SPOCC-194, a new high functional group density PEG-based resin for solid-phase organic synthesis

A novel polymer matrix for solid-phase synthesis, SPOCC(194) resin (1), was designed featuring a backbone of homogeneous tetraethylene glycol (TEG(194)) macromonomer linked by quaternary carbon junctions and terminating in primary alcohol functionality. Beaded SPOCC(194) resin was effectively prepared by suspension polymerization of oxetanylated TEG macromonomer 5 in stirred silicon oil. Mechanically stable and inert to a diverse range of reaction conditions, SPOCC(194) possessed a high hydroxyl group loading (0.9-1.2 mmol/g) for substrate attachment and swelled effectively ( approximately 2-4 mL/g) in a variety of organic and aqueous solvents. Developed for solid-phase synthesis at high reactant concentrations for driving organic and aqueous reactions to completion, SPOCC(194) exhibited high functional group density (mmol/mL) similar to that of low-loaded aminomethylated polystyrene-divinylbenzene copolymer (PS-1%DVB) yet significantly higher than that of PEGA(1900), SPOCC(1500), and TentaGel S. High-resolution MAS NMR spectra of Fmoc-derivatized SPOCC(194) indicate that monitoring of functional group transformation is possible. Moreover, by employment of a nonaromatic resin-linker combination, electrophilic chemistry, such as Lewis acid catalyzed glycosylation and Friedel-Crafts acylation, was selectively performed on substrate bound to SPOCC(194) resin. Such properties make SPOCC(194) resin a promising new polymer matrix for the support-bound construction of small organic molecules by parallel and combinatorial synthesis and the scavenging of solution-phase reactants or byproducts.     

A new safety-catch protecting group and linker for solid-phase synthesis

The use of two derivatives of 2-methoxy-4-methylsulfinylbenzyl alcohol is demonstrated as a safety-catch protecting group and linker for solid-phase peptide synthesis. The protecting group and linker are stable to TFA and are readily removed under reductive acidolytic conditions.     

Colorimetric tools for solid-phase organic synthesis

One of the unresolved problems of solid-phase organic synthesis (SPOS) is the availability of general and rapid methods to monitor the transformation of functional groups present in molecules supported on insoluble supports. Color tests, far from providing the ultimate solution, may help in detection (and sometimes in quantification) of different functional groups. In this short review, we have collected most of the methods available and applied in SPOS with an Experimental Section that describes the procedure we have successfully applied to bead analyses in our laboratories.     

Peptide synthesis by a combination of solid-phase and solution methods I: A new very acid-labile anchor group for the solid phase synthesis of fully protected fragments

The synthesis of a new polymeric support for the preparation of fully protected peptide fragments by the Fmoc/t-butyl method is described. Data for coupling yields and racemization data are given. Cleavage from the resin is performed by very mild acidolysis.¹     

O-Glycosyl trichloroacetimidates bearing Fmoc as temporary hydroxy protecting group: a new access to solid-phase oligosaccharide synthesis

Different O-glycosyl trichloroacetimidates bearing base sensitive Fmoc protected hydroxy groups were efficiently prepared with CCl(3)CN using a catalytic amount of sodium hydride. The resulting glycosyl donors were engaged in glycosylation reactions both in solution and on solid support with a new ester-type linker with good results. In both approaches, Fmoc groups were afterward quantitatively cleaved using mild basic conditions.     

Coordinate-bond-dependent solid-phase organic synthesis of biotinylated desferrioxamine B: a new route for metal-specific probes

Desferrioxamine B (DFOB) was biotinylated at the pendant amine using solid-phase organic synthesis (SPOS) on a matrix used conventionally for metal affinity chromatography. The strength of the DFOB-matrix coordinate bonds was functionally equivalent to a covalent bond which underpinned the veracity of the SPOS format. After washing excess reagents, biotin-DFOB was eluted from the matrix with water at pH 6.     

Nitro group as a new anchoring group for organic dyes in dye-sensitized solar cells

An organic dye JY1 bearing a nitro group was designed, synthesized and applied in DSCs. An unusual colour change was observed when the voltage applied to the device was reversed which was accompanied by a five-fold increase in the cell efficiency. We propose that applying a bias enabled the attachment of nitro groups to the TiO(2) surface.     

