Thermolytic 4-methylthio-1-butyl group for phosphate/thiophosphate protection in solid-phase synthesis of DNA oligonucleotides

The thermolabile 4-methylthio-1-butyl phosphate/thiophosphate protecting group for DNA oligonucleotides has been investigated for its potential application to a "heat-driven" process for either oligonucleotide synthesis on diagnostic microarrays or, oppositely, to the large-scale preparation of therapeutic oligonucleotides. The preparation of phosphoramidites 10a-d is straightforward, and the incorporation of these amidites into oligonucleotides via solid-phase techniques proceeds as efficiently as that achieved with 2-cyanoethyl deoxyribonucleoside phosphoramidites. The versatility of the 4-methylthio-1-butyl phosphate/thiophosphate protecting group is exemplified by its facile removal from oligonucleotides upon heating for 30 min at 55 degrees C in an aqueous buffer under neutral conditions or within 2 h at 55 degrees C in concentrated NH(4)OH. The deprotection reaction occurs through an intramolecular cyclodeesterification mechanism leading to the formation of sulfonium salt 18. When mixed with deoxyribonucleosides and N-protected 2'-deoxyribonucleosides or with a model phosphorothioate diester under conditions approximating those of large-scale (>50 mmol) oligonucleotide deprotection reactions, the salt 18 did not significantly alter DNA nucleobases or desulfurize the phosphorothioate diester model to an appreciable extent.     

The 4-(N-dichloroacetyl-N-methylamino)benzyloxymethyl group for 2'-hydroxyl protection of ribonucleosides in the solid-phase synthesis of oligoribonucleotides

Emerging RNA-based technologies for controlling gene expression have triggered a high demand for synthetic oligoribonucleotides and have motivated the development of ribonucleoside phosphoramidites that would exhibit coupling kinetics and coupling efficiencies comparable to those of deoxyribonucleoside phosphoramidites. To fulfill these needs, the novel 4-(N-dichloroacetyl-N-methylamino)benzyloxymethyl group for 2'-hydroxyl protection of ribonucleoside phosphoramidites 9a-d has been implemented (Schemes 1 and 2). The solid-phase synthesis of AUCCGUAGCUAACGUCAUGG was then carried out employing 9a-d as 0.2 M solutions in dry MeCN and 5-benzylthio-1H-tetrazole as an activator. The coupling efficiency of 9a-d averaged 99% within a coupling time of 180 s. Following removal of all base-sensitive protecting groups, cleavage of the remaining 2'-[4-(N-methylamino)benzyl] acetals from the RNA oligonucleotide was effected in buffered 0.1 M AcOH (pH 3.8) within 30 min at 90 degrees C. RP-HPLC and PAGE analyses of the fully deprotected AUCCGUAGCUAACGUCAUGG were comparable to those of a commercial RNA oligonucleotide sharing an identical sequence. Enzymatic digestion of the RNA oligomer catalyzed by bovine spleen phosphodiesterase and bacterial alkaline phosphatase revealed no significant amounts of RNA fragments containing (2'-->5')-internucleotidic phosphodiester linkages or noteworthy nucleobase modifications.     

Assessment of 4-nitrogenated benzyloxymethyl groups for 2'-hydroxyl protection in solid-phase RNA synthesis

The search for a 2'-OH protecting group that would impart ribonucleoside phosphoramidites with coupling kinetics and coupling efficiencies comparable to those of deoxyribonucleoside phosphoramidites led to an assessment of 2'-O-(4-nitrogenated benzyloxy)methyl groups through solid-phase RNA synthesis using phosphoramidites 2a-d, 12a, and 14a. These phosphoramidites exhibited rapid and efficient coupling properties. Particularly noteworthy is the cleavage of the 2'-O-[4-(N-methylamino)benzyloxy]methyl groups in 0.1 M AcOH, which led to U19dT within 15 min at 90 degrees C. [reaction: see text]     

Synthesis of oligonucleotides with a 2'-cap at the 3'-terminus via reversed phosphoramidites

[reaction: see text] A method is presented for the synthesis of single compounds or small combinatorial libraries of oligonucleotides with 2'-acylamido-2'-deoxyuridine residues at the 3'-terminus. Selection experiments identified the residue of anthraquinone-2-carboxylic acid as a "molecular cap" that increases the UV melting point of the duplex (5'-ACGCGU-3')(2) by up to 28 degrees C compared to the unmodified control duplex.     

New reagent for the preparation of oligonucleotides involving a 5′-thiophosphate or a 5′-phosphate group

We report here a novel, simple reagent enabling the chemical incorporation of a thiophosphate or a phosphate group at the 5′-end of oligonucleotides using very mild basic deprotection conditions. This method can be useful in the case of alkali sensitive modified oligonucleotides. This reagent also gives access to the preparation of bifunctional oligonucleotides with either a thiophosphate group at the 5′-end and a phosphate at the 3′-end, or two thiophosphate groups at both the 5′- and the 3′-ends, or a 5′-thiophosphate group and a 3′-amino-containing linker.     

