The equations of a holomorphic subspace in a complex Finsler space

In [Mu1] we underlined the motifs of holomorphic subspaces in a complex Finsler space: induced nonlinear connection, coupling connections, and the induced tangent and normal connections. In the present paper we investigate the equations of Gauss, H-and A-Codazzi, and Ricci equations of a holomorphic subspace. We deduce the link between the holomorphic curvatures of the Chern-Finsler connection and its induced tangent connection. Conditions for totally geodesic holomorphic subspaces are obtained. Communicated by János Szenthe     

Multiple solutions of boundary value problems: an elementary approach via the shooting method

In this paper we derive the existence of multiple solutions for boundary value problems of the type $$u\prime \prime + f\left( {t,u} \right) = 0,u\left( 0 \right) = 0,u\left( \pi \right) = 0$$ , in terms of the behaviour of the ratiof(t,u)/u nearu=0 and near infinity. The nonlinear termf is assumed to be locally Lipschitz inu, so that the shooting method can be used. (AMS Subject Classification: 34B15).     

Probing hydrogen bonding in a DNA triple helix using protium-deuterium fractionation factors

In this communication we report protium-deuterium fractionation factors for the intramolecular triple helix formed by the DNA oligonucleotide 5'-d(AGAGAGAACCCCTTCTCTCTTTTTCTCTCTT)-3'. The fractionation factors of individual Watson-Crick and Hoogsteen hydrogen bonds in the structure are measured by NMR spectroscopy. The results show that, in contrast to proteins, the fractionation factors are all equal or lower than unity. On the average, the values of the fractionation factors are centered between 0.6 and 0.8, and no significant differences are observed between Hoogsteen and Watson-Crick hydrogen bonds. Deviations from the average are observed for the 5'-end region of the molecule where a base triad is absent and the structure is strained by the intramolecular folding of the DNA strand.     

Preparation and characterisation of thermoresponsive poly[(N-isopropylacrylamide-co-acrylamide-co-(hydroxyethyl acrylate)] microspheres as a matrix for the pulsed release of drugs

Despite the large number of publications and patents concerning pH/thermoresponsive polymers, few data are available concerning the preparation of thermoresponsive cross-linked microspheres from preformed polymers. Therefore, N-isopropylacrylamide-co-acrylamide-co-(2-hydroxyethyl acrylate) copolymers were obtained as a new thermoresponsive material with a lower critical solution temperature (LCST) around 36 degrees C, in phosphate buffer at pH 7.4, and with a cross-linkable OH group in their structure. The LCST value was determined both by UV spectroscopy and microcalorimetric analysis. These copolymers were solubilised in acidified aqueous solution below their LCST, dispersed in mineral oil, and transformed into stable microspheres by cross-linking with glutaraldehyde. The thermoresponsive microspheres were characterised by optical and scanning electron microscopy, degree of swelling, and water retention. The pore dimensions of the microspheres and the retention volumes of some drugs and typical compounds were evaluated at different temperatures by liquid chromatography. Indomethacin, as a model drug, was included in the microspheres by the solvent evaporation method. Finally, the influence of temperature and of temperature cycling on drug release was investigated.     

Photometrische Bestimmung von Kohlenmonoxyd in der Luft

Zusammenfassung Es wird ein photometrisches Verfahren der CO-Bestimmung beschrieben, das auf der Absorption des Gases in einer alkalischen Lösung der Silberverbindung der p-Sulfamidbenzoesäure beruht. Die Silberverbindung wird zu metallischem Silber reduziert, das in kolloider Verteilung bleibt. Die Extinktion dieses Silbersols wird gemessen. Sie ist unter den Bedingungen der Arbeitsvorschrift im Bereich von 0,001–0,5% CO der Konzentration des Kohlenmonoxyds proportional. Bei Wellenlängen unterhalb 500 m nimmt die Extinktion stark zu. Die Messungen werden deshalb zweckmäßig im kurzwelligen Licht durchgeführt. Mit Zeiss-Filter S 42 wird z. B. nahezu die doppelte Meßempfindlichkeit erreicht wie mit Filter S 50. Die Durchführung der CO-Bestimmung wird genau beschrieben.     

HPLC monitored synthesis of R2NCH2 substituted benzene derivatives used as (C,N)-ligands for organometallic compounds

2-(Diethylaminomethyl)phenyl bromide and 1,3-bis(dimethylaminomethyl)-benzene, useful ligands for the synthesis of hypervalent organometallic compounds, were prepared and characterized by NMR (¹H, ¹³C, 2D experiments) spectroscopy. Their synthesis was monitored by the HPLC method. The compounds were eluted on a Nucleosil 120 Si column (5 μm, 25×0.4 cm) with n-hexane at room temperature using a 1.0 ml/min flow-rate. The maximum values of absorbance for the studied compounds, excepting the diethylamine, were located in a narrow range around 212 nm, the wavelength used for their UV detection. The diethylamine was detected at 190 nm. The calibration curves are straight lines with correlation factors r>0.995. The HPLC data are in good agreement with those provided by NMR spectroscopy.     

Model-based sensitivity analysis of a fluidised-bed bioreactor for mercury uptake by immobilised Pseudomonas putida cells

A model-based sensitivity analysis was performed in order to evaluate the importance of the individual operating parameters of a three-phase fluidised-bed biological reactor used for removing mercury ions from wastewater. The parameters analysed involve the immobilised biomass load (bacteria P. putida) on alginate beads, particle size, inlet flow-rate, mercury ion loads in the fed wastewater, and the solid fraction in the reactor. Predictions were generated by using pseudo-first-order, Michaelis-Menten, or pseudo-Haldane kinetic models. The results highlight the major influence of the biomass/solid load and of the liquid residence time on the reactor efficiency. Also, the resultant significant differences in the model predictions underline the importance of using a more accurate kinetic model for process design and control purposes.     

The Vapor-Liquid Polycondensation of Cyclohexylphosphoric Dichloride with Hydroquinone

The vapor-liquid polycondensation of cyclohexylphosphoric dichloride with hydroquinone was investigated. The influence of the temperature, reaction time, base concentration, and molar ratio of reagents on the yield, inherent viscosity, and molecular weight of the obtained polymer was studied. Second order, central, composite, rotatable experimental design was used in order to carry out this work and to mark limits of the experimental field for optimal yields and high inherent viscosities.     

Geometrical and dynamical properties of general Euler top system

In this paper we present various geometrical and dynamical properties of the Euler top system in general form. Also the stability problem for the equilibrium states of them are discussed.     

Homogenization heat treatment and segregation analysis of equiaxed CMSX-4 superalloy for gas turbine components

Journal of Thermal Analysis and Calorimetry - Two new zinc(II) coordination compounds have been synthesized by the reaction of diazine-ring containing Schiff bases di(2-pyridyl) ketone...