Polytetrahydrofuran cross-linked polystyrene resins for solid-phase organic synthesis

Currently, divinylbenzene cross-linked polystyrene (DVB-PS) is the polymer of choice for use in solid-phase organic synthesis (SPOS). While much research has been directed toward the optimization of linker groups for the attachment of compounds to the polymer, the development of new polymers themselves has been relatively neglected. In an attempt to overcome the shortcomings of DVB-PS and to develop new polymers with optimum properties for use in organic synthesis, we have prepared a series of polystyrene polymers that incorporate flexible polytetrahydrofuran (PTHF) based cross-linkers. The objective of incorporating PTHF into the polymers was to slightly increase the overall polarity of the polymer and thus render the resins more organic solvent-like. Since the degree to which a resin swells in and absorbs a particular solvent correlates to how well substrates attached to the polymer are solvated, we compared the swelling of our new resins to commercially available DVB-PS resins. In all cases, we found that our resins swelled to a much greater extent than do DVB-PS resins, and their use should therefore allow for SPOS reaction conditions that more closely mimic homogeneous solution-phase conditions. It was also found that the PTHF chain length of the cross-linker does not affect the level of swelling since all of our cross-linkers afford resins with comparable levels of increased swelling. Furthermore, we have examined the utility of our resins in directed ortho-metalation reactions and found that the increased swelling of our resins allows for isolation of reaction products in yields comparable to what is achieved using standard solution-phase conditions.     

Microwave-assisted solid-phase organic synthesis (MASPOS) as a key step for an indole library construction

[reaction: see text] Microwave-assisted solid-phase organic synthesis (MASPOS) has been demonstrated to significantly facilitate the Cu(II)- or Pd(II)-mediated ring closure of the resin-bound 2-alkynylanilides. Under microwave irradiation at 200 degrees C [for Cu(OAc)(2), NMP] or 160 degrees C [for Pd(MeCN)(2)Cl(2), THF] for 10 min, 1-acyl-2-alkyl-5-arenesulfamoylindoles were obtained, after cleavage from the resin, in 95-99% purities and in 65-82% overall yields via a 5-step synthetic sequence.     

The 2-(N-formyl-N-methyl)aminoethyl group as a potential phosphate/thiophosphate protecting group in solid-phase oligodeoxyribonucleotide synthesis

[reaction in text] The 2-(N-formyl-N-methyl)aminoethyl deoxyribonucleoside phosphoramidite 1 has been synthesized and used in the solid-phase synthesis of an octadecathymidylic acid as a cost-efficient monomer for potential application in the preparation of therapeutic oligonucleotides. The 2-(N-formyl-N-methyl)aminoethyl group can be cleaved from oligonucleotides according to a unique thermolytic cyclodeesterification process at pH 7.0. In addition to being cost-effective, the use of 1 simplifies oligonucleotide postsynthesis processing by eliminating the utilization of concentrated ammonium hydroxide in oligonucleotide deprotection.     

The ‘fully protected backbone’ approach as a versatile tool for a new solid-phase PNA synthesis strategy

The ‘fully protected backbone’ (FPB) strategy has been efficiently adapted to the solid-phase synthesis of homothymine, homocytosine and ‘mixed’ pyrimidine PNAs. This versatile and simple method avoids the preparation of PNA monomers and relies on easy available starting materials, highly efficient backbone elongations and effective nucleobase units condensations.     

A 'triflate-like' tetrafluoroarylsulfonate linker for multifunctional solid-phase organic synthesis

An arylsulfonate solid-phase linker is suitable for 'traceless' synthesis and Pd(0) catalyzed cross-coupling reactions.     

The preparation of a new "safety catch" ester linker for solid-phase synthesis

A new "safety catch" linker for esters has been synthesized on polystyrene resin. This 2-tert-butoxyphenol resin 10 may be acylated to give a relatively stable ester that will allow nucleophilic chemistry without reaction at the linking ester group. Removal of the tert-butyl group with acid unmasks a highly reactive 2-hydroxyphenyl ester that reacts readily with nucleophiles to cause release of the product from the resin. This sequence has been exemplified by acylating the resin with various bromo acids, carrying out nucleophilic displacements with thiols, phenols, or amines, activating the ester with trifluoroacetic acid and cleaving from the resin with amines to give the (nucleophile) substituted carboxamides in high yield and purity. Kinetic studies with a model ester revealed half-lives for reaction with morpholine of 119 h for the tert-butoxyphenyl ester and 1 min for the corresponding phenol.     

o-Nitrobenzoyl group as a new amino protecting group for peptide synthesis and the synthesis of some anthranilyl peptides

N (o-nitrobenzoyl)amino acids can be coupled with other amino acids using DCC and the resulting product on hydrogenation gives peptides, containing the anthranilyl group as —NH₂ end group. N (anthranilyl)amino acids or peptides can also be obtained by reaction of isatoic anhydride on amino acids or peptides. The anthranilyl end group is easily cleaved by metal (Cu⁺²) catalysed hydrolysis to give α-amino acid peptides and the insoluble copper(II) anthranilate.     