An efficient and versatile solid-phase synthesis of 5'- and 3'-conjugated oligonucleotides

[reaction: see text] An easy and efficient solid-phase strategy to obtain 5'- and 3'-oligonucleotide conjugates in highly pure form has been developed. Ad hoc derivatized solid supports, to which the first nucleoside unit can be attached through a phosphate linkage, have been exploited both in a pre- and post-DNA assembly conjugation approach. A number of 5'- or 3'- oligonucleotide conjugates, incorporating a variety of labels covalently linked through a phosphodiester or a phosphoramidate bond, have been synthesized and characterized.     

Syntheses of two 5-hydroxymethyl-2'-deoxycytidine phosphoramidites with TBDMS as the 5-hydroxymethyl protecting group and their incorporation into DNA

5-Hydroxymethylcytosine (5-hmC) is a newly discovered DNA base modification in mammalian genomic DNA that is proposed to be a major epigenetic mark. We report here the syntheses of two new versions of phosphoramidites III and IV from 5-iodo-2'-deoxyuridine in 18% and 32% overall yields, respectively, with TBDMS as the 5-hydroxyl protecting group. Phosphoramidites III and IV allow efficient incorporation of 5-hmC into DNA and a "one-step" deprotection procedure to cleanly remove all the protecting groups. A "two-step" deprotection strategy is compatible with ultramild DNA synthesis, which enables the synthesis of 5hmC-containing DNA with additional modifications.     

The N-vinyl group as a protection group of the preparation of 3(5)-substituted pyrazoles via bromine-lithium exchange

Treatment of 3,4,5-tribromopyrazole with 1,2-dibromoethane and triethylamine gave 3,4,5-tribromo-1-vinylpyrazole, which underwent regioselective bromine-lithium exchange at the 5-position. Subsequent addition of an electrophile gave 5-substituted 3,4-dibromo-1-vinylpyrazoles. These underwent bromine-lithium or bromine-magnesium exchange predominantly at the 4-position, with the regioselectivity between the 3- and 4-positions being influenced by the nature of the metal and the 5-substituent. The 5-substituted products were de-vinylated by mild treatment with KMnO₄ affording 3-substituted pyrazoles. Alternatively, the 1-vinyl group could be used in ring-closing metathesis. Thus, 5-allylthio-1-vinylpyrazole produced 5H-pyrazolo[5,1-b][1,3]thiazine upon treatment with Grubbs' second-generation catalyst.     

The pK(a) of the internucleotidic 2'-hydroxyl group in diribonucleoside (3'-->5') monophosphates

Ionization of the internucleotidic 2'-hydroxyl group in RNA facilitates transesterification reactions in Group I and II introns (splicing), hammerhead and hairpin ribozymes, self-cleavage in lariat-RNA, and leadzymes and tRNA processing by RNase P RNA, as well as in some RNA cleavage reactions promoted by ribonucleases. Earlier, the pK(a) of 2'-OH in mono- and diribonucleoside (3'-->5') monophosphates had been measured under various nonuniform conditions, which make their comparison difficult. This work overcomes this limitation by measuring the pK(a) values for internucleotidic 2'-OH of eight different diribonucleoside (3'-->5') monophosphates under a set of uniform noninvasive conditions by 1H NMR. Thus the pK(a) is 12.31 (+/-0.02) for ApG and 12.41 (+/-0.04) for ApA, 12.73 (+/-0.04) for GpG and 12.71 (+/-0.08) for GpA, 12.77 (+/-0.03) for CpG and 12.88 (+/-0.02) for CpA, and 12.76 (+/-0.03) for UpG and 12.70 (+/-0.03) for UpA. By comparing the pK(a)s of the respective 2'-OH of monomeric nucleoside 3'-ethyl phosphates with that of internucleotidic 2'-OH in corresponding diribonucleoside (3'-->5') monophosphates, it has been confirmed that the aglycons have no significant effect on the pK(a) values of their 2'-OH under our measurement condition, except for the internucleotidic 2'-OH of 9-adeninyl nucleotide at the 5'-end (ApA and ApG), which is more acidic by 0.3-0.4 pK(a) units.     

Suzuki coupling reaction for the solid-phase preparation of 5-substituted nicotinic acid derivatives

The application of the Suzuki coupling reaction to the preparation of small combinatorial libraries using 5-bromonicotinic acid as a scaffold onto three different types of solid support (Wang, Rink, and BAL resin) is described.     

