charged guanidine replaces the phosphodiester linkages, tethering to Hoechst 33258 fluorophore by varying lengths has been synthesized. A pentameric thymidine DNG was synthesized on solid phase in the 3' --> 5' direction that allowed stepwise incorporation of straight chain amino acid linkers and a bis-benzimidazole (Hoechst 33258) ligand at the 5'-terminus using PyBOP/HOBt chemistry. The stability of (DNA)(2).DNG-H triplexes and DNA.DNG-H duplexes formed by DNG and DNG-Hoechst 33258 (DNG-H) conjugates with 30-mer double-strand (ds) DNA, d(CGCCGCGCGCGCGAAAAACCCGGCGCGCGC)/d(GCGGCGCGCGCGCTTTTTGGGCCGCGCGCG), and single-strand (ss) DNA, 5'-CGCCGCGCGCGCGAAAAACCCGGCGCGCGC-3', respectively, has been evaluated by thermal melting and fluorescence emission experiments. The presence of tethered Hoechst ligand in the 5'-terminus of the DNG enhances the (DNA)(2).DNG-H triplex stability by a DeltaT(m) of 13 degrees C. The fluorescence emission studies of (DNA)(2).DNG-H triplex complexes show that the DNG moiety of the conjugates bind in the major groove while the Hoechst ligand resides in the A:T rich minor groove of dsDNA. A single G:C base pair mismatch in the target site decreases the (DNA)(2).DNG triplex stability by 11 degrees C, whereas (DNA)(2).DNG-H triplex stability was decreased by 23 degrees C. Inversion of A:T base pair into T:A base pair in the center of the binding site, which provides a mismatch selectively for DNG moiety, decreases the triplex stability by only 5-6 degrees C. Upon hybridization of DNG-Hoechst conjugates with the 30-mer ssDNA, the DNA.DNG-H duplex exhibited significant increase in the fluorescence emission due to the binding of the tethered Hoechst ligand in the generated DNA.DNG minor groove, and the duplex stability was enhanced by DeltaT(m) of 7 degrees C. The stability of (DNA)(2).DNG triplexes and DNA.DNG duplexes is independent of pH, whereas the stability of (DNA)(2).DNG-H triplexes decreases with increase in pH.     

Novel benzamides as selective and potent gastrokinetic agents. IV. Synthesis and structure-activity relationships of 2-substituted 4-amino-N-[(4-benzyl-2-morpholinyl)methyl]-5-chlorobenzamides.

A new series of 2-substituted 4-amino-N-[(4-benzyl-2-morpholinyl)methyl]-5-chlorobenzamides (4-39) including a few 4-fluorobenzyl analogues were prepared and evaluated for their gastrokinetic activity by determining their effects on the gastric emptying activity of phenol red semisolid meal in rats. The C-2 substituent comprises alkoxy and variously substituted alkoxy groups. Among the derivatives, 4-amino-N-[(4-benzyl-2-morpholinyl)methyl]-2-(n-butoxy)-5-chlorobenza mide (5), its 4-fluorobenzyl (6), and 3-methyl-2-butenyloxy analogues (22) were superior to cisapride and essentially equipotent to the 2-ethoxy analogue (1b, AS-4370 as its citrate) in gastrokinetic activity. These compounds, like AS-4370, had no dopamine D2 receptor antagonistic activity.     

Selective recognition of G-qQuadruplex telomeric DNA by a bis(quinacridine) macrocycle

The interaction of G-quadruplex DNA with the macrocyclic compound BOQ1, which possesses two dibenzophenanthroline (quinacridine) subunits, has been investigated by a variety of methods. The oligonucleotide 5'-A(GGGT(2)A)(3)G(3), which mimics the human telomeric repeat sequence and forms an intramolecular quadruplex, was used as one model system. Equilibrium binding constants measured by biosensor surface plasmon resonance (SPR) methods indicate a high affinity of the macrocycle for the quadruplex conformation (K > 1 x 10(7) M(-)(1)) with two equivalent binding sites. The affinity of BOQ1 for DNA duplexes is at least 1 order of magnitude lower. In addition, the macrocycle is more selective than the monomeric control compound (MOQ2), which is not able to discriminate between the two DNA structures (K(duplex) approximately K(quadruplex) approximately 10(6) M(-)(1)). Strong binding of BOQ1 to G4 DNA sequences was confirmed by fluorometric titrations with a tetraplex-forming oligonucleotide. Competition dialysis experiments with a panel of different DNA structures, from single strands to quadruplexes, clearly established the quadruplex binding specificity of BOQ1. Fluorescence resonance energy transfer (FRET) T(m) experiments with a doubly labeled oligonucleotide also revealed a strong stabilization of the G4 conformation in the presence of BOQ1 (DeltaT(m) = +28 degrees C). This DeltaT(m) value is one of the highest values measured for a G-quadruplex ligand and is significantly higher than observed for the monomer control compounds (DeltaT(m) = +10-12 degrees C). Gel mobility shift assays indicated that the macrocycle efficiently induces the formation of G-tetraplexes. Strong inhibition of telomerase was observed in the submicromolar range (IC(50) = 0.13 microM). These results indicate that macrocycles represent an exciting new development opportunity for targeting DNA quadruplexes.     

Improved hydrogen release from LiB0.33N0.67H2.67 with noble metal additions

The hydrogen release behavior of the quaternary hydride LiB(0.33)N(0.67)H(2.67) has been successfully improved through the incorporation of small quantities of noble metal. Adding 5 wt % Pd either as Pd metal particles or as PdCl(2) reduced the temperature T(1/2) corresponding to the midpoint of the hydrogen release reaction by DeltaT(1/2) = -43 degrees C and -76 degrees C, respectively. PtCl(2) and Pt nanoparticles supported on a Vulcan carbon substrate proved to be even more effective, with DeltaT(1/2) = -90 degrees C. The amount of NH(3) released during dehydrogenation is reduced compared to that from additive-free material, and, more importantly, at temperatures below 210 degrees C hydrogen is released with no detectable NH(3). In contrast to additive-free LiB(0.33)N(0.67)H(2.67), which melts completely above 190 degrees C and releases hydrogen from the liquid state only above approximately 250 degrees C, hydrogen release from LiB(0.33)N(0.67)H(2.67) + 5 wt % Pt/Vulcan carbon is accompanied by partial melting plus a cascade through a series of solid intermediate phases. Calorimetric measurements indicate that both additive-free and Pt-added LiB(0.33)N(0.67)H(2.67) release hydrogen exothermically, and hence the reverse reaction is thermodynamically unfavorable. By exposing partially dehydrogenated samples to high H(2) pressures at modest temperatures, fractional hydrogen uptake (roughly 15% of the released hydrogen) has been achieved. The mechanism by which noble metals promote hydrogen release is not known, but the behavior is consistent with that expected for a catalyst, including a large effect with small additions and saturation of the effect at low concentration.     

Evaluation of 13C-phenylalanine and 13C-tyrosine breath tests for the measurement of hepatocyte functional capacity in patients with liver cirrhosis.

Liver disease is associated with an abnormal elevation of the plasma concentrations of the aromatic amino acids phenylalanine and tyrosine. The liver is the main site of aromatic amino acid metabolism, particularly the hydroxylation of phenylalanine to tyrosine and further tyrosine degradation. In the present study, we have examined the usefulness of the L-[1-13C]phenylalanine breath test (13C-PheBT) and L-[13C]tyrosine breath test (13C-TyrBT) for the detection of hepatic damage in patients with liver cirrhosis. First, the time courses of 13CO2 excretion after the administration of L-[1-13C]phenylalanine and L-[1-13C]tyrosine were compared. The peak times (the time expressed in minutes at which 13CO2 excretion was maximal) were 20 min in both breath tests, but 13C-TyrBT gave a higher peak than 13C-PheBT. Next, the parameters of 13C-PheBT and 13C-TyrBT were compared with biochemical liver function test values. These parameters were well correlated with several liver blood test values conventionally regarded as measures of hepatocyte functional reserve. Therefore, 13C-PheBT and 13C-TyrBT may be useful to assess the degree and progression of hepatic dysfunction.     

Synthesis and Crystal Structure of 2-Fluoro-4-methyl-3-oxo-4-aza-5α-androst-1-ene-17β-carboxylic Acid Methyl Ester

Synthesis and Crystal Structure of 2-Fluoro-4-methyl-3-oxo-4-aza-5α-androst-1-ene-17β-carboxylic Acid Methyl EsterAuthorJANG Yin-Zhi XIANG Zuo LIANG Da-Wei (Department of Applied Chemistry, Zhejiang Sci-Tech. University, Hangzhou 310018, China)AbstractThe title compound VII, 2-fluoro-4-methyl-3-oxo-4-aza-5α-androst-1-ene-17β-carboxylic acid methyl ester (C21H30FNO3, Mr = 363.46), was prepared through a seven-step reaction from pregnenolone, and characterized by elemental and single-crystal X-ray diffraction analyses as well as IR, MS and 1H-NMR spectra. It is of monoclinic system, space group P21/c with a = 6.3882(7), b = 9.9033(11), c = 15.4925(17) , β = 91.923(2)°, V = 979.57(19) 3, Z = 2, Dc = 1.232 mg/m3, μ = 0.088 mm-1, F(000)= 392, R = 0.0465, wR = 0.0989 and λ(MoKα) = 0.71073 . The structure indicates that the four cycles (A: C(1)-C(2)-C(3)-N(1)-C(5)-C(10), B: C(5)-C(6)-C(7)- C(8)-C(9)-C(10), C: C(8)-C(14)-C(13)-C(12)-C(11)-C(9), D: C(14)-C(15)-C(16)-C(17)-C(13)) are in chairand trans-configurations. The results of crystal structure determination show that there exist weak intra-molecular hydrogen bonds, resulting in a two-dimensional supramolecular frame-work of the title compound.Keywordsfluoro-sterol, synthesis, crystal structure, supramolecule     

Medicinal flowers. III. Marigold. (1): hypoglycemic, gastric emptying inhibitory, and gastroprotective principles and new oleanane-type triterpene oligoglycosides, calendasaponins A, B, C, and D, from Egyptian Calendula officinalis.

The methanolic extract and its 1-butanol-soluble fraction from the flowers of Calendula officinalis were found to show a hypoglycemic effect, inhibitory activity of gastric emptying, and gastroprotective effect. From the 1-butanol-soluble fraction, four new triterpene oligoglycosides, calendasaponins A, B, C, and D, were isolated, together with eight known saponins, seven known flavonol glycosides, and a known sesquiterpene glucoside. Their structures were elucidated on the basis of chemical and physicochemical evidence. The principal saponin constituents, glycosides A, B, C, D, and F, exhibited potent inhibitory effects on an increase in serum glucose levels in glucose-loaded rats, gastric emptying in mice, and ethanol- and indomethacin-induced gastric lesions in rats. Some structure-activity relationships are discussed.     

Synthesis and Crystal Structure of a Copper(II) Complex with a Tab-Tab Disulfide Ligand (Tab-Tab)[CuBr_4](Tab=Trimethylammoniumphenyl-4-thiolate)

1 INTRODUCTION In the past decades, metal disulphides have recei- ved much attention due to their diversity struc- tures[1~4] and applications as potential ligands for metal ions in biological system[5]. Metal disulfide compounds are usually prepared from the direct reactions of metal ions with organic disulphide[1~5], while some others are isolated from the reactions of metal salts and thiolates with the presence of certain oxidizing agents (e.g., O2, H2O2, etc.)[6, 7]. A large number o…     

A theoretical case study of type I and type II beta-turns

NMR chemical shielding anisotropy tensors have been computed by employing a medium size basis set and the GIAO-DFT(B3LYP) formalism of electronic structure theory for all of the atoms of type I and type II beta-turn models. The models contain all possible combinations of the amino acid residues Gly, Ala, Val, and Ser, with all possible side-chain orientations where applicable in a dipeptide. The several hundred structures investigated contain either constrained or optimized phi, psi, and chi dihedral angles. A statistical analysis of the resulting large database was performed and multidimensional (2D and 3D) chemical-shift/chemical-shift plots were generated. The (1)H(alpha-13)C(alpha), (13)C(alpha-1)H(alpha-13)C(beta), and (13)C(alpha-1)H(alpha-13)C' 2D and 3D plots have the notable feature that the conformers clearly cluster in distinct regions. This allows straightforward identification of the backbone and side-chain conformations of the residues forming beta-turns. Chemical shift calculations on larger For-(L-Ala)(n)-NH(2) (n=4, 6, 8) models, containing a single type I or type II beta-turn, prove that the simple models employed are adequate. A limited number of chemical shift calculations performed at the highly correlated CCSD(T) level prove the adequacy of the computational method chosen. For all nuclei, statistically averaged theoretical and experimental shifts taken from the BioMagnetic Resonance Bank (BMRB) exhibit good correlation. These results confirm and extend our previous findings that chemical shift information from selected multiple-pulse NMR experiments could be employed directly to extract folding information for polypeptides and proteins.     

Determination of underivatized amino acid delta(13)C by liquid chromatography/isotope ratio mass spectrometry for nutritional studies: the effect of dietary non-essential amino acid profile on the isotopic signature of individual amino acids in fish

This study provides data for the effect of dietary non-essential amino acid composition on the delta(13)C values of individual amino acids in rainbow trout (Oncorhynchus mykiss) using liquid chromatography coupled to isotope ratio mass spectrometry (LC/IRMS). In this experiment, trout were reared either on a control diet or on three experimental diets, differing in the composition of non-essential/conditionally essential amino acids, for a period of 6 weeks. The control diet was a commercial trout starter feed with fish meal as the main protein source. The experimental diets contained no protein, only synthetic amino acids. Diet 1 resembled the composition of fish meal in both essential and non-essential amino acids, Diet 2 had all essential amino acids, but cysteine, glycine, proline and tyrosine were replaced by the corresponding amounts of their precursors, and in Diet 3 all non-essential amino acids were replaced by glutamate. LC/IRMS was used for the determination of delta(13)C values of individual amino acids from diets and tissues without derivatization. Diet affected the delta(13)C of individual amino acids in fish. For fish on Diets 1-3 amino acid delta(13)C values showed a similar trend: phenylalanine showed very little change from diet to body tissue. Arginine, lysine, tyrosine and proline showed strong depletion from diet to body tissue and glycine, alanine, aspartate and serine all showed variable but strong enrichment in (13)C. Improvements are necessary before all amino acid delta(13)C values can be determined; however, this study demonstrates that measuring amino acid isotopic signatures by LC/IRMS is a promising new technique for nutritional physiologists.     

Synthesis and Crystal Structure of a Copper(Ⅱ) Complex with a Tab-Tab Disulfide Ligand (Tab-Tab)[CuBr4] (Tab = Trimethylammoniumphenyl-4-thiolate)

Reaction of CuBr2 with TabHPF6/Et3N in methanol followed by dissolving the resulting precipitate in hydrobromic acid yielded purple blocks of the title complex [Tab-Tab][CuBr4] 1 (C18H26CuBr4N2S2). 1 crystallizes in the monoclinic system, space group P21/n with a = 9.686(3),b = 19.257(5), c = 13.399(4) (A), β= 93.610(9)°, V= 2494.2(13) (A)3, Z= 4, Dc = 1.911 g/cm3, T=193(2) K, Mr = 717.71, F(000) = 1396, μ = 74.58 cm-1, S = 1.126, R = 0.0748 and wR = 0.1736 for 2921 observed reflections with I ＞ 2σ(Ⅰ). The structure of 1 contains a discrete [CuBr4]2- dianion and a [Tab-Tab]2+ dication. In the dianion, the Cu atom is coordinated to four Br atoms forming a distorted tetrahedral coordination geometry. The bromides of the dianion interact with the H atoms of the phenyl and methyl groups of the dications to form a 1D hydrogen-bonded chain.     

Nucleic acid structural engineering using pyrene-functionalized 2'-amino-alpha-L-LNA monomers and abasic sites

Oligonucleotides (ONs) modified with a 2'-N-(pyren-1-yl)acetyl-2'-amino-alpha-L-LNA thymine monomer Y flanked on the 3'-side by an abasic site Phi (i.e., YPhi-unit) exhibit unprecedented increases in thermal affinity (DeltaT(m) values) toward target strands containing abasic sites (DeltaT(m) per YPhi unit >+33.0 degrees C in 9-mer duplexes relative to unmodified ONs). Biophysical studies along with force field calculations suggest that the conformationally locked 2-oxo-5-azabicyclo[2.2.1]heptane skeleton of monomer Y, in concert with the short rigid acetyl linker, efficiently forces the thymine and pyrene moieties to adopt an interplanar distance of approximately 3.4 A. This precisely positions the pyrene moiety in the duplex core void formed by abasic sites (Phi:Phi pair) for optimal pi-pi overlap. Duplexes with multiple YPhi: APhi units separated by one base pair are tolerated extraordinarily well, as exemplified by a 13-mer duplex containing four separated YPhi: APhi units (8 abasic sites distributed over 13 "base pairs"), which exhibit a thermal denaturation temperature of 60.5 degrees C. The YPhi probes display up to 16-fold increases in fluorescence intensity at 380 nm upon hybridization with abasic target strands, whereby self-assembly of these complex architectures can be easily monitored. This study underlines the potential of N2'-functionalized 2'-amino-alpha-L-LNA as building blocks in nucleic acid based diagnostics and nanomaterial engineering.