Nin-cyclohexyloxycarbonyl group as a new protecting group for tryptophan

Several new protecting groups were introduced at the Nⁱⁿ-position of tryptophan, and their reactivities were examined under the conditions used for peptide synthesis by Boc-strategy. Among them, the cyclohexyloxycarbonyl (Hoc) group was found to be the most suitable in terms of stability during elongation of the peptide chain and removability at the final HF reaction without resorting to the use of thiols.     

2-diphenylmethylsilylethyl group as a new protecting group of internucleotidic phosphates in oligonucleotide synthesis

Internucleotidic phosphates were protected by 2-diphenylmethylsilylethyl which was selectively removed by treatment with tetrabutylammonium fluoride.     

The 3-(N-tert-butylcarboxamido)-1-propyl group as an attractive phosphate/thiophosphate protecting group for solid-phase oligodeoxyribonucleotide synthesis

Among the various phosphate/thiophosphate protecting groups suitable for solid-phase oligonucleotide synthesis, the 3-(N-tert-butylcarboxamido)-1-propyl group is one of the most convenient, as it can be readily removed, as needed, under thermolytic conditions at neutral pH. The deprotection reaction proceeds rapidly (t(1/2) approximately 100 s) through an intramolecular cyclodeesterification reaction involving the amide function and the release of the phosphate/thiophosphate group as a 2-(tert-butylimino)tetrahydrofuran salt. Incorporation of the 3-(N-tert-butylcarboxamido)-1-propyl group into the deoxyribonucleoside phosphoramidites 1a-d is achieved using inexpensive raw materials. The coupling efficiency of 1a-d in the solid-phase synthesis of d(ATCCGTAGCTAAGGTCATGC) and its phosphorothioate analogue is comparable to that of commercial 2-cyanoethyl deoxyribonucleoside phosphoramidites. These oligonucleotides were phosphate/thiophosphate-deprotected within 30 min upon heating at 90 degrees C in Phosphate-Buffered Saline (PBS buffer, pH 7.2). Since no detectable nucleobase modification or significant phosphorothioate desulfurization occurs, the 3-(N-tert-butylcarboxamido)-1-propyl group represents an attractive alternative to the 2-cyanoethyl group toward the large-scale preparation of therapeutic oligonucleotides.     

Polymer-supported (2,6-dichloro- 4-alkoxyphenyl)(2,4-dichlorophenyl)methanol: a new linker for solid-phase organic synthesis

An acid and base stable hydroxytetrachlorodiphenylmethyl (HTPM) linker is developed for polymer-supported organic synthesis. The linkers reported here are utilized for loading carboxylic acids, amines, alcohols, and phenols, and are stable to Br?nsted and Lewis acids, Br?nsted bases, and a wide variety of nucleophiles. However, the HTPM linkers can conveniently be cleaved by the solvolytic displacement reactions with 20% TFA. [structure: see text]     

Diversity-oriented synthesis and solid-phase organic synthesis under controlled microwave heating

Diversity-oriented organic synthesis (DOS) and solid-phase organic synthesis (SPOS) are proven technologies for generating small molecule libraries for chemical genetics studies. Integration of controlled microwave heating with DOS and SPOS not only speeds up the library preparation process but also offers unique opportunities in tackling issues which are hardly addressed by thermal heating. Microwave-assisted synthesis is illustrated for (a) highly regioselective Wittig olefination of cycloalkanones by accurate regulation of temperature; (b) tandem Wittig-IMDA sequence toward stereochemical diversity of gamma-butyrolactones; (c) one-pot alkylation-amidation approach toward appendage diversity through use of building blocks; and (d) one-pot U-4CR-annulation strategy toward skeletal diversity via careful reaction design. Microwave-assisted solid-phase organic synthesis (MASPOS) is highlighted by incorporating with split-pool combinatorial synthesis (SPCS) of indole sulfonamides via a key on-resin Cu(II)- or Pd(II)-catalyzed heteroannulation under microwave heating. Design and fabrication of a novel diglycine-derived catlinker are described and its role in facilitating on-resin reaction is evaluated. A traceless synthesis of indole sulfonamides via microwave-assisted Cu(II)-catalyzed heteroannulation of the catlinker-tethered substrates is also given.