Computational studies on the structures and energies of the tautomers of 1-amino-3-nitrotriazol-5-one-2-oxide

Molecular orbital calculations at the DFT-B3LYP/aug-cc-pVDZ level were performed for the possible tautomers of 1-amino-3-nitro-1,2,4-triazol-5-one-2-oxide. We have examined the substitution effects of amino and nitro groups by comparing calculated geometries, relative energies, and electrostatic potentials of model molecules. The optimized structures, vibrational frequencies, and thermodynamic values for triazol-5-one-N-oxides were obtained in their ground state. The results show 1H, 4H tautomers to be most stable. Detonation velocity and detonation pressure were evaluated by the Kamlet and Jacob equations based on the predicted density and the calculated heat of explosion. Explosive properties appear to be promising compared with those of 1,3,5-trinitro-1,3,5-triazine (D = 8.75 km/s, P = 34.7 Gpa) and octahydro-1,3,5,7-tetranitro-1,3,5,7-tetrazocine (D = 8.96 km/s, P = 35.96 Gpa), 2,4,6,8,10,12-hexanitro-2,4,6,8,10,12-hexaazaisowurtzitane (D = 9.20 km/s, P = 42.0 Gpa) and octanitrocubane (D = 9.90 km/s, P = 48.45 GPa). The designed triazol-5-one-N-oxides satisfy the criteria of high energy density materials.     

A convenient synthesis of the cytidyl 3′-terminal monomer for solid-phase synthesis of RNG oligonucleotides

Replacing the phosphodiester backbone of RNA with positively charged guanidinium linkages has been shown to enable RNA oligomers to overcome electrostatic repulsion and bind double-stranded DNA in a triplex with high affinity. Ribonucleotide monomers with the ability to form guanidinium linkages have been synthesized for the generation of ribooligonucleotides with guanidinium linkages (RNGs) through solid-phase synthesis. We report herein an efficient method for the synthesis of N⁴-benzoyl-2′-O-(tert-butyldimethylsilyl)-5′-N-(4-monomethoxytritylamino)-3′-O-succinyl-5′-deoxycytidine, a new monomer required for the solid-phase synthesis of cytidyl RNG oligonucleotides.     

New phosphoramidite derivatives for the preparation of oligonucleotides containing a hydrazide group in any specified position of the oligonucleotide chain

A new versatile method for the preparation of oligonucleotides containing hydrazide groups in any position of the oligonucleotide chain by standard phosphoramidite automated oligonucleotide synthesis is proposed. The method is based on the use of a series of new modified components for oligonucleotide synthesis. An original protecting group for the hydrazide group is proposed. The presence of the hydrazide group in the obtained oligonucleotides and its high reactivity were demonstrated by the reaction with 4-methoxybenzaldehyde in solution. Published in Russian in Izvestiya Akademii Nauk. Seriya Khimicheskaya, No. 11, pp. 2585–2595, November, 2005.     

A new method for the preparation of modified oligonucleotides

[reaction-see text] N-Nitrothymidine can be transformed into a phosphoramidite building block suitable for oligonucleotide synthesis using the standard phosphite triester solid-phase approach. The N-nitrothymidine residues remain stable during the elongation cycles and react smoothly with primary amines, furnishing oligonucleotides containing N3-modified thymidines. A number of N3-substituted oligonucleotides have been prepared using this methodology, some of them incorporating aminoalkyl or hydroxyalkyl groups.     

Tandem oligonucleotide synthesis on solid-phase supports for the production of multiple oligonucleotides

More than one oligonucleotide can be synthesized at a time by linking multiple oligonucleotides end-to-end in a tandem manner on the surface of a solid-phase support. The 5'-terminal hydroxyl position of one oligonucleotide serves as the starting point for the next oligonucleotide synthesis. The two oligonucleotides are linked via a cleavable 3'-O-hydroquinone-O,O'-diacetic acid linker arm (Q-linker). The Q-linker is rapidly and efficiently coupled to the 5'-OH position of immobilized oligonucleotides using HATU, HBTU, or HCTU in the presence of 1 equiv of DMAP. This protocol avoids introduction of phosphate linkages on either the 3'- or 5'-end of oligonucleotides. A single NH(4)OH cleavage step can simultaneously release the products from the surface of the support and each other to produce free 5'- and 3'-hydroxyl termini. Selective cleavage of one oligonucleotide out of two sequences has also been accomplished via a combination of succinyl and Q-linker linker arms. Tandem synthesis of multiple oligonucleotides is useful for producing sets of primers for PCR, DNA sequencing, and other diagnostic applications as well as double-stranded oligonucleotides. Tandem synthesis of the same sequence multiple times increases the yield of material from any single synthesis column for maximum economy in large-scale synthesis. This method can also be combined with reusable solid-phase supports to further reduce the cost of oligonucleotide production.