An effective green and ecofriendly catalyst for synthesis of bis(indolyl)methanes as promising antimicrobial agents

An effective and suitable meglumine‐catalyzed high‐yielding process was considered and engaged for the synthesis of new bis(indolyl)methanes at ambient temperature under aqueous conditions. The catalytic reaction proceeds very smoothly. Clean reaction, ease of product isolation/purification, easily available reactant and ecofriendly reaction conditions are the notable advantages of the present methodology. All the title compounds were characterized by IR, 1H, ¹³C NMR, and mass spectra. All the synthesized compounds were tested for antimicrobial activity, and the results indicated that most of the synthesized compounds exhibited excellent activity against the tested microorganisms. In this new series, compound 3l , having nitro substituent on the aromatic ring, showed exceptional potent inhibitory activity against Pseudomonas aeruginosa and Penicillium chrysogenum.     

Synthesis of a New Class of Sulfonamido Bis Heterocycles—Pyrrolyl/Pyrazolyl‐1,3,4‐oxadiazoles, 1,3,4‐Thiadiazoles,and 1,2,4‐Triazoles

A new class of sulfonamido bis heterocycles—pyrrolyl/pyrazolyl‐oxadiazoles, thiadiazoles, and triazoles—were prepared from arylaminosulfonylacetic acid hydrazide and E‐aroylethenesulfonylacetic acid adopting simple and versatile synthetic methodologies.     

Development and validation of a HPLC method for quantification of rivastigmine in rat urine and identification of a novel metabolite in urine by LC‐MS/MS

A sensitive, specific and accurate HPLC method for the quantification of rivastigmine (RSM) in rat urine was developed and validated. The method involves the simple liquid–liquid extraction of RSM and pyridostigmine as an internal standard (IS) from rat urine with tertiary methyl butyl ether. The chromatographic separation of RSM and IS was achieved with 20 mm ammonium acetate buffer (pH 6.5) and acetonitrile (65:35, v/v) delivered at flow‐rate of 1 mL/min on a Kromasil KR‐100. The method was in linear range from 50 to 5000 ng/mL. The validation was done as per FDA guidelines and the results met the acceptance criteria. The method was successfully applied for the quantification of RSM in rat urine. Besides method validation, we have identified two metabolites of RSM in urine. Both the metabolites were characterized by HPLC‐PDA and LC‐MS/MS and it was found that one metabolite is novel. Copyright © 2010 John Wiley & Sons, Ltd.     

Box–Behnken Design-Based Development and Validation of a Reverse-Phase HPLC Analytical Method for the Estimation of Paclitaxel in Cationic Liposomes

Chromatographia - Stability-indicating reverse-phase HPLC analytical method for the quantification of Paclitaxel (PTX) in the bulk and cationic liposomes was developed. The optimized method was...     

Stereoselective total synthesis of (−)-brevisamide

The stereoselective total synthesis of (−)-brevisamide, a novel marine cyclic ether alkaloid isolated from dinoflagellate karenia brevis is described. The key steps involved in this synthesis are the Sharpless asymmetric epoxidation and regioselective ring opening of chiral epoxide by Gilman's reagent. The tetrahydropyran core has been constructed by an intramolecular S_N2 cyclisation.     

Adsorption of Pb(2+) ions on nanosized gamma-Fe(2)O(3): formation of surface ternary complexes on ligand complexation

Adsorption of Pb²⁺ ions on the combustion derived nanosized γ-Fe₂O₃ and its thiourea complex composite is reported. The adsorbents upon adsorption of Pb²⁺ ions are characterised by X-ray diffraction, scanning electron microscopy, energy dispersive X-ray microanalysis and infrared spectroscopy techniques. The eluent is characterised by atomic absorption spectroscopy for the estimation of Pb²⁺ ions. The reduction in the amount of lead after adsorption was estimated to be around 50% in case of complex composite adsorbent and around 15% in case of the γ-Fe₂O₃ adsorbents. Orthorhombic PbSO₄ precipitated out from the eluent and is reported with a model reaction. Adsorption of lead onto the complex composite is explained through the formation of a surface tertiary complex. The advantage of employing a thiourea-γ-Fe₂O₃ complex composite as solid adsorbent for the adsorption of heavy metal pollutants is envisaged in the present investigation.     

Direct spectrophotometric method for the determination of cobalt with indane 1,2,3-trionetrioxime in aqueous medium

A simple, sensitive and selective Spectrophotometric method has been developed for the determination of cobalt using indane 1,2,3-trionetrioxime (ITT): The method is based on the colour reaction between ITT and cobalt(II) in sodium acetate-acetic acid buffer (pH 4.5–7.5) medium. The calibration graph for measurement at 320 nm is linear in the range 1.18–23.60g of cobalt per 25 ml, with molar absorptivity of 5.32×10⁴1mol^–1 cm^–1. The effect of interfering ions has been studied and the method was applied to the determination of cobalt in alloys, with good results.     

Solid-phase synthesis of positively charged deoxynucleic guanidine (DNG) tethering a Hoechst 33258 analogue: triplex and duplex stabilization by simultaneous minor groove binding

Deoxynucleic guanidine (DNG), a DNA analogue in which positively charged guanidine replaces the phosphodiester linkages, tethering to Hoechst 33258 fluorophore by varying lengths has been synthesized. A pentameric thymidine DNG was synthesized on solid phase in the 3' --> 5' direction that allowed stepwise incorporation of straight chain amino acid linkers and a bis-benzimidazole (Hoechst 33258) ligand at the 5'-terminus using PyBOP/HOBt chemistry. The stability of (DNA)(2).DNG-H triplexes and DNA.DNG-H duplexes formed by DNG and DNG-Hoechst 33258 (DNG-H) conjugates with 30-mer double-strand (ds) DNA, d(CGCCGCGCGCGCGAAAAACCCGGCGCGCGC)/d(GCGGCGCGCGCGCTTTTTGGGCCGCGCGCG), and single-strand (ss) DNA, 5'-CGCCGCGCGCGCGAAAAACCCGGCGCGCGC-3', respectively, has been evaluated by thermal melting and fluorescence emission experiments. The presence of tethered Hoechst ligand in the 5'-terminus of the DNG enhances the (DNA)(2).DNG-H triplex stability by a DeltaT(m) of 13 degrees C. The fluorescence emission studies of (DNA)(2).DNG-H triplex complexes show that the DNG moiety of the conjugates bind in the major groove while the Hoechst ligand resides in the A:T rich minor groove of dsDNA. A single G:C base pair mismatch in the target site decreases the (DNA)(2).DNG triplex stability by 11 degrees C, whereas (DNA)(2).DNG-H triplex stability was decreased by 23 degrees C. Inversion of A:T base pair into T:A base pair in the center of the binding site, which provides a mismatch selectively for DNG moiety, decreases the triplex stability by only 5-6 degrees C. Upon hybridization of DNG-Hoechst conjugates with the 30-mer ssDNA, the DNA.DNG-H duplex exhibited significant increase in the fluorescence emission due to the binding of the tethered Hoechst ligand in the generated DNA.DNG minor groove, and the duplex stability was enhanced by DeltaT(m) of 7 degrees C. The stability of (DNA)(2).DNG triplexes and DNA.DNG duplexes is independent of pH, whereas the stability of (DNA)(2).DNG-H triplexes decreases with increase in